|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
B Activation in Hemopoietic Progenitor Cells1


*
The Vanderbilt Cancer Center and Departments of Medicine and
Microbiology and Immunology, Vanderbilt University School of Medicine, Nashville, TN 37232; and
Hamon Center for Therapeutic Oncology Research, University of Texas Southwestern Medical Center, Dallas, TX 75287
| Abstract |
|---|
|
|
|---|
B
(NF-
B)-dependent activation of reporter gene transcription during
the first 24 h in culture. The presence of VEGF significantly
decreased the specific DNA binding of NF-
B as early as 30 min after
induction with TNF-
. This was followed on days 7 to 10 by decreases
in the mRNA for RelB and c-Rel, two subunits of NF-
B. Blockade of
NF-
B activity in HPC at early stages of differentiation with an
adenovirus expressing a dominant I
B inhibitor of NF-
B reproduced
the pattern of effects observed with VEGF. Thus, NF-
B plays an
important role in maturation of HPCs to DC, and VEGF activation of the
Flt-1 receptor is able to block the activation of NF-
B in this
system. Blockade of NF-
B activation in HPCs by tumor-derived factors
may therefore be a mechanism by which tumor cells can directly
down-modulate the ability of the immune system to generate effective
antitumor immune responses. | Introduction |
|---|
|
|
|---|
We and others have detected the presence of mRNA for one of the VEGF
receptors, Flt-1, in human hemopoietic progenitor cells
(CD34+ cells) (9, 15, 16). mRNA for another VEGF receptor,
KDR, has also been reported in these cells by others (15). The
detection of mRNA for a specific VEGF receptor suggests that VEGF may
act directly on these cells, and in this study we report specific
binding of VEGF to HPCs and implicate the transcription factor NF-
B
in the observed functional effects. NF-
B regulates transcription of
many genes involved in immune response, including cytokines and growth
factors (reviewed in Refs. 17 and 18). NF-
B is present as an
inactive complex in the cytoplasm of many cells bound to the inhibitory
protein I
B. Activation of NF-
B involves serine phosphorylation,
dissociation, and degradation of I
B followed by release and nuclear
translocation of NF-
B. Alternatively, tyrosine phosphorylation of
I
B may also result in its activation in the absence of degradation
(19). This activation can be mediated by a variety of stimuli,
including bacterial LPS, PMA, and TNF-
. Authentic NF-
B is
composed of 50- and 65-kDa subunits that bind to a 10-bp motif in the
promoter of responsive genes. Several subunits of NF-
B have been
identified: p50, p52, p65 (RelA), c-Rel, and RelB. These subunits form
both homo- and heterodimeric complexes and differentially regulate gene
expression. Several studies have recently demonstrated that RelB, a
component of NF-
B, is required for the development of DC (20, 21, 22).
Here, we demonstrate for the first time that VEGF signaling via the
Flt-1 receptor inhibits NF-
B activation in hemopoietic progenitor
cells. This inhibition of NF-
B also leads to defective functional
maturation of DC and may contribute to inefficient induction of
immunity in cancer patients.
| Materials and Methods |
|---|
|
|
|---|
CD34+ cells were isolated from umbilical cord
blood by magnetic bead separation techniques (Dynal, Oslo, Norway)
according to the manufacturers protocol. The purity of
CD34+ cells was >90% as estimated by flow cytometry with
anti-CD34+ Ab (Becton Dickinson, Mountain View, CA). In
some experiments with VEGF binding, CD34+ were separated on
a FACStar flow cell sorter (Becton Dickinson) after labeling with
anti-CD34+ FITC Ab. CD34+ cells (2 x
105) were cultured in 24-well plates in complete culture
medium (CCM; RPMI 1640 supplemented with 10% FCS, 5 x
10-5 M 2-ME, and antibiotics; Life Technologies,
Gaithersburg, MD) with 2 ng/ml GM-CSF and 1 ng/ml TNF-
or 2 ng/ml
IL-4 and 10 ng/ml stem cell factor. All cytokines were obtained from
R&D Systems (Minneapolis, MN). Tumor cell supernatants (TCS) were
generated from different tumor cell lines as described previously (9).
Tumor cell lines were obtained from American Type Culture Collection
(Rockville, MD). Three cell lines, the most effective in previous
experiments (HTB 130, HTB 131, and HTB 121) were used in this study.
VEGF165 and VEGF121 were obtained from R&D. TCS
(20% final concentration) or VEGF (50100 ng/ml) was added on day 0.
CCM with cytokines was replaced on days 5 and 10. TCS and VEGF were not
added with fresh medium. For several experiments DC were sorted using a
FACStar cell sorter (Becton Dickinson). Briefly, cells generated from
CD34+ progenitor cells in the presence of GM-CSF and
TNF-
were collected on day 14, washed, and labeled with either CD1a
(RDI, Flanders, NJ) or HLA DR (Sigma Chemical Co., St. Louis, MO) mAbs
conjugated with FITC. Dead cells were labeled with 7AAD (Molecular
Probes, Eugene, OR) and excluded. Viable CD1a+ or HLA
DRbright cells were separated from CD1a- or
HLA DR- cells, collected, and used in some experiments.
The level of nonspecific binding was established using FITC-labeled
mouse IgG2b (Sigma).
For some experiments DC were generated from precursors in peripheral blood as previously described (23). Briefly, mononuclear cells isolated from peripheral blood were cultured for 1 h on six-well plates in CCM. Nonadherent cells were removed, and the remaining cells were cultured in complete culture medium supplemented with GM-CSF (5 ng/ml) and IL-4 (2 ng/ml) for 6 days at 37°C. After that time cells were collected, and DC were further purified on a metrizamide gradient (14.5 g metrizamide (Accurate Chemical, Westbury, NY) dissolved in 100 ml of RPMI 1640 with 10% FCS). The purity of the final DC population was >90%.
VEGF binding and competition assay
Iodination of VEGF was performed using the chloramine-T method. Briefly, 25 µg of protein in PBS was incubated with 1 mCi of 125I and 100 µg of chloramine-T for 3 min on ice. This was followed by addition of 60 µg of sodium metabisulfite and separation of free iodine on a Sephadex G-25 column. The sp. act. (10,00015,000 cpm/fmol) was determined by measuring the total recovered protein using a Bradford assay, and total incorporated 125I was measured using a gamma counter (Beckman, Palo Alto, CA). VEGF radiolabeled to this sp. act. was fully functional as tested in an endothelial cell proliferation assay (data not shown). To measure specific binding, 3 x 105 CD34+ cells were incubated in duplicate with [125I]VEGF in PBS with 0.2% BSA for 6 to 8 h at 4°C. For the cold competition assay, cells were incubated with a 100-fold molar excess of unlabeled VEGF, GM-CSF, or placenta growth factor (PlGF). PlGF used in this study was either obtained from R&D or was provided by Dr. N. Ferrara (Genentech, South San Francisco, CA). After incubation, cells were washed three times in PBS containing carrier protein, and radioactivity was measured with a gamma counter (Beckman). As a positive control for VEGF binding we used murine 3T3 fibroblasts overexpressing human Flt-1 receptor (provided by Dr. Shibuya) (24). To provide larger numbers of cells for the Scatchard analysis, in some experiments CD34+ from several donors were pooled. Data were analyzed according to Scatchards procedure (25). The cold competition assay was performed by incubating cells with a fixed concentration (500 pM) [125I]VEGF and increased concentrations of unlabeled ligand.
