| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
B
and IBß and Sustained Activation of Nuclear Factor-B/c-Rel
*
Department of Internal Medicine and Interdisciplinary Immunology Program, University of Iowa College of Medicine, Iowa City, IA 52242; and
Department of Veterans Affairs, Iowa City, IA 52246
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B p50/c-Rel heterodimers followed by a
decline of p50/c-Rel heterodimers by 3 h and a concomitant
increase of p50/p50 homodimers. In contrast, CpG DNA induced and
maintained the levels of p50/c-Rel heterodimers in the presence or
absence of anti-IgM, while control non-CpG DNA failed to induce
NFB activation. Anti-IgM induced IB
degradation followed by
increased IB protein levels. The levels of IBß were
increased after anti-IgM treatment. In contrast, CpG DNA, but not
non-CpG DNA, induced sustained IB and IBß degradation in the
presence or absence of anti-IgM. Inhibition of IB degradation
blocked CpG DNA-induced NFB activation and expression of
c-myc. Prevention of NFB activation by inhibiting
IB degradation also suppressed the ability of CpG DNA to rescue
WEHI-231 cells from anti-IgM-induced apoptosis. These results
indicate that CpG DNA-mediated sustained activation of NFB depends
on the degradation of IB and IBß and is required for the CpG
DNA-mediated anti-apoptosis gene expression and the protection
against anti-IgM-induced apoptosis of WEHI-231 cells. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
After the cross-linking of surface Ag receptor on WEHI-231 cells, the
expression of c-myc gene is rapidly increased and then
declines below basal level (7, 8). Even though the meaning of this
initial increase of c-myc expression after Ag receptor
cross-linking is currently not understood, the following decline of
c-myc expression may have a role in anti-IgM induced
growth arrest and apoptosis of WEHI-231 cells (6, 7, 8, 9). Recent studies
from several laboratories also indicate that the altered
c-myc and bcl-xL
expression plays an important role in the regulation of apoptosis in
WEHI-231 cells (6, 10, 11, 12). Sonenshein and colleagues (13, 14)
demonstrated that NFB is a critical regulator of c-myc
expression and that the suppression of c-myc expression by
inhibiting NFB activation actually leads to apoptosis of WEHI-231
cells. More recently, Schauer et al. (15) suggested that CD40 ligand
(CD40L)3 rescue of WEHI-231
cell apoptosis is related to the maintenance of c-myc
expression by inducing NFB through modulation of IB proteins.
Recent studies have demonstrated that unmethylated CpG dinucleotides in
particular base contexts (CpG motif) present in bacterial DNA and in
certain synthetic oligodeoxynucleotides (CpG DNA) promote B cell
proliferation; secretion of various cytokines such as IL-6, IL-10,
IL-12, TNF-, and IFN-
from B cells, macrophages, and NK cells;
and subsequent Ig secretion
(16, 17, 18, 19, 20, 21, 22).4 CpG DNA synergizes
with Ag receptor-mediated signals to increase IL-6 and Ig secretion and
cell proliferation (16, 22). The molecular mechanisms by which CpG DNA
mediates leukocyte activation are not clearly understood at the present
time. However, our recent studies suggest that CpG DNA induced B cell
proliferation and production of various cytokines are mediated via a
rapid generation of intracellular reactive oxygen species (ROS), which
probably will lead to NFB activation
(22).5
Like CD40L and LPS, CpG DNA protects mature splenic B cells from
spontaneous apoptosis and rescues WEHI-231 cells from growth arrest and
apoptosis induced by surface Ag receptor cross-linking
(8).6 In this connection, the
goal of the present study is to evaluate the effect of CpG DNA
treatment on NFB activation in the presence of anti-IgM and
whether the CpG DNA-mediated NFB activation plays a role in the CpG
DNA rescue of the anti-IgM-induced apoptosis of WEHI-231 cells. Our
results indicate that CpG DNA induces the persistent activation of
NFB (p50/c-Rel) in WEHI-231 cells in the presence or absence of
anti-IgM. This persistent NFB activation is preceded by IB
and IBß degradation and is required for the maintenance of
expression of c-myc, which in turn protects WEHI-231 cells
from anti-IgM-induced apoptosis.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Nuclease-resistant phosphorothioate oligodeoxynucleotides (S-ODN) were purchased from Oligos Etc. (Wilsonville, OR). All S-ODN were purified by ethanol precipitation. The LPS level in S-ODN was <0.2 ng/mg of ODN by Limulus assay. S-ODN was used at 0.5 to 1 µM to prevent the anti-IgM-induced apoptosis of WEHI-231 cells. Sequences of S-ODN used are 5'TCCATGACGTTCCTGACGTT3' (CpG DNA: 1826) and 5'TCCAGGACTTTCCTCAGGTT3' (non-CpG DNA: 1911).