NF-
B transcription activity
Two constructs with the luciferase reporter gene under
NF-
B-dependent promoters were used. The HIV-Luc construct places the
HindIII/XhoI fragment of pHIVlacZ (26)
into the HindIII/XhoI sites of
pGL2-Basic (Promega Corp., Madison, WI). The
2xIFN-
tkLuc construct was made by placing an oligonucleotide
bearing two tandem copies of the IFN-
binding site (27)
(5'-GAGACTTAAAAGGGATTTATGAATTTTCCAAAA-3') containing HindIII
linkers at either end for insertion into the HindIII site of
pGL2-Basic. Both constructs were confirmed by sequence
analysis before use. Cells (45 x 105) were
collected after 5 to 6 days in culture with GM-CSF and TNF-
, washed
in serum-free medium (OptiMEM, Life Technologies), and transfected in
duplicate with 2 µg of plasmid DNA using the liposome Lipofectamine
reagent (Life Technologies) in serum-free medium. Cells were collected
36 h after transfection and lysed with Triton/glycylglycine lysis
buffer. The luciferase activity in cell lysates was measured as
previously described (28) in the presence of D-luciferin
(Sigma Chemical Co.) and ATP (Sigma) on a Monolight 2010 luminometer
(Analytical Luminescence Laboratory, San Diego, CA).
Electrophoretic mobility shift assay (EMSA)
Double-stranded oligonucleotide probes were prepared by
annealing the appropriate single-stranded oligonucleotides at 65°C
for 10 min in 10 mM Tris, 1 mM EDTA, and 10 mM NaCl followed by slow
cooling to room temperature. The probes were end labeled with
32P-labeled CTP by filling in 5' overhangs with the
Klenow fragment. We used the following
B probes (29):
normal, 5'-GATCCAACGGCAGGGGAATTCCCCTCTCCTTA GTTGCCGTCCCCTTAAGGGGAGAGGAATCTAG;
and mutant,
5'-GATCCAACGGCAGATCTATTCCCCTCTCCTTA GTTGCCGTCTAGATAAGGGGAGAGGAATCTAG.
Nuclear extract was obtained from the cells as previously described (30). Ten micrograms of nuclear extract was incubated for 20 min with labeled probe (50,000 cpm) in the presence of 4 µg of poly(dI-dC) (Pharmacia, Piscataway, NJ) in binding buffer (20 mM HEPES, 5% glycerol, 0.2 mM EDTA, 1 mM DTT, and 5 mM MgCl2). Competition assays were performed with a 200-fold excess of unlabeled probes. The DNA-protein complexes were separated on 4% polyacrylamide gels, and visualized and analyzed on a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).
Inhibition of NF-
B activity
To block NF-
B, we used a dominant negative inhibitor I
B
with deleted serine phosphorylation sites. This prevents the
dissociation of I
B
from NF-
B and subsequent activation of
transcription. pAC, JM17, and Adeno-ß-gal were gifts from Dr. Newgard
(31). pAC-I
B-
N was constructed by ligating the 0.9-kbp
Acc651 fragment of pBS(SK-)-I
B-
N into the
unique Acc651 site of pAC. The construct was confirmed by
restriction endonuclease digestion and sequence analysis over the start
site of transcription. Human 293 cells were maintained on gelatinized
tissue culture plates in DMEM containing 10% FBS (non-heat
inactivated) and antibiotics at 37°C in 5% CO2. A
subconfluent culture of cells (6 x 105 cells/60-mm
dish) were transfected by calcium phosphate precipitation of pAC
expression construct (10 µg) and JM17 (10 µg). Medium was replaced
once weekly, and plaque formation was observed between 2 and 4 wk
post-transfection. A subconfluent (80%) culture of 293 cells was
infected with 10 to 100 µl of conditioned medium from picked plaques.
Thirty-six hours postinfection, the medium was removed, cells were
lysed, DNA was extracted from lysates, and the construct was verified
by Southern blot analysis. Virus was precipitated from cell lysates
using 0.5 vol of 20% polyethylene glycol 8000 (Sigma)/2.5 M NaCl on
ice for 18 h and ultracentrifuged on CsCl gradient. The adenovirus
band was purified on PD-10 Sephadex column (Pharmacia). The resulting
virus-containing fractions were stored at -80°C. Two
independently confirmed clones of the construct were produced, and
protein production was verified by Western blot analysis.
CD34+ cells were transduced at a multiplicity of infection
of 100 by recombinant adenovirus (Ad-I
B
-
N or Ad-ß-gal) on
day 0, 3, or 6 after the start of the culture with GM-CSF and TNF-
.
Cells were cultured as described above, with medium replaced on days 5
and 10. On day 14 cells were harvested, washed, and tested in
functional studies or for expression of surface molecules. To assess
the efficiency of transduction, 48 h after infection the ß-gal
activity in the cells was determined using standard X-gal assays
(32).
Allogeneic MLR
Cells generated from CD34+ progenitor cells
with GM-CSF and TNF-
in the presence of VEGF, PlGF,
Ad-I
B
-
N, or Ad-ß-gal were irradiated (20 Gy) and incubated
in triplicate with control allogeneic T cells at different ratios for 5
days. [3H]thymidine incorporation over 18 h was
counted using a liquid scintillation counter (Beckman).
mRNA expression for VEGF receptor and NF-
B subunits in
CD34+ cells
RNA was isolated from cells using the GlassMAX RNA
microisolation spin cartridge system (Life Technologies). Traces of DNA
were removed by treatment with DNase I. cDNA was synthesized from 1
µg of total RNA by using random hexamers as primers and Superscript
II reverse transcriptase (Life Technologies) according to the protocol
provided by the manufacturer. The cDNA was subjected to PCR initial
denaturation of 94°C for 2 min; 34 cycles of 94°C for 30 s,
55°C for 30 s, and 72°C for 45 s; and a final extension
at 72°C for 2 min. PCR products were transferred to
Hybond-N+ membrane (Amersham, Arlington Heights, IL)
using standard alkaline transfer Southern blot techniques. Membranes
were hybridized with 32P-labeled internal probes. Results
were visualized and quantitated on a PhosphorImager. ß-Actin primers
and probes were used in every experiment in parallel to
NF-
B-specific primers for standardization. Expression of the mRNA
for each gene was normalized to the level of ß-actin expression in
the same sample using the formula: gene expression/ß-actin
expression x 100. PCR primer pairs for NF-
B subunits were
selected so that the products had minimal homology with known family
members to assure specific results for each NF-
B subunit.
PCR primers pairs and internal probes were as follow: Flt-1: sense, 5'-AATTCCACCATGGTCAGCTA; antisense, 5'-AATTCATGCTCAGCCTTTCG; probe, 5'-AAGGCACCCAGCACATCATG; relB: sense, 5'-GAAGAACCATCAGGAAGTAGAC; antisense, 5'-GGTGAGCCGCTGCAGGAAGACG; probe, 5'-TGACAAGAAATCCACAAACACATC; c-rel: sense, 5'-GAGGGGAATGCGTTTTAGATACAA; antisense, 5'-CAGGAGGAAGAGCAGTCGTCAAAT; probe, 5'-CCAGGGGAGCACAGCACAGA; p50: sense, 5'-ACCCGCGGGCGTCTAAAA; antisense, 5'-AGCCGCTGCCTCTGAAGTT; probe, 5'-AGAAACAGCTGATGGCCCCTACCT; and ß-actin: sense, 5'-TCACCCACACTGTGCCCATCTACGA; antisense, 5'-CAGCGGAACCGCTCATTGCCAATGG; probe, 5'-ATGCCCTCCCCCATGCCATCTGCGT.
| Results |
|---|
|
|
|---|
Previously, we and others reported the presence of mRNA for one
(9, 16) or both (15) VEGF receptors (Flt-1 and KDR) in
CD34+ cells. Here, we assayed for specific VEGF
binding to freshly isolated CD34+ cells and to the cells
during the process of DC maturation in vitro. Low but clearly specific
VEGF binding to CD34+ cells was observed (Fig. 1
A). This effect was
reproduced in five independently performed experiments. These results
were confirmed in experiments with CD34+ isolated from
umbilical cord blood using a flow cell sorter to a purity of >99%
(data not shown). This binding was blocked by unlabeled VEGF and PlGF,
but not by GM-CSF, as expected for binding to the Flt-1 receptor. Under
the conditions used, the 125I-labeled VEGF binding was
competed by unlabeled VEGF more efficiently than unlabeled PlGF (Fig. 1
B), consistent with reports that VEGF binds FLT-1
with higher affinity than PlGF (33, 34). Scatchard analysis performed
using pooled CD34+ cells from several donors indicated that
the Kd for the binding of VEGF to
CD34+ cells was about 96 pM, with approximately 9,000
receptors/cell (Fig. 1
C). Binding reached saturation
at a VEGF concentration of about 600 pM (Fig. 1
D).
The ability of cells to specifically bind VEGF diminished with time in
culture as cells progressed toward mature DC (Fig. 2
A), consistent with
the observed effects of VEGF early, but not late, in maturation. The
number of VEGF binding sites per cell decreased from 8800 on day 0 to
2100 on day 6 and 1500 on day 12. The Kd for
VEGF binding on days 6 and 12 was unchanged from that observed on day
0. Thus, the decreased VEGF binding was due to a decrease in the number
of specific receptors and not to a decrease in affinity. Negligible
levels of specific VEGF binding were observed in DC generated from
peripheral blood (data not shown). This decrease in binding was closely
associated with a decrease in the level of Flt-1 mRNA (Fig. 2
B). It has been reported that TNF-
can directly
inhibit Flt-1 expression in endothelial cells (35). Since our cultures
contain TNF-
, we wanted to determine whether this factor alone was
responsible for the loss of receptors with maturation. Therefore, we
measured specific VEGF binding when HPC were grown in the presence of
IL-4, another cytokine capable of supporting DC differentiation, rather
than TNF-
. Both culture conditions resulted in substantial decreases
in Flt-1 mRNA expression by days 7 and 11 (Fig. 2
B).
|
|
to stimulate allogeneic
T cell proliferation. PlGF was associated with similar decreases in
proliferation in this experimental system (Fig. 3
|
B activity
We have previously shown that the presence of TCS affected DC
maturation if present during the first 4 to 5 days in culture (9). We
therefore hypothesized that if there were any effect of TCS or VEGF on
NF-
B activity it would be detectable at the end of this period.
CD34+ cells were cultured with GM-CSF and either
TNF-
or IL-4 for 5 to 6 days in the presence of TCS or VEGF. Cells
were then collected, washed, and transfected with the
B enhancer
reporter gene construct as described in Materials and
Methods. As shown in Figure 4
, TCS
and VEGF significantly decreased
B-dependent transcription. This
effect was observed in both experimental conditions (growth of HPCs
with GM-CSF and either TNF-
or IL-4). However, the level of
transcriptional activation in control cells cultured with GM-CSF and
IL-4 was lower than that in the presence of TNF-
. This effect could
be due to the fact that TNF-
is a potent activator of NF-
B, while
IL-4 inhibits NF-
B activation in a number of systems (36, 37). Under
both conditions, however, VEGF and TCS suppressed the observed
activity. To confirm the trans-activation studies, we
assessed sequence-specific binding of NF-
B to oligodeoxynucleotides
in an electrophoretic mobility shift assay. As shown in Figure 5
, significantly decreased
NF-
B-specific binding was observed in the presence of TCS or VEGF in
cells after 7 days in culture.
|
|
B
activity occur during the first few days of culture, when these cells
are most responsive to TCS (9). CD34+ cells were incubated
with GM-CSF and TNF-
in the presence of VEGF. Cells were transfected
after different times with a luciferase reporter plasmid containing the
NF-
B-specific promoter from IFN-
. Fourteen hours after the start
of culture, control cells had substantial levels of reporter gene
transcription, and VEGF significantly decreased the observed activity
(Fig. 6
B to DNA as early as 30
min after treatment with TNF-
(Fig. 7
|
|
B function with I
B affects DC
maturation in vitro
The data presented above indicate that defective DC maturation
induced by TCS and VEGF is associated with a decrease in NF-
B
activity. To independently confirm the hypothesis that NF-
B plays an
important role in causing the observed effects of VEGF on DC
differentiation, we used a transdominant inhibitor of NF-
B,
I
B
-
N. This NF-
B inhibitor has deleted critical serine
phosphorylation sites and therefore is not degraded in response to
physiologic stimuli that normally activate nuclear translocation of
NF-
B. Thus, NF-
B-specific transcription is constitutively
inhibited. CD34+ cells were transduced with an
adenovirus expressing I
B-
N (Ad-I
B
-
N) or a control virus
(Ad-ß-gal) on days 0, 3, and 6 after the start of the culture. Cells
were cultured in CCM supplemented with GM-CSF and TNF-
. Medium was
replaced on days 6 and 10. Cells were cultured for a total of 14 days
and were analyzed simultaneously. Adenovirus (100 multiplicity of
infection) had no affect on cell viability (data not shown). The
efficiency of transduction was tested using staining for ß-gal
activity. Forty-eight hours after infection, 40 to 50% of the cells in
all samples were positive for X-gal staining, indicating that
approximately half the cell population was infected and expressing the
ß-gal gene product. The total cell number was the same in all paired
samples. No significant differences were seen in the morphology of the
cells using light microscopy. However, the percentage of cells
expressing one of the DC-associated markers, CD1a, was decreased from
35.5 to 21.3% (14.2% difference) in CD34+ cells infected
with I
B
-
N on day 0. This difference was greater (45.2 vs 21.1
and 24.1%) if cells were transduced with I
B
-
N on day 3. No
effect was seen if cells were infected on day 6 (Fig. 8
A). It should be noted
that the percentage of CD1a+ cells generated from HPC in
the presence of the control adenovirus on day 0 was lower than that
seen when the virus was added on day 3 or day 6. This may reflect a
nonspecific effect of adenovirus on HPCs. The same patterns were
observed when expression of HLA DR on the cell surface was measured.