Culture conditions and reagents
A murine B lymphoma, WEHI-231 cells (American Type Culture Collection (ATCC), Rockville, MD) were cultured at 37°C in a 5% CO2 humidified incubator and maintained in RPMI 1640 (Life Technologies, Gaithersburg, MD) supplemented with 10% (v/v) heat-inactivated FCS (Sigma Chemical Co., St. Louis, MO), 1.5 mM L-glutamine, 50 µM 2-ME, 100 U/ml penicillin, and 100 µg/ml streptomycin. Rabbit polyclonal anti-mouse IgM (µ-chain specific) was purchased from Sigma Chemical Co. and used at 2 to 10 µg/ml to induce growth inhibition and apoptosis. Anti-murine CD40 Ab was purchased from PharMingen (San Diego, CA) and used at 1 to 2 µg/ml.
Preparation of RNA and RNase protection assay (RPA)
WEHI-231 cells (2 x 106 cells/ml) were treated with or without CpG or non-CpG DNA (1 µM) in the presence or absence of anti-IgM (10 µg/ml). In some experiments, cells were pretreated with pyrrolidine dithiocarbamate (PDTC) (25 µM), N-tosyl-L-phenylalanine chloromethyl ketone (TPCK) (30 µM), gliotoxin (0.1 µg/ml), or bis-gliotoxin (0.1 µg/ml) for 2 h before addition of anti-IgM and/or CpG or non-CpG DNA (1 µM). Cells were harvested 9 h after anti-IgM and DNA treatments and total RNA was isolated by using RNAzol B (Tel-test Inc., Friendswood, TX) following the manufacturer’s protocol. c-myc and L32 mRNA was detected using the RPA as previously described (23). Equivalent amounts of RNA were examined, as judged by the amount of L32, which encodes a ubiquitously expressed ribosome subunit protein (24), in each sample. The GeneBank accession numbers and nucleotide sequences for these genes were previously described (8).
Preparation of whole cell lysates, cytoplasmic extracts, and nuclear extracts
Log phase WEHI-231 cells (2 x 106
cells/ml) were treated with medium, CpG, or non-CpG DNA (1 µM) in the
presence or absence of anti-IgM (10 µg/ml). In some experiments,
cells were treated with various inhibitors 2 h before the
stimulation with anti-IgM and/or DNA. Cells were harvested at
various time points (0.5 to 8 h) and washed three times with
ice-cold PBS. Whole cell lysates were prepared as previously described
(8). The nuclear extracts and cytoplasmic extracts were prepared as
follows: The washed cells were resuspended and incubated in buffer A
(10 mM HEPES, pH 7.5, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 0.5 mM DTT,
0.5 mM PMSF, and 2 µg/ml aprotinin) for 15 min on ice, and 10% SDS
was added to a final concentration of 0.1%. The cell suspension was
vortexed for 10 s and centrifuged. After the centrifugation, the
supernatant (cytoplasmic extract) was transferred into a fresh tube and
kept at -70°C until analyzed for IB by Western blot. The pelleted
nuclei were resuspended in buffer B (20 mM HEPES, pH 7.5, 0.45 M NaCl,
1 mM EDTA, 1 mM EGTA, 50 mM NaF, 20% glycerol, 1 mM DTT, 1 mM PMSF,
and 2 µg/ml aprotinin), incubated for 1 h at 4°C and then
centrifuged for 30 min at 4°C to remove insoluble debris. The
supernatant (nuclear extract) was kept at -70°C until analyzed.
Electrophoretic mobility shift assay (EMSA)
Oligonucleotides containing the B sequence from -intronic
enhancer (5'GTAGGGGACTTTCCGAGCTCGAGATCCTATG3') (25), or NFB URE
(5'TGCAGGAAGTCCGGGTTTTCCCCAACCCCCC3') (26) from c-myc
promoter region was end labeled using T4 kinase (New England Biolabs,
Beverly, MA) and [-32P]dATP (Amersham, Arlington
Heights, IL). 32P-Labeled probes (20,000 cpm) were mixed
with 10 µg of whole cell lysates or 3 µg of nuclear extracts in a
final volume of 10 µl of the binding buffer (0.5% BSA, 110 mM HEPES,
pH 7.9, 30% glycerol, 350 mM KCl, 0.25 mM EDTA, 0.125% Nonidet P-40,
11 mM DTT, and 0.4 mM PMSF) and incubated for 30 min at room
temperature. Specificity of the NFB bands was confirmed by
competition studies with cold oligonucleotides with NFB or other
unrelated transcription factor-binding sites (data not shown). For
supershift assay, 2 µg of specific Abs for p50, p52, Rel A, Rel B,
and c-Rel (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) were added
into the reaction mixture for 30 min before the radiolabeled probe was
added. The mixture was loaded on a native 6% polyacrylamide gel, and
electrophoresed using 0.5x Tris-borate-EDTA running buffer (90 mM
Tris, 90 mM boric acid, 2 mM EDTA, pH 8.0). The gels were dried and
then autoradiographed.