The group of cells with high MHC class II expression was not seen in
samples with I
B
N transduction on days 0 and 3, whereas no
differences were registered if transduction was performed on day 6
(Fig. 8
B). Cells cultured in the presence of the
NF-
B inhibitor from days 0 and 3 were unable to stimulate control
allogeneic T cells, whereas cells cultured with I
B
-
N from day
6 stimulated T cells at approximately control levels (Fig. 8
C). These effects parallel those observed with TCS
or VEGF, suggesting that NF-
B may be the mediator of the observed
effects.
|
B subunits
We then asked whether VEGF can directly block transcription of the
subunits of NF-
B. RNA was collected from cells cultured with GM-CSF
and either TNF-
or IL-4 on days 1, 4, 7, and 12. Expression of mRNA
for three subunits of NF-
B (c-rel, RelB, and p50) was
studied. As shown in Figure 9
, no
decrease in mRNA expression for any of these subunits in the presence
of TCS or VEGF was observed during the first 4 days of culture.
However, on days 7 and 12, mRNA levels for c-rel and
relB, but not for p50, were only half those in control
cultures in the presence of TCS or VEGF. This observation was seen
mostly in cells cultured with TNF-
. The presence of IL-4 in cell
culture significantly decreased the level of NF-
B mRNA expression in
control samples by day 12, and the effect of VEGF or TCS was observed
only for RelB. We then attempted to determine whether this decrease was
associated with all cells or only with the subpopulation of immature
cells that appeared in the presence of TCS or VEGF. Cells were cultured
for 14 days with GM-CSF and TNF-
in the presence of TCS or VEGF.
After that time, cells were labeled with anti-CD1a Ab, a molecule
expressed on mature DC and Langerhans cells. CD1a+ cells
were separated from CD1a- cells, and the level of mRNA for
NF-
B subunits was measured in each group of cells. As shown in
Figure 7
, mature DC expressed more than sixfold higher levels of mRNA
for c-rel, relB, and p50 than CD1a-
cells. When CD1a+ DC generated in the presence of TCS or
VEGF were compared with those from control samples, no differences in
the level of mRNA for p50 and relB was found, indicating
that the majority of the observed decrease in the bulk population was
due to a shift of cells from the CD1a+ group to the
CD1a- group. However, an almost twofold decrease was still
observed in the level of c-rel mRNA.
|
| Discussion |
|---|
|
|
|---|
We first demonstrated specific binding of VEGF to freshly isolated
CD34+ cells. Two high affinity tyrosine kinase receptors
for VEGF have been previously described on endothelial cells: Flt-1 and
KDR (38, 39). Different signal transduction properties have been
reported for these two receptors (33). FLT-1 has been reported to have
a higher affinity for VEGF than KDR (Kd
values of 1020 and 760770 pM, respectively) (33). We have been able
to detect only mRNA for Flt-1 in HPC, though others have reported that
they express mRNA for KDR. To identify the functional receptor for VEGF
on CD34+ cells, we used competition with PlGF. PlGF has
been recently described as a growth factor with strong homology to VEGF
and to be capable of forming functional heterodimers with VEGF. PlGF is
able to bind to Flt-1, but not to KDR (34, 40). In our experiments PlGF
effectively competed for specific VEGF binding sites on
CD34+ cells. This indicates that VEGF binds to
CD34+ cells via the Flt-1 receptor. Interestingly, Flt-1,
but not KDR, has been identified as the VEGF receptor on monocytes that
mediates the activities of VEGF on the chemotactic and procoagulant
activities of these cells (41, 42). In direct experiments, cells
cultured with GM-CSF and TNF-
in the presence of PlGF demonstrated
reduced ability to stimulate control allogeneic T cells compared with
control cells. These data confirm that signals mediated by Flt-1 are
responsible for the observed defective functional maturation of DC from
progenitor cells.
TCS containing VEGF do not, however, affect the function of mature DC isolated from peripheral blood (9). In this study we have demonstrated that the effect of TCS is closely related to the expression of VEGF receptors on the cells. We have shown that specific VEGF binding decreases dramatically with time in culture and progressive maturation. It was very low on day 7 and almost undetectable on day 14 and on mature DC generated from peripheral blood, closely associated with decreased Flt-1 mRNA levels. The percentage of CD34+ cells in culture also drops dramatically by day 7 (9, 43). Thus, only HPC, but not mature DC, have the ability to bind VEGF.
We then sought to establish the signal transduction and transcriptional
activation mechanisms altered by Flt-1 signaling in HPCs. The
transcription factor NF-
B is involved in regulation of many genes
responsible for cell activation; immune, inflammatory, and cytokine
responses; cell adhesion; and growth control (for review, see Refs. 44
and 45). One of the NF-
B subunits, RelB, has been directly
implicated in DC function, as relB knockout mice have no
mature DC (21). In knockout mice, however, all somatic cells lack the
gene throughout development, and the function of NF-
B in postnatal
HPCs and the signals controlling its activity were undefined. RelB and
other members of the NF-
B family, p65 (RelA), p52, p50, and c-Rel,
are expressed in normal bone marrow-derived DC and in follicular
dendritic cells (46, 47). We therefore hypothesized that NF-
B might
be the transcription factor most responsible for the observed effects
of VEGF on DC maturation. In our experiments, TCS and VEGF blocked the
ability of NF-
B to activate transcription and to specifically bind
DNA, consistent with our hypothesis that the effects of VEGF may be
mediated by reduced NF-
B activity. To independently confirm this, we
blocked NF-
B activity directly in HPCs under our culture conditions
using a transdominant inhibitor of NF-
B, I
B
-
N. Transduction
of CD34+ cells with Ad-I
B
-
N on days 0 and 3 after
the start of culture with GM-CSF and TNF-
dramatically affected DC
maturation in a manner indistinguishable from that observed with TCS.
This effect was not observed when I
B
-
N was transduced 6 days
after the start of the culture, in agreement with our previous data
with TCS. This demonstrates that the first 4 to 5 days of culture are a
critical period in which NF-
B function is required for normal DC
development, and exposure to VEGF during this period can block it. This
time (67 days in culture) is also critical for the appearance of
intermediate cell-type cells that have the potential to differentiate
into either DC or macrophages depending on the culture conditions (48, 49). After 6 to 7 days in culture with GM-CSF and TNF-
, DC
precursors do not proliferate but, rather, differentiate into mature DC
(48), and DC maturation appears to be less dependent on NF-
B.