Western blot analysis
Equal concentrations of cell lysates were boiled in SDS sample
buffer for 4 min before being subjected to electrophoresis on a 12%
polyacrylamide gel containing 0.1% SDS (SDS-PAGE). After
electrophoresis, proteins were transferred to Immobilon-P transfer
membranes (Millipore Corp., Bedford, MA). Blots were blocked with 5%
nonfat dry milk, and murine IB or IBß protein was detected
with anti-IB or anti-IBß (Santa Cruz Biotechnology,
Inc.), respectively. Blots were developed in enhanced chemiluminescence
reagent (Amersham, Arlington Heights, IL) according to the
manufacturer’s recommended procedure.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B in the
anti-IgM- treated WEHI-231 cells.
Recent studies have demonstrated that CpG DNA rapidly induces
NFB activation in murine spleen B cells5 and in several
macrophage cell lines (20, 40).5 We evaluated whether the
CpG DNA itself induces NFB activation and/or alters the
anti-IgM-mediated NFB activation in WEHI-231 cells. WEHI-231
cells were treated with medium, anti-IgM, and/or CpG or non-CpG
DNA. The DNA-binding activity of NFB was analyzed by EMSA with
radiolabeled B binding element as a probe. The components of NFB
were identified by supershift with specific Abs to murine Rel A (p65),
Rel B, c-Rel, p50, and p52 (data not shown). As shown in Figure 1
and previous studies (27, 28), NFB
was constitutively activated in WEHI-231 cells, and the major component
of NFB was p50/c-Rel heterodimer. A minimal amount of p50/p50
homodimer was also present in WEHI-231 cells under normal culture
conditions (27) (Fig. 1). CpG DNA, but not control non-CpG DNA,
activated NFB composed of p50/c-Rel heterodimer within 30 min in
WEHI-231 cells (Fig. 1A). As demonstrated in Figure 1B, the levels of p50/c-Rel heterodimer were increased
within 30 min after Ag receptor cross-linking by anti-IgM. These
high levels of p50/c-Rel heterodimer were maintained until 1 h
after anti-IgM treatment. However, the levels of p50/c-Rel
heterodimer were decreased within 3 h after Ag receptor
cross-linking and followed by continuous decline of this p50/c-Rel
heterodimer and simultaneous increases of the levels of p50/p50
homodimer. No NFB binding activity was detected at 16 h after
stimulation with anti-IgM (data not shown). In contrast, CpG DNA
elevated and sustained the levels of p50/c-Rel heterodimer in the
presence of anti-IgM without affecting anti-IgM-mediated
p50/p50 homodimer formation (Fig. 1B). The levels of
p50/c-Rel heterodimer at 16 h after CpG DNA stimulation in the
presence of anti-IgM were comparable to the normal unstimulated
control level (data not shown). The control non-CpG DNA did not affect
either the anti-IgM-mediated p50/p50 homodimer formation or
inhibition of p50/c-Rel heterodimer formation (Fig. 1B).
|
B and
IBß after Ag cross-linking in WEHI-231 cells
Previous studies demonstrated that rapid proteolysis of IB is
involved in the regulation of both transient and sustained NFB
activation (29, 30, 31). However, recent studies indicated that NFB
activation could occur without IB degradation (32). We evaluated
whether CpG DNA-mediated sustained activation of p50/c-Rel correlates
with an enhanced or sustained degradation of IB family members in
the presence or absence of anti-IgM in WEHI-231 cells. A Western
blot assay of either cytoplasmic extracts or whole cell lysates was
performed using the specific Abs against murine IB or IBß.
As shown in Figures 2 and 3, the
concentrations of IB and IBß were low in WEHI-231 cells
under normal culture conditions. Anti-IgM induced slight decreases in
IB protein levels within 15 min, but the IB level was back
to the normal unstimulated level by 1 h and then increased
thereafter (Fig. 2A and data not shown). CpG DNA treatment
induced decreases in the levels of IB within 15 min in the
presence or absence of anti-IgM and these decreased levels of
IB were sustained through 9 h after treatment (Fig. 2 and
data not shown). In contrast, non-CpG DNA did not induce degradation of
IB in the presence of anti-IgM (Fig. 2). The protein levels
of IBß in WEHI-231 cells were increased within 30 min after
anti-IgM or the combination of anti-IgM and non-CpG DNA
treatments (Fig. 3A).
In contrast, CpG DNA prevented the accumulation of IBß induced by
anti-IgM in WEHI-231 cells (Fig. 3A). CpG DNA
alone induced degradation of IBß within 30 min, and this decreased
level of IBß was maintained through 8 h after the treatment
(Fig. 3B and data not shown). The control non-CpG DNA alone
did not alter IBß level (Fig. 3B).
|
|
B degradation suppresses CpG DNA-mediated NFB
p50/c-Rel activation
To confirm whether the CpG DNA-mediated sustained NFB
activation depended on the degradation of IB, several known
inhibitors of IB degradation were added to WEHI-231 cells. A
reducing thiol agent that inhibits degradation of IB and
IBß, PDTC (30), inhibited CpG DNA-mediated sustained activation of
p50/c-Rel in the presence or absence of anti-IgM in WEHI-231 cells
(Fig. 4 and data not shown). TPCK, a
serine/threonine protease inhibitor that prevents proteolysis of
IB and IBß (29, 30), or gliotoxin, a fungal toxin that
inhibits IB degradation (33), also inhibited CpG DNA-mediated
sustained activation of p50/c-Rel in the presence or absence of
anti-IgM as well as inhibited the constitutive activation of NFB
in WEHI-231 cells (Fig. 4 and data not shown). Bis-gliotoxin, an
inactive congener of gliotoxin (33), showed no effect on NFB
activation under our experimental conditions (Fig. 4 and data not
shown). At the time of harvest, no apparent cell death was observed by
trypan blue stain after treatments with the above inhibitors at the
concentrations used for these experiments (data not shown).
|
B activation by preventing IB degradation
suppresses CpG DNA-mediated c-myc expression
To examine the possible consequences of inhibition of NFB
activation on gene expression in WEHI-231 cells, we prepared RNA from
WEHI-231 cells treated with PDTC, gliotoxin, or bis-gliotoxin in the
presence or absence of CpG DNA and/or anti-IgM and analyzed these
samples using multiprobe RPA. As shown in Figure 5 and in our previous study (8), great
decreases in the level of c-myc mRNA were observed in the
presence of anti-IgM. Addition of CpG DNA, but not control non-CpG
DNA, restored the mRNA level of c-myc. In contrast, CpG DNA
failed to prevent anti-IgM-mediated down-regulation of
c-myc in the presence of the NFB activation inhibitor
PDTC or gliotoxin (Fig. 5). The control bis-gliotoxin did not suppress
the ability of CpG DNA to maintain the c-myc mRNA levels in
the presence of anti-IgM (Fig. 5).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B degradation
and NFB activation in the CpG DNA-mediated protection against
anti-IgM-induced growth arrest and apoptosis of WEHI-231 cells. CpG
DNA induces prolonged activation of NFB which is preceded by
sustained degradation of IB and IBß in WEHI-231 cells. This
sustained NFB activation is associated with CpG DNA-mediated
maintenance of anti-apoptotic oncogene expression and subsequent
growth and survival of the WEHI-231 cells despite the presence of
anti-IgM.
The NFB family of transcription factors is composed of several
related proteins such as p50, p65, p52, c-Rel, and Rel B that can form
a variety of homodimers and heterodimers. Different components of
NFB proteins are expressed during different stages of B cell
development (27, 34). In WEHI-231 cells under normal culture
conditions, NFB was constitutively activated as a p50/c-Rel
heterodimer (Fig. 1
). The binding activity of NFB p50/p50 homodimer
was minimal, and no p50/p65 heterodimer was observed in our
experimental conditions (Fig. 1) in agreement with previous findings
(34). Anti-IgM treatment induced a transient increase of the p50/c-Rel
binding activity which declined within 3 h and was followed by
increased levels of p50/p50 homodimer, a putative transcriptional
repressor (Fig. 1B) (13). The kinetic profiles of the
increase and decline of p50/c-Rel binding activities and later p50/p50
homodimer formation are compatible with the kinetic profiles of the
c-myc expression, which increases within 30 min and declines
after 3 h in WEHI-231 cells after anti-IgM treatment (8). This
indicates the possible relationship between the NFB activation and
c-myc expression. Indeed, Lee et al. (13) demonstrated that
p50/c-Rel heterodimer activates c-myc expression while
p50/p50 homodimer represses expression of c-myc. Therefore,
these changes in NFB-binding activities may mediate the observed
activation and subsequent inhibition of c-myc gene
transcription in WEHI-231 after anti-IgM treatment (13). Like
CD40L, which rescues WEHI-231 cells from anti-IgM-induced apoptosis
by maintaining p50/c-Rel binding activity and c-myc
expression (15), CpG DNA prevented decline of p50/c-Rel heterodimer
formation without affecting p50/p50 homodimer formation induced by
anti-IgM (Fig. 1B). Interestingly, neither CD40L
(15) nor CpG DNA inhibited p50/p50 homodimer formation induced after
anti-IgM treatment. p50/p50 homodimer could act as a
transcriptional repressor or as a transcriptional activator depending
on its association with Bcl-3 (35). The functional nature of the
p50/p50 homodimer present after CpG DNA or CD40L treatment in the
presence of anti-IgM in WEHI-231 cell is yet to be elucidated. In
addition, like CD40L and other stimulants, CpG DNA also inhibits
anti-IgM-mediated down-regulation of c-myc and
bcl-xL expression (8). These results
indicate that CpG DNA rescues WEHI-231 cells from anti-IgM-induced
apoptosis by maintaining prolonged p50/c-Rel activation which may be
directly and/or indirectly involved in the regulation of
anti-apoptotic genes such as c-myc and
bcl-xL.