The initial activation of NF-
B does not require protein synthesis de
novo (50). However, maintenance of NF-
B activity requires protein
synthesis and continuous stimulation, suggesting that regulation also
occurs transcriptionally (51). Since CD34+ cells were
cultured with TNF-
and GM-CSF, known stimulators of NF-
B, we also
studied the possibility that VEGF may directly inhibit transcription of
NF-
B and hence result in reduced activity. However, no effect of TCS
or VEGF on the level of NF-
B transcription was observed during the
first 4 days in culture, while NF-
B activity was significantly
decreased as early as 14 h after the start of culture with VEGF. A
decreased ability of NF-
B to bind to specific DNA sequences was
detected as early as 30 min after stimulation with TNF-
in the
presence of VEGF or PlGF (Fig. 7
). Significant decreases in mRNA for
relB and c-rel were observed only after day 7,
suggesting that transcriptional changes were secondary to the effects
occurring during the first 5 to 6 days in culture. It is interesting
also that NF-
B activity was closely associated with relatively
mature DC. The level of mRNA for all three studied member of the
NF-
B family (c-rel, relB, and p50) was
dramatically higher (six- to sevenfold) in mature DC than in other
cells in the final culture. The precise chain of events leading to
defective NF-
B function after exposure of HPC to VEGF is not clear.
It is possible that VEGF signaling through the Flt-1 receptor may
directly inhibit the dissociation of NF-
B from I
B in the
cytoplasm. Recently, it has been reported that site-specific tyrosine
phosphorylation of I
B
may inhibit its inducible serine
phosphorylation and degradation, preventing translocation of NF-
B to
the nucleus (52). Since NF-
B is positively autoregulated after cell
stimulation (53, 54), sequestration of NF-
B in the cytoplasm may
result in lower levels of transcription in the presence of VEGF, as
observed in our experiments. Further studies are needed to test these
hypotheses.
As we reported previously and demonstrated here, treatment with VEGF or
PLGF alone induces about a 45% decrease in the function of DC
generated from progenitors. Treatment with the dominant inhibitor
results in a more dramatic effect. PLGF or VEGF are likely to work
through complex pathways involving many unknown factors, and their
effects are less profound that direct blockade of NF-
B by the
dominant inhibitor I
B
N.
Finally, in this study we for the first time demonstrated that VEGF
specifically binds to Flt-1 receptors on the surface of HPC and that
this leads to inhibition of NF-
B activity and to a defect in DC
maturation. We also for the first time have shown that NF-
B is
directly involved in the early stages of DC maturation from hemopoietic
progenitor cells. Thus, tumor-derived soluble factors, including VEGF,
may affect the function of professional APC that may, in turn, result
in a decreased ability of the immune system to generate effective
antitumor immune responses.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Dmitry I. Gabrilovich, The Vanderbilt Cancer Center, 649 MRB II, Nashville, TN 37232-6838. E-mail: ![]()
3 Abbreviations used in this paper: DC, dendritic cells; VEGF, vascular endothelial growth factor; HPC, hemopoietic progenitor cell; NF-
B, nuclear factor-
B; I
B, inhibitory protein-
B; CCM, complete culture medium; GM-CSF, granulocyte-macrophage CSF; TCS, tumor cell supernatants; bright, strongly expressed; PlGF, placenta growth factor; EMSA, electrophoretic mobility shift assay; Ad-ß-gal, adenovirus-ß-galactosidase; M-CSF, macrophage CSF. ![]()
Received for publication May 5, 1997. Accepted for publication October 6, 1997.
| References |
|---|
|
|
|---|
B/I
B family: intimate tales of association and dissociation. Genes Dev. 9:2723.
B: a lesson in family values. Cell 80:529.[Medline]
B-
activates NF-
B without proteolytic degradation of I
B-
. Cell 86:787.[Medline]
B binds to the intronic region of the human interferon-
gene at a site related to an interferon-stimulable response element. Proc. Natl. Acad. Sci. USA 89:1740.
B function. Cell 63:803.[Medline]
B. Proc. Natl. Acad. Sci. USA 86:2336.
in cultured human vascular endothelial cells. J. Clin. Invest. 98:490.[Medline]
light chain expression and NF
B activation but not I
B
degradation in 70Z/3 murine pre-B cells. Eur. J. Immunol. 25:2961.[Medline]
B/I
B story. Adv. Cancer Res. 66:255.[Medline]
B and Rel proteins in innate immunity. Adv. Immunol. 58:1.[Medline]
B/Rel and Sp1 transcription factors in human immunodeficiency virus 1-induced, dendritic cell-T-cell syncytia. Proc. Natl. Acad. Sci. USA 92:10944.
B by a posttranslational mechanism. Cell 47:921.[Medline]
B activity is dependent on protein synthesis and the continuous presence of external stimuli. Mol. Cell. Biol. 11:259.
Ba negatively regulates its inducible phosphorylation and degradation. J. Biol. Chem. 271:31049.
B indicates that it participates in its own regulation. EMBO J. 11:195.[Medline]
B-mediated positive and negative autoregulation. Mol. Cell. Biol. 14:7695.This article has been cited by other articles:
![]() |
A. Soeda, Y. Morita-Hoshi, H. Makiyama, C. Morizane, H. Ueno, M. Ikeda, T. Okusaka, S. Yamagata, N. Takahashi, I. Hyodo, et al. Regular Dose of Gemcitabine Induces an Increase in CD14+ Monocytes and CD11c+ Dendritic Cells in Patients with Advanced Pancreatic Cancer Jpn. J. Clin. Oncol., December 1, 2009; 39(12): 797 - 806. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. B. Dorff, A. Goldkorn, and D. I. Quinn Review: Targeted therapy in renal cancer Therapeutic Advances in Medical Oncology, November 1, 2009; 1(3): 183 - 205. [Abstract] [PDF] |
||||
![]() |