The transcription factor NFB is present in the cytoplasm as an
inactive complex with an inhibitor protein, IB (36). IB is a
family of several related proteins that contain multiple copies of
ankyrin repeats at their C termini. Various stimuli including LPS and
PMA can induce activation of NFB. In general, activation of NFB
is coupled to its dissociation from IB, to translocation into
nucleus and to the proteolysis of IB (reviewed in Refs. 37 and 38).
However, not all NFB activation pathways require IB degradation
(32). Furthermore, different isoforms of IB respond to different
activators of NFB, and the phosphorylation status of different IB
isoforms can have different effects on NFB activation (30, 31). As
expected, the concentrations of both IB and IBß were
constitutively very low in WEHI-231 cells (Figs. 2 and 3) (27). Ag
receptor cross-linking resulted in the transient reduction in IB
protein concentration followed by the continuous accumulation of
IB protein (Fig. 2A and data not shown). This temporal
reduction in IB protein concentration may be correlated with the
transient NFB activation observed after anti-IgM stimulation
(Fig. 1B). Furthermore, this temporal NFB
activation induced by anti-IgM may be responsible for later
accumulation of IB proteins since transcription of IB can
be regulated by NFB. The concentrations of IBß were increased
after anti-IgM treatment in WEHI-231 cells (Fig. 3A). In contrast, CpG DNA caused reductions of both
IB and IBß and maintained comparably low concentrations of
both IB and IBß proteins in WEHI-231 cells regardless of the
presence of anti-IgM (Figs. 2 and 3 and data not shown).
Interestingly, CD40L also induces degradation of both IB and
IBß in WEHI-231 cell in the presence or absence of anti-IgM
(15). These persistent degradations of IB and IBß after CpG
DNA stimulation in the presence of anti-IgM may lead to the
maintenance of p50/c-Rel activation. Recently, Thompson et al. (30)
demonstrated that a transient activation of NFB is mediated through
IB while a persistent activation of NFB is mediated via
modulation of both IB and IBß. Furthermore, after the
initial degradation, newly synthesized IBß is unphosphorylated and
this unphosphorylated form of IBß acts as an IB inhibitor
(31). These observations support our hypothesis that CpG DNA-mediated
reversal of anti-IgM-induced NFB (p50/c-Rel) inactivation in
WEHI-231 cells is mediated through modulation of both IB and
IBß.
Recent studies have shown that gliotoxin inhibits NFB activation by
inhibiting IB degradation (33). TPCK and PDTC inhibit NFB
activation by blocking proteolysis of both IB and IBß (29, 30). In addition to abolishing the constitutive activation of NFB in
WEHI-231 cells, these IB degradation inhibitors prevented the
sustained activation of NFB by CpG DNA regardless of the presence of
anti-IgM (Fig. 4 and data not shown). TPCK, PDTC, or gliotoxin
directly and/or indirectly inhibited expression of various
proto-oncogenes that might be involved in cell growth and/or survival
such as c-myc and bcl-xL
and induced apoptosis of WEHI-231 cells (data not shown). These results
are consistent with previous observations that inhibition of NFB by
preventing IB degradation results in suppression of c-myc
expression and induction of apoptosis in WEHI-231 cells (14), but we
cannot exclude the possibility that these drugs may have additional
unknown biologic activities that contributed to their effects.
Likewise, the failure of CpG DNA to prevent down-regulation of gene
expression or apoptosis by NFB inhibitors (Fig. 5 and data not
shown) is compatible with an essential role for NFB in the CpG
DNA-induced signaling pathway. In contrast to this failure of CpG DNA
to rescue WEHI-231 cells from the NFB inhibitors, CpG DNA can rescue
from apoptosis induced by many other physical and chemical agents (39).
Of course, our studies cannot exclude the alternative interpretation
that CpG DNA simply could not overcome the cytotoxic effects of these
inhibitors rather than that these inhibitors specifically block
NFB-mediated CpG DNA effects. However, cell death was not detected
at the time of cell harvest by trypan blue stain in the experiments for
EMSA and RPA.
The molecular mechanism by which CpG DNA induces lymphocyte activation
remains to be illustrated. Recent studies in our laboratory indicate
that CpG DNA is endocytosed by B lymphocytes and macrophages and then
induces intracellular ROS generation.5 Further studies are
being performed to determine whether these ROS have a functional role
in sustained NFB activation and anti-apoptotic effects of CpG
DNA in WEHI-231 cells.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Arthur M. Krieg, Department of Internal Medicine, University of Iowa College of Medicine, Iowa City, IA 52242. E-mail address:
3 Abbreviations used in this paper: CD40L, CD40 ligand; ROS, reactive oxygen species; S-ODN, phosphorothioate oligodeoxynucleotides; RPA, RNase protection assay; PDTC, pyrrolidine dithiocarbamate; TPCK, N-tosyl-L-phenylalanine chloromethyl ketone; EMSA, electrophoretic mobility shift assay.
4 Anitescu, M., J. H. Chace, R. Tuetken, A.-K. Yi, D. J. Berg, A. M. Krieg, and J. S. Cowdery. J. Interferon Cytokine Res. In press.
5 Yi, A.-K., R. Tuetken, T. Redford, J. Kirsch, and A. M. Krieg. Submitted for publication.
6 Yi, A.-K., M. Chang, D. W. Peckham, A. M. Krieg, and R. F. Ashman. Submitted for publication.
Received for publication July 2, 1997. Accepted for publication October 14, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B/Rel and c-myc expression during CD40 ligand rescue of WEHI-231 early B cells from receptor-mediated apoptosis through modulation of IB proteins. J. Immunol. 157:81.[Abstract]
in vivo and increases the toxicity of lipopolysaccharides. J. Immunol. 156:4570.[Abstract]
. Proc. Natl. Acad. Sci. USA 93:2879. promotes IL-6 and IgM secretion in response to CpG motifs in bacterial DNA and oligodeoxynucleotides. J. Immunol. 156:558.[Abstract]
B-like factor with a site upstream of the c-myc promoter. Proc. Natl. Acad. Sci. USA 87:4727.B degradation is responsible for constitutive NF-B activity in mature murine B-cell lines. Mol. Cell. Biol. 14:3276.B p50-related protein in B lymphocytes. Mol. Cell. Biol. 16:7089.[Abstract]
B- is necessary for activation of transcription factor NF-B. Nature 365:182.[Medline]
B-ß regulates the persistent response in a biphasic activation of NF-B. Cell 80:573.[Medline]
Bß in persistent activation of NF-B. Mol. Cell. Biol. 16:5444.[Abstract]
B- activates NF-B without proteolytic degradation of IB-. Cell 86:787.[Medline]
B. J. Exp. Med. 183:1829.B/Rel family proteins during B-cell terminal differentiation. Mol. Cell. Biol. 14:5349.B-mediated transactivation by removing inhibiting homodimers from select B sites. EMBO J. 12:3893.[Medline]
B: a specific inhibitor of the NF-B transcription factor. Science 242:540.B: ten years after. Cell 87:13.
B and IB proteins: new discoveries and insights. Annu. Rev. Immunol. 14:649.[Medline]
-mediated shock. Eur. J. Immunol. 27:1671.[Medline]
This article has been cited by other articles:
|
|
 |
|
  A. D. Henn, J. Rebhahn, M. A. Brown, A. J. Murphy, M. N. Coca, O. Hyrien, T. Pellegrin, T. Mosmann, and M. S. Zand Modulation of Single-Cell IgG Secretion Frequency and Rates in Human Memory B Cells by CpG DNA, CD40L, IL-21, and Cell Division J. Immunol., September 1, 2009; 183(5): 3177 - 3187. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-P. Carralot, C. Lemmel, S. Stevanovic, and S. Pascolo Mass spectrometric identification of an HLA-A*0201 epitope from Plasmodium falciparum MSP-1 Int. Immunol., November 1, 2008; 20(11): 1451 - 1456. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. D. Navarro, J. Carracedo, R. Ramirez, J. A. Madueno, A. Merino, M. Rodriguez, A. Martin-Malo, and P. Aljama Bacterial DNA prolongs the survival of inflamed mononuclear cells in haemodialysis patients Nephrol. Dial. Transplant., December 1, 2007; 22(12): 3580 - 3585. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. O'Keeffe, R. J. Grumont, H. Hochrein, M. Fuchsberger, R. Gugasyan, D. Vremec, K. Shortman, and S. Gerondakis Distinct roles for the NF-{kappa}B1 and c-Rel transcription factors in the differentiation and survival of plasmacytoid and conventional dendritic cells activated by TLR-9 signals Blood, November 15, 2005; 106(10): 3457 - 3464. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Chagnon, S. Tanguay, O. L. Ozdal, M. Guan, Z. Z. Ozen, J.