K. Schmidt, K. Seeger, C. Scheibenbogen, R. Bender, M. Abdulla, S. Sussmilch, A. Salama, and A. Moldenhauer Histone deacetylase inhibition improves differentiation of dendritic cells from leukemic blasts of patients with TEL/AML1-positive acute lymphoblastic leukemia J. Leukoc. Biol., March 1, 2009; 85(3): 563 - 573. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Leroy, S. De Seigneux, V. Agassiz, U. Hasler, M.-E. Rafestin-Oblin, M. Vinciguerra, P.-Y. Martin, and E. Feraille Aldosterone Activates NF-{kappa}B in the Collecting Duct J. Am. Soc. Nephrol., January 1, 2009; 20(1): 131 - 144. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mancino, T. Schioppa, P. Larghi, F. Pasqualini, M. Nebuloni, I-H. Chen, S. Sozzani, J. M. Austyn, A. Mantovani, and A. Sica Divergent effects of hypoxia on dendritic cell functions Blood, November 1, 2008; 112(9): 3723 - 3734. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Hasler, V. Leroy, U. S. Jeon, R. Bouley, M. Dimitrov, J. A. Kim, D. Brown, H. M. Kwon, P.-Y. Martin, and E. Feraille NF-{kappa}B Modulates Aquaporin-2 Transcription in Renal Collecting Duct Principal Cells J. Biol. Chem., October 17, 2008; 283(42): 28095 - 28105. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Williams, T. Rangasamy, S. M. Bauer, S. Killedar, M. Karp, T. W. Kensler, M. Yamamoto, P. Breysse, S. Biswal, and S. N. Georas Disruption of the Transcription Factor Nrf2 Promotes Pro-Oxidative Dendritic Cells That Stimulate Th2-Like Immunoresponsiveness upon Activation by Ambient Particulate Matter J. Immunol., October 1, 2008; 181(7): 4545 - 4559. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Bhandarkar, J. Bromberg, C. Carrillo, P. Selvakumar, R. K. Sharma, B. N. Perry, B. Govindarajan, L. Fried, A. Sohn, K. Reddy, et al. Tris (Dibenzylideneacetone) Dipalladium, a N-Myristoyltransferase-1 Inhibitor, Is Effective against Melanoma Growth In vitro and In vivo Clin. Cancer Res., September 15, 2008; 14(18): 5743 - 5748. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Koldehoff, D. W. Beelen, and A. H. Elmaagacli Small-molecule inhibition of proteasome and silencing by vascular endothelial cell growth factor-specific siRNA induce additive antitumor activity in multiple myeloma J. Leukoc. Biol., August 1, 2008; 84(2): 561 - 576. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Duluc, Y. Delneste, F. Tan, M.-P. Moles, L. Grimaud, J. Lenoir, L. Preisser, I. Anegon, L. Catala, N. Ifrah, et al. Tumor-associated leukemia inhibitory factor and IL-6 skew monocyte differentiation into tumor-associated macrophage-like cells Blood, December 15, 2007; 110(13): 4319 - 4330. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-L. Lin, Y.-C. Liang, and B.-L. Chiang Placental growth factor down-regulates type 1 T helper immune response by modulating the function of dendritic cells J. Leukoc. Biol., December 1, 2007; 82(6): 1473 - 1480. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Tian, S. Grimaldo, M. Fugita, J. Cutts, N. L. Vujanovic, and L.-Y. Li The Endothelial Cell-Produced Antiangiogenic Cytokine Vascular Endothelial Growth Inhibitor Induces Dendritic Cell Maturation J. Immunol., September 15, 2007; 179(6): 3742 - 3751. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Fricke, N. Mirza, J. Dupont, C. Lockhart, A. Jackson, J.-H. Lee, J. A. Sosman, and D. I. Gabrilovich Vascular Endothelial Growth Factor-Trap Overcomes Defects in Dendritic Cell Differentiation but Does Not Improve Antigen-Specific Immune Responses Clin. Cancer Res., August 15, 2007; 13(16): 4840 - 4848. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Manning, J. G.M. Ullman, J. M. Leatherman, J. M. Asquith, T. R. Hansen, T. D. Armstrong, D. J. Hicklin, E. M. Jaffee, and L. A. Emens A Vascular Endothelial Growth Factor Receptor-2 Inhibitor Enhances Antitumor Immunity through an Immune-Based Mechanism Clin. Cancer Res., July 1, 2007; 13(13): 3951 - 3959. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Jewett, C. Head, and N.A. Cacalano Emerging Mechanisms of Immunosuppression in Oral Cancers Journal of Dental Research, December 1, 2006; 85(12): 1061 - 1073. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Otahal, T. D. Schell, S. C. Hutchinson, B. B. Knowles, and S. S. Tevethia Early Immunization Induces Persistent Tumor-Infiltrating CD8+ T Cells against an Immunodominant Epitope and Promotes Lifelong Control of Pancreatic Tumor Progression in SV40 Tumor Antigen Transgenic Mice. J. Immunol., September 1, 2006; 177(5): 3089 - 3099. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wang, J. Yang, J. Qian, M. Wezeman, L. W. Kwak, and Q. Yi Tumor evasion of the immune system: inhibiting p38 MAPK signaling restores the function of dendritic cells in multiple myeloma Blood, March 15, 2006; 107(6): 2432 - 2439. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Appel, V. Mirakaj, A. Bringmann, M. M. Weck, F. Grunebach, and P. Brossart PPAR-{gamma} agonists inhibit toll-like receptor-mediated activation of dendritic cells via the MAP kinase and NF-{kappa}B pathways Blood, December 1, 2005; 106(12): 3888 - 3894. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Vermaelen and R. Pauwels Pulmonary Dendritic Cells Am. J. Respir. Crit. Care Med., September 1, 2005; 172(5): 530 - 551. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Cejas, L. M. Carlson, J. Zhang, S. Padmanabhan, D. Kolonias, I. Lindner, S. Haley, L. H. Boise, and K. P. Lee Protein Kinase C {beta}II Plays an Essential Role in Dendritic Cell Differentiation and Autoregulates Its Own Expression J. Biol. Chem., August 5, 2005; 280(31): 28412 - 28423. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Appel, A. Rupf, M. M. Weck, O. Schoor, T. H. Brummendorf, T. Weinschenk, F. Grunebach, and P. Brossart Effects of Imatinib on Monocyte-Derived Dendritic Cells Are Mediated by Inhibition of Nuclear Factor-{kappa}B and Akt Signaling Pathways Clin. Cancer Res., March 1, 2005; 11(5): 1928 - 1940. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Dikov, J. E. Ohm, N. Ray, E. E. Tchekneva, J. Burlison, D. Moghanaki, S. Nadaf, and D. P. Carbone Differential Roles of Vascular Endothelial Growth Factor Receptors 1 and 2 in Dendritic Cell Differentiation J. Immunol., January 1, 2005; 174(1): 215 - 222. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hoeben, B. Landuyt, M. S. Highley, H. Wildiers, A. T. Van Oosterom, and E. A. De Bruijn Vascular Endothelial Growth Factor and Angiogenesis Pharmacol. Rev., December 1, 2004; 56(4): 549 - 580. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Platzer, A. Jorgl, S. Taschner, B. Hocher, and H. Strobl RelB regulates human dendritic cell subset development by promoting monocyte intermediates Blood, December 1, 2004; 104(12): 3655 - 3663. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Le Gouill, K. Podar, M. Amiot, T. Hideshima, D. Chauhan, K. Ishitsuka, S. Kumar, N. Raje, P. G. Richardson, J.-L. Harousseau, et al. VEGF induces Mcl-1 up-regulation and protects multiple myeloma cells against apoptosis Blood, November 1, 2004; 104(9): 2886 - 2892. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Podar, R. Shringarpure, Y.