-S. Ripeau, M. Chevrette, M. M. Elhilali, and L. A. Thompson-Snipes Potentiation of a Dendritic Cell Vaccine for Murine Renal Cell Carcinoma by CpG Oligonucleotides Clin. Cancer Res., February 1, 2005; 11(3): 1302 - 1311. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Scheller, A. Ullrich, K. McPherson, B. Hefele, J. Knoferle, S. Lamla, A. R. M. Olbrich, H. Stocker, K. Arasteh, V. t. Meulen, et al. CpG Oligodeoxynucleotides Activate HIV Replication in Latently Infected Human T Cells J. Biol. Chem., May 21, 2004; 279(21): 21897 - 21902. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Cornelie, J. Hoebeke, A.-M. Schacht, B. Bertin, J. Vicogne, M. Capron, and G. Riveau Direct Evidence that Toll-like Receptor 9 (TLR9) Functionally Binds Plasmid DNA by Specific Cytosine-phosphate-guanine Motif Recognition J. Biol. Chem., April 9, 2004; 279(15): 15124 - 15129. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H.-J. Anders, B. Banas, and D. Schlondorff Signaling Danger: Toll-Like Receptors and their Potential Roles in Kidney Disease J. Am. Soc. Nephrol., April 1, 2004; 15(4): 854 - 867. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-J. Yeo, J.-G. Yoon, and A.-K. Yi Myeloid Differentiation Factor 88-dependent Post-transcriptional Regulation of Cyclooxygenase-2 Expression by CpG DNA: TUMOR NECROSIS FACTOR-{alpha} RECEPTOR-ASSOCIATED FACTOR 6, A DIVERGING POINT IN THE Toll-LIKE RECEPTOR 9-SIGNALING J. Biol. Chem., October 17, 2003; 278(42): 40590 - 40600. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Zou, A. Amcheslavsky, and Z. Bar-Shavit CpG Oligodeoxynucleotides Modulate the Osteoclastogenic Activity of Osteoblasts via Toll-like Receptor 9 J. Biol. Chem., May 2, 2003; 278(19): 16732 - 16740. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-K. Yi, J.-G. Yoon, and A. M. Krieg Convergence of CpG DNA- and BCR-mediated signals at the c-Jun N-terminal kinase and NF-{kappa}B activation pathways: regulation by mitogen-activated protein kinases Int. Immunol., May 1, 2003; 15(5): 577 - 591. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Wang and A. M. Krieg Synergy between CpG- or non-CpG DNA and specific antigen for B cell activation Int. Immunol., February 1, 2003; 15(2): 223 - 231. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. D. Sandler, H. Chihara, G. Kobayashi, X. Zhu, M. A. Miller, D. L. Scott, and A. M. Krieg CpG Oligonucleotides Enhance the Tumor Antigen-specific Immune Response of a Granulocyte Macrophage Colony-stimulating Factor-based Vaccine Strategy in Neuroblastoma Cancer Res., January 15, 2003; 63(2): 394 - 399. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-J. Yeo, J.-G. Yoon, S.-C. Hong, and A.-K. Yi CpG DNA Induces Self and Cross-Hyporesponsiveness of RAW264.7 Cells in Response to CpG DNA and Lipopolysaccharide: Alterations in IL-1 Receptor-Associated Kinase Expression J. Immunol., January 15, 2003; 170(2): 1052 - 1061. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Heckelsmiller, K. Rall, S. Beck, A. Schlamp, J. Seiderer, B. Jahrsdorfer, A. Krug, S. Rothenfusser, S. Endres, and G. Hartmann Peritumoral CpG DNA Elicits a Coordinated Response of CD8 T Cells and Innate Effectors to Cure Established Tumors in a Murine Colon Carcinoma Model J. Immunol., October 1, 2002; 169(7): 3892 - 3899. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Jahrsdorfer, R. Jox, L. Muhlenhoff, K. Tschoep, A. Krug, S. Rothenfusser, G. Meinhardt, B. Emmerich, S. Endres, and G. Hartmann Modulation of malignant B cell activation and apoptosis by bcl-2 antisense ODN and immunostimulatory CpG ODN J. Leukoc. Biol., July 1, 2002; 72(1): 83 - 92. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Riedl, D. Stober, C. Oehninger, K. Melber, J. Reimann, and R. Schirmbeck Priming Th1 Immunity to Viral Core Particles Is Facilitated by Trace Amounts of RNA Bound to Its Arginine-Rich Domain J. Immunol., May 15, 2002; 168(10): 4951 - 4959. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-K. Yi, J.-G. Yoon, S.-J. Yeo, S.-C. Hong, B. K. English, and A. M. Krieg Role of Mitogen-Activated Protein Kinases in CpG DNA-Mediated IL-10 and IL-12 Production: Central Role of Extracellular Signal-Regulated Kinase in the Negative Feedback Loop of the CpG DNA-Mediated Th1 Response J. Immunol., May 1, 2002; 168(9): 4711 - 4720. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T.-H. Chuang, J. Lee, L. Kline, J. C. Mathison, and R. J. Ulevitch Toll-like receptor 9 mediates CpG-DNA signaling J. Leukoc. Biol., March 1, 2002; 71(3): 538 - 544. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-K. Yi, J.-G. Yoon, S.-C. Hong, T. W. Redford, and A. M. Krieg Lipopolysaccharide and CpG DNA synergize for tumor necrosis factor-{alpha} production through activation of NF-{kappa}B Int. Immunol., November 1, 2001; 13(11): 1391 - 1404. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F.-G. Zhu and D. S. Pisetsky Role of the Heat Shock Protein 90 in Immune Response Stimulation by Bacterial DNA and Synthetic Oligonucleotides Infect. Immun., September 1, 2001; 69(9): 5546 - 5552. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F.-G. Zhu and J. S. Marshall CpG-containing oligodeoxynucleotides induce TNF-{alpha} and IL-6 production but not degranulation from murine bone marrow-derived mast cells J. Leukoc. Biol., February 1, 2001; 69(2): 253 - 262. [Abstract] [Full Text]
|
|
|
|
|
|
C. Brunner, J. Seiderer, A. Schlamp, M. Bidlingmaier, A. Eigler, W. Haimerl, H.-A. Lehr, A. M. Krieg, G. Hartmann, and S. Endres Enhanced Dendritic Cell Maturation by TNF-{alpha} or Cytidine-Phosphate-Guanosine DNA Drives T Cell Activation In Vitro and Therapeutic Anti-Tumor Immune Responses In Vivo J. Immunol., December 1, 2000; 165(11): 6278 - 6286. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. A. Bishop, Y. Hsing, B. S. Hostager, S. V. Jalukar, L. M. Ramirez, and M. A. Tomai Molecular Mechanisms of B Lymphocyte Activation by the Immune Response Modifier R-848 J. Immunol., November 15, 2000; 165(10): 5552 - 5557. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. P. Sester, S. J. Beasley, M. J. Sweet, L. F. Fowles, S. L. Cronau, K. J. Stacey, and D. A. Hume Bacterial/CpG DNA Down-Modulates Colony Stimulating Factor-1 Receptor Surface Expression on Murine Bone Marrow-Derived Macrophages with Concomitant Growth Arrest and Factor-Independent Survival J. Immunol., December 15, 1999; 163(12): 6541 - 6550. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-K. Yi, D. W. Peckham, R. F. Ashman, and A. M. Krieg CpG DNA rescues B cells from apoptosis by activating NF{kappa}B and preventing mitochondrial membrane potential disruption via a chloroquine-sensitive pathway Int. Immunol., December 1, 1999; 11(12): 2015 - 2024. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Cowdery, N. J. Boerth, L. A. Norian, P. S. Myung, and G. A. Koretzky Differential Regulation of the IL-12 p40 Promoter and of p40 Secretion by CpG DNA and Lipopolysaccharide J. Immunol., June 1, 1999; 162(11): 6770 - 6775. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Kovarik, P. Bozzotti, L. Love-Homan, M. Pihlgren, H. L. Davis, P.-H. Lambert, A. M. Krieg, and C.-A. Siegrist CpG Oligodeoxynucleotides Can Circumvent the Th2 Polarization of Neonatal Responses to Vaccines But May Fail to Fully Redirect Th2 Responses Established by Neonatal Priming J. Immunol., February 1, 1999; 162(3): 1611 - 1617. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-K. Yi and A. M. Krieg Cutting Edge: Rapid Induction of Mitogen-Activated Protein Kinases by Immune Stimulatory CpG DNA J. Immunol., November 1, 1998; 161(9): 4493 - 4497. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. W. Redford, A.-K. Yi, C. T. Ward, and A. M. Krieg Cyclosporin A Enhances IL-12 Production by CpG Motifs in Bacterial DNA and Synthetic Oligodeoxynucleotides J. Immunol., October 15, 1998; 161(8): 3930 - 3935. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Krieg, T. Wu, R. Weeratna, S. M. Efler, L. Love-Homan, L. Yang, A.-K. Yi, D. Short, and H. L. Davis Sequence motifs in adenoviral DNA block immune activation by stimulatory CpG motifs PNAS, October 13, 1998; 95(21): 12631 - 12636. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-K. Yi, R. Tuetken, T. Redford, M. Waldschmidt, J. Kirsch, and A. M. Krieg CpG Motifs in Bacterial DNA Activate Leukocytes Through the pH-Dependent Generation of Reactive Oxygen Species J. Immunol., May 15, 1998; 160(10): 4755 - 4761. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