-T. Tai, M. Simoncini, M. Sattler, K. Ishitsuka, P. G. Richardson, T. Hideshima, D. Chauhan, and K. C. Anderson Caveolin-1 Is Required for Vascular Endothelial Growth Factor-Triggered Multiple Myeloma Cell Migration and Is Targeted by Bortezomib Cancer Res., October 15, 2004; 64(20): 7500 - 7506. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Takeuchi, S.-i. Hiraoka, X.-Y. Zhou, M. Nagafuku, S. Ono, T. Tsujimura, M. Nakazawa, Y. Yura, T. Hamaoka, and H. Fujiwara Anti-HER-2/neu Immune Responses Are Induced before the Development of Clinical Tumors but Declined following Tumorigenesis in HER-2/neu Transgenic Mice Cancer Res., October 15, 2004; 64(20): 7588 - 7595. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Moldenhauer, R. C. Frank, J. Pinilla-Ibarz, G. Holland, P. Boccuni, D. A. Scheinberg, A. Salama, K. Seeger, M. A. S. Moore, and S. D. Nimer Histone deacetylase inhibition improves dendritic cell differentiation of leukemic blasts with AML1-containing fusion proteins J. Leukoc. Biol., September 1, 2004; 76(3): 623 - 633. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Podar, L. P. Catley, Y.-T. Tai, R. Shringarpure, P. Carvalho, T. Hayashi, R. Burger, R. L. Schlossman, P. G. Richardson, L. N. Pandite, et al. GW654652, the pan-inhibitor of VEGF receptors, blocks the growth and migration of multiple myeloma cells in the bone marrow microenvironment Blood, May 1, 2004; 103(9): 3474 - 3479. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Rao, C.-M. Hao, and M. D. Breyer Hypertonic Stress Activates Glycogen Synthase Kinase 3{beta}-mediated Apoptosis of Renal Medullary Interstitial Cells, Suppressing an NF{kappa}B-driven Cyclooxygenase-2-dependent Survival Pathway J. Biol. Chem., February 6, 2004; 279(6): 3949 - 3955. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Appel, A. M. Boehmler, F. Grunebach, M. R. Muller, A. Rupf, M. M. Weck, U. Hartmann, V. L. Reichardt, L. Kanz, T. H. Brummendorf, et al. Imatinib mesylate affects the development and function of dendritic cells generated from CD34+ peripheral blood progenitor cells Blood, January 15, 2004; 103(2): 538 - 544. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nefedova, M. Huang, S. Kusmartsev, R. Bhattacharya, P. Cheng, R. Salup, R. Jove, and D. Gabrilovich Hyperactivation of STAT3 Is Involved in Abnormal Differentiation of Dendritic Cells in Cancer J. Immunol., January 1, 2004; 172(1): 464 - 474. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Murillo, A. Arina, I. Tirapu, C. Alfaro, G. Mazzolini, B. Palencia, A. L.-D. De Cerio, J. Prieto, M. Bendandi, and I. Melero Potentiation of Therapeutic Immune Responses against Malignancies with Monoclonal Antibodies Clin. Cancer Res., November 15, 2003; 9(15): 5454 - 5464. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Melani, C. Chiodoni, G. Forni, and M. P. Colombo Myeloid cell expansion elicited by the progression of spontaneous mammary carcinomas in c-erbB-2 transgenic BALB/c mice suppresses immune reactivity Blood, September 15, 2003; 102(6): 2138 - 2145. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Corn, M. A. Aronica, F. Zhang, Y. Tong, S. A. Stanley, S. R. A. Kim, L. Stephenson, B. Enerson, S. McCarthy, A. Mora, et al. T Cell-Intrinsic Requirement for NF-{kappa}B Induction in Postdifferentiation IFN-{gamma} Production and Clonal Expansion in a Th1 Response J. Immunol., August 15, 2003; 171(4): 1816 - 1824. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kusmartsev and D. I. Gabrilovich Inhibition of myeloid cell differentiation in cancer: the role of reactive oxygen species J. Leukoc. Biol., August 1, 2003; 74(2): 186 - 196. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Woltman and C. van Kooten Functional modulation of dendritic cells to suppress adaptive immune responses J. Leukoc. Biol., April 1, 2003; 73(4): 428 - 441. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sharma, M. Stolina, S.-C. Yang, F. Baratelli, J. F. Lin, K. Atianzar, J. Luo, L. Zhu, Y. Lin, M. Huang, et al. Tumor Cyclooxygenase 2-dependent Suppression of Dendritic Cell Function Clin. Cancer Res., March 1, 2003; 9(3): 961 - 968. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Casella, T. Feccia, C. Chelucci, P. Samoggia, G. Castelli, R. Guerriero, I. Parolini, E. Petrucci, E. Pelosi, O. Morsilli, et al. Autocrine-paracrine VEGF loops potentiate the maturation of megakaryocytic precursors through Flt1 receptor Blood, February 15, 2003; 101(4): 1316 - 1323. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Andreakos, C. Smith, C. Monaco, F. M. Brennan, B. M. Foxwell, and M. Feldmann Ikappa B kinase 2 but not NF-kappa B-inducing kinase is essential for effective DC antigen presentation in the allogeneic mixed lymphocyte reaction Blood, February 1, 2003; 101(3): 983 - 991. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Lin, K. Podar, D. Gupta, Y.-T. Tai, S. Li, E. Weller, T. Hideshima, S. Lentzsch, F. Davies, C. Li, et al. The Vascular Endothelial Growth Factor Receptor Tyrosine Kinase Inhibitor PTK787/ZK222584 Inhibits Growth and Migration of Multiple Myeloma Cells in the Bone Marrow Microenvironment Cancer Res., September 1, 2002; 62(17): 5019 - 5026. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Ruby, M. Leid, and N. I. Kerkvliet 2,3,7,8-Tetrachlorodibenzo-p-dioxin Suppresses Tumor Necrosis Factor-alpha and Anti-CD40-Induced Activation of NF-kappa B/Rel in Dendritic Cells: p50 Homodimer Activation Is Not Affected Mol. Pharmacol., September 1, 2002; 62(3): 722 - 728. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. I. Gabrilovich, P. Cheng, Y. Fan, B. Yu, E. Nikitina, A. Sirotkin, M. Shurin, T. Oyama, Y. Adachi, S. Nadaf, et al. H1{degrees} histone and differentiation of dendritic cells. A molecular target for tumor-derived factors J. Leukoc. Biol., August 1, 2002; 72(2): 285 - 296. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nencioni, F. Grunebach, A. Zobywlaski, C. Denzlinger, W. Brugger, and P. Brossart Dendritic Cell Immunogenicity Is Regulated by Peroxisome Proliferator-Activated Receptor {gamma} J. Immunol., August 1, 2002; 169(3): 1228 - 1235. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. O'Sullivan and R. Thomas CD40 Ligation Conditions Dendritic Cell Antigen-Presenting Function Through Sustained Activation of NF-{kappa}B J. Immunol., June 1, 2002; 168(11): 5491 - 5498. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Fong, D. Brockstedt, C. Benike, J. K. Breen, G. Strang, C. L. Ruegg, and E. G. Engleman Dendritic Cell-Based Xenoantigen Vaccination for Prostate Cancer Immunotherapy J. Immunol., December 15, 2001; 167(12): 7150 - 7156. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Cheng, A. Zlobin, V. Volgina, S. Gottipati, B. Osborne, E. J. Simel, L. Miele, and D. I. Gabrilovich Notch-1 Regulates NF-{kappa}B Activity in Hemopoietic Progenitor Cells J. Immunol., October 15, 2001; 167(8): 4458 - 4467. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Weaver Jr., B. Poligone, T. Bui, U. M. Abdel-Motal, A. S. Baldwin Jr., and R. Tisch Dendritic Cells from Nonobese Diabetic Mice Exhibit a Defect in NF-{kappa}B Regulation Due to a Hyperactive I{kappa}B Kinase J. Immunol., August 1, 2001; 167(3): 1461 - 1468. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Podar, Y.-T. Tai, F. E. Davies, S. Lentzsch, M. Sattler, T. Hideshima, B. K. Lin, D. Gupta, Y. Shima, D. Chauhan, et al. Vascular endothelial growth factor triggers signaling cascades mediating multiple myeloma cell growth and migration Blood, July 15, 2001; 98(2): 428 - 435. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Dikov, T. Oyama, P. Cheng, T. Takahashi, K. Takahashi, T. Sepetavec, B. Edwards, Y. Adachi, S. Nadaf, T. Daniel, et al. Vascular Endothelial Growth Factor Effects on Nuclear Factor-{{kappa}}B Activation in Hematopoietic Progenitor Cells Cancer Res., March 1, 2001; 61(5): 2015 - 2021. [Abstract] [Full Text] |
||||
![]() |
W. T. Bellamy, L. Richter, D. Sirjani, C. Roxas, B. Glinsmann-Gibson, Y. Frutiger, T. M. Grogan, and A. F. List Vascular endothelial cell growth factor is an autocrine promoter of abnormal localized immature myeloid precursors and leukemia progenitor formation in myelodysplastic syndromes Blood, March 1, 2001; 97(5): 1427 - 1434. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ugurel, G. Rappl, W. Tilgen, and U. Reinhold Increased Serum Concentration of Angiogenic Factors in Malignant Melanoma Patients Correlates With Tumor Progression and Survival J. Clin. Oncol., January 15, 2001; 19(2): 577 - 583. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Matsushita, R. Motani, T. Sakutal, N. Yamaguchi, T. Koga, K. Matsuo, S. Nagaoka, K. Abeyama, I. Maruyama, and M. Torii The Role of Vascular Endothelial Growth Factor in Human Dental Pulp Cells: Induction of Chemotaxis, Proliferation, and Differentiation and Activation of the AP-1-dependent Signaling Pathway Journal of Dental Research, August 1, 2000; 79(8): 1596 - 1603. [Abstract] [PDF] |
||||
![]() |
P. Brossart, A. Zobywalski, F. Grünebach, L. Behnke, G. Stuhler, V. L. Reichardt, L. Kanz, and W. Brugger Tumor Necrosis Factor {{alpha}} and CD40 Ligand Antagonize the Inhibitory Effects of Interleukin 10 on T-Cell Stimulatory Capacity of Dendritic Cells Cancer Res., August 1, 2000; 60(16): 4485 - 4492. [Abstract] [Full Text] |
||||
![]() |
S. R. Wedge, D. J. Ogilvie, M. Dukes, J. Kendrew, J. O. Curwen, L. F. Hennequin, A. P. Thomas, E. S. E. Stokes, B. Curry, G. H. P. Richmond, et al. ZD4190: An Orally Active Inhibitor of Vascular Endothelial Growth Factor Signaling with Broad-Spectrum Antitumor Efficacy Cancer Res., February 1, 2000; 60(4): 970 - 975. [Abstract] [Full Text] |
||||
![]() |
S. M. Kiertscher, J. Luo, S. M. Dubinett, and M. D. Roth Tumors Promote Altered Maturation and Early Apoptosis of Monocyte-Derived Dendritic Cells J. Immunol., February 1, 2000; 164(3): 1269 - 1276. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Brenner, C. Rossig, U. Sili, J. W. Young, and E. Goulmy Transfusion Medicine: New Clinical Applications of Cellular Immunotherapy Hematology, January 1, 2000; 2000(1): 356 - 375. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Neumann, H.-W. Fries, C. Scheicher, P. Keikavoussi, A. Kolb-Maurer, E.-B. Brocker, E. Serfling, and E. Kampgen Differential expression of Rel/NF-kappa B and octamer factors is a hallmark of the generation and maturation of dendritic cells Blood, January 1, 2000; 95(1): 277 - 285. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. I. Gabrilovich, T. Ishida, S. Nadaf, J. E. Ohm, and D. P. Carbone Antibodies to Vascular Endothelial Growth Factor Enhance the Efficacy of Cancer Immunotherapy by Improving Endogenous Dendritic Cell Function Clin. Cancer Res., October 1, 1999; 5(10): 2963 - 2970. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Ohm, M. R. Shurin, C. Esche, M. T. Lotze, D. P. Carbone, and D. I. Gabrilovich Effect of Vascular Endothelial Growth Factor and FLT3 Ligand on Dendritic Cell Generation In Vivo J. Immunol., September 15, 1999; 163(6): 3260 - 3268. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Matsui, J. D. Ahlers, A. O. Vortmeyer, M. Terabe, T. Tsukui, D. P. Carbone, L. A. Liotta, and J. A. Berzofsky A Model for CD8+ CTL Tumor Immunosurveillance and Regulation of Tumor Escape by CD4 T Cells Through an Effect on Quality of CTL J. Immunol., July 1, 1999; 163(1): 184 - 193. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Verhasselt, W. Vanden Berghe, N. Vanderheyde, F. Willems, G. Haegeman, and M. Goldman N-Acetyl-L-Cysteine Inhibits Primary Human T Cell Responses at the Dendritic Cell Level: Association with NF-{kappa}B Inhibition J. Immunol., March 1, 1999; 162(5): 2569 - 2574. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Gabrilovich, T. Ishida, T. Oyama, S. Ran, V. Kravtsov, S. Nadaf, and D. P. Carbone Vascular Endothelial Growth Factor Inhibits the Development of Dendritic Cells and Dramatically Affects the Differentiation of Multiple Hematopoietic Lineages In Vivo Blood, December 1, 1998; 92(11): 4150 - 4166. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ishida, T. Oyama, D. P. Carbone, and D. I. Gabrilovich Defective Function of Langerhans Cells in Tumor-Bearing Animals Is the Result of Defective Maturation from Hemopoietic Progenitors J. Immunol., November 1, 1998; 161(9): 4842 - 4851. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R. Wong, R. Josien, S. Y. Lee, M. Vologodskaia, R. M. Steinman, and Y. Choi The TRAF Family of Signal Transducers Mediates NF-kappa B Activation by the TRANCE Receptor J. Biol. Chem., October 23, 1998; 273(43): 28355 - 28359. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rosic-Kablar, K. Chan, M. D. Reis, I. D. Dube, and M. R. Hough Induction of tolerance to immunogenic tumor antigens associated with lymphomagenesis in HOX11 transgenic mice PNAS, November 21, 2000; 97(24): 13300 - 13305. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |