The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sim, B.-C.
Right arrow Articles by Gascoigne, N. R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sim, B.-C.
Right arrow Articles by Gascoigne, N. R. J.
The Journal of Immunology, 1998, 160: 1204-1211.
Copyright © 1998 by The American Association of Immunologists

Polymorphism Within a TCRAV Family Influences the Repertoire Through Class I/II Restriction1

Bee-Cheng Sim, Jay L. Wung and Nicholas R. J. Gascoigne2

Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Antibody-staining experiments have shown that closely related members of the TCRAV3 family are reciprocally selected into the CD4 or CD8 peripheral T cell subsets. This has been attributed to the individual AV3 members interacting preferentially with either MHC class I or MHC class II molecules. Single amino acid residues present in the complementarity-determining regions (CDR) CDR1{alpha} and CDR2{alpha} are important in determining MHC class specificity. We have now extended these observations to survey the expressed repertoire of the AV3 family in C57BL/6 mice. Three of the four expressed AV3 members are preferentially selected into the CD4+ subset of T cells. These share the same amino acid residue in both CDR1{alpha} and CDR2{alpha} that differ from the only CD8-skewed member. Preferential expression of an individual AV3 is not caused by other endogenous {alpha}- or ß-chains, by any conserved CDR3 sequence, or by the usage of TCRAJ regions. This study shows that residues in the CDR1 and CDR2 regions are primary determinants for MHC class discrimination and suggests that polymorphism found within a TCRAV family has an important effect on the overall shaping of the T cell repertoire.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The T cell repertoire within an individual is biased toward the ability of the TCR to recognize MHC proteins. T cells that are positively selected on MHC class I protein develop into CD8+ peripheral T cells, and those that recognize MHC class II proteins become positively selected into CD4+ cells (1, 2). Transgenic studies show that the CD4 or CD8 phenotype of T cells will be in accordance with the specificity of the transgenic TCR for either MHC class I or MHC class II (3, 4, 5, 6). All TCRAV regions analyzed to date with anti-TCRAV Abs exhibit a remarkable preference to be "skewed" into either the CD4+ or CD8+ peripheral T cell subset. V{alpha}3.2, V{alpha}8, and human V{alpha}12.1 are consistently found in a higher proportion in the CD8+ cells (7, 8, 9); while V{alpha}3.1, V{alpha}2, and V{alpha}11.1/11.2 are more predominant in the CD4+ population of T cells (10, 11, 12, 13). Because this phenomenon is generally independent of MHC haplotype, it has been strongly suggested that each of these V{alpha} elements is positively selected by either MHC class I or MHC class II molecules. This view is consistent with reports that the TCR has an intrinsic ability to interact with MHC molecules (14, 15). In addition, the crystal structure of TCR-MHC class I complexes show the germline-encoded complementarity-determining regions (CDR)3 CDR1{alpha} and CDR2{alpha} of the TCR making significant contact with the MHC molecule (16, 17). In one case, the CDR1{alpha} and CDR2{alpha} contact the class I molecule, but the CDR1ß and CDR2ß have little or no interaction (17).

In C57BL/6 (B6) mice, the closely related V{alpha}3.1 (AV3S5) and V{alpha}3.2 (AV3S2) elements are reciprocally skewed into the CD4+ and CD8+ T cell subsets, respectively (7, 13). Comparison of the sequences of AV3S5 and AV3S2 shows that four amino acid residues differ between them. These are at positions 27, 51, 85, and 92. It has previously been shown that T cells expressing an AV3S5 transgene are skewed preferentially into the CD4+ subset (13, 18). Using a panel of mutant AV3S5 transgenes, we determined that residue 27 in the CDR1{alpha} region and residue 51 in the CDR2{alpha} region are sufficient for determining MHC specificity. When either of these residues in AV3S5 were mutated to the corresponding residue from AV3S2, the transgene expression was skewed to the CD8 cells (18).

The mouse TCRAV locus contains many more V regions than the TCRBV locus. Having undergone several rounds of gene duplication, most V{alpha} families have several family members (19). Analysis of published V{alpha} families shows that much of the within-family diversity is in the CDR1{alpha} and CDR2{alpha} regions (11, 20, 21, 22, 23). With the presence of many closely related V{alpha} genes with a high degree of polymorphism in CDR1{alpha} and CDR2{alpha}, which we know can result in biased usage of the various members of a V{alpha} family in class I- or class II-restricted T cells, it is likely that the T cell repertoire will be affected. We therefore analyzed the expressed closely related members of the AV3 family in B6 mice. Only one of the four AV3 members observed in B6 is strongly over-represented in the CD8+ T cell subset, with the other three family members being biased to the CD4+ population to varying degrees. The three CD4-skewed members share similar amino acid residues in both the CDR1{alpha} and CDR2{alpha} and differ from particular residues found in the single CD8-skewed member. There appears to be no preference in TCRAJ usage in either T cell population. Taking into account the lack of obvious influence by endogenous {alpha}-chains, ß-chains, and J regions, the unique residues present in the CDR1{alpha} and CDR2{alpha} are probably crucial for controlling selection into class I- or II-restricted T cells. Polymorphism within a TCRAV family will have a strong impact on MHC class discrimination which inevitably will contribute to the overall T cell repertoire.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice

The B6 mice were obtained from The Scripps Research Institute vivarium. The TCRA knockout mice, C57BL/6J-Tcratm1Mom (24) (TCRA-/-) were a seventh generation backcross to B6 and were purchased from The Jackson Laboratory (Bar Harbor, ME). The panel of V{alpha}3 transgenic mice, namely V{alpha}3.1, V{alpha}3.1 m, CDR1 m, and CDR2 m, are described in detail elsewhere (18). Briefly, the {alpha}-chain from the T cell clone Ar-5 (25), AV3S5J31, was used to generate the V{alpha}3.1 transgenic mice. Specific point mutations were made in the wild-type AV3S5 gene to resemble the closely related AV3S2 element giving rise to the three mutant transgenic lines. Therefore, the V{alpha}3.1 m transgenic mice bear three mutations in the AV3S5 gene at position 27 from serine (S27) to phenylalanine (F) (i.e., S27F), S51P, and S85W; the CDR1 m transgenic mice carry the S27F single amino acid mutation in the CDR1{alpha} region, while the CDR2 m mice have the S51P mutation in the CDR2{alpha}.

FACS analysis and Abs

Erythrocyte-free PBL were subjected to three-color FACS analysis. The wild-type V{alpha}3.1 and CDR2 m transgene-expressing cells were detected with an antiserum raised against AV3S5 (13, 18), while lymphocytes expressing the V{alpha}3.1 m and the CDR1 m transgene were stained with the AV3S2-specific RR3-16 Ab. We previously showed that the epitope for this Ab depends on phenylalanine 27, present in AV3S2 and these two mutants (18). Thy-1.2+ lymphocytes were further divided into the CD4 and CD8 subsets. In the V{alpha}3Vß pairing experiments described in Figure 3Go, lymphocytes isolated from lymph nodes were subjected to four-color FACS analysis. To enrich transgene-expressing CD4+ cells and transgene-expressing CD8+ cells, lymphocytes expressing the respective transgenes were first sorted into the appropriate T cell populations followed by staining with the panel of Vß Abs. Data acquired are represented as a percentage of the respective V{alpha}3Vß pair in the CD4+ and CD8+ subsets.



View larger version (38K):
[in this window]
[in a new window]
  		FIGURE 3. Pairing of transgenic V{alpha}3s with individual Vßs in CD8+ and CD4+ cells. The population of transgene expressing T cells in the CD8+ (A) and CD4+ (B) subsets was enhanced by cell sorting and subsequently stained for the panel of Vßs indicated. An average of three individual animals were analyzed for each transgenic V{alpha}3 chain. Data shown are expressed as a percentage (± SD) of V{alpha}3 transgene+ T cells paired to a particular Vß.

 
All Abs utilized were purchased from PharMingen (San Diego, CA) unless otherwise stated. Anti-TCRV{alpha}3.2 (RR3-16) and anti-CD8{alpha} (53-6.7) were used as FITC-conjugated Abs; and anti-Vß3 (KJ-25), anti-Vß6 (RR4-7), anti-Vß7 (TR310), and anti-Vß8.1/8.2 (MR5-2) were conjugated with phycoerythrin. The AV3S5 antiserum (13) was provided by Drs. L. Zerva and M. Greene (University of Pennsylvania, Philadelphia, PA) with goat anti-rabbit (heavy chain + light chain)-FITC as the second-step reagent (Jackson ImmunoResearch Labs, Inc., West Grove, PA). mAbs against TCRVß9 (MR10-2), Vß10 (B21.5), Vß11 (RR3-15), Vß12 (MR11-1), Vß13 (MR12-3), were used in biotinylated form with streptavidin-phycoerythrin as the second-step reagent. Anti-CD8 allophycocyanin, anti-CD8 RED613, and anti-CD4 RED613 (H129.19) Abs were purchased from Life Technologies (Grand Island, NY).

RT-PCR, spectratyping, and sequencing

Lymphocytes from spleens and lymph nodes were isolated from (B6 x TCRA-/-)F1 mice, double-stained with anti-CD4 RED613 and anti-CD8{alpha}-FITC, and sorted into the respective CD4+ and CD8+ T cell subsets. Total RNAs from the sorted CD4+ and CD8+ population of T cells were extracted following standard procedures (26). First strand cDNA was reverse transcribed using a cDNA kit (Life Technologies, Grand Island, NY) and subjected to two rounds of PCR with nested AV3 primers. In the first round of PCR, the 5' primer used was specific for the AV3 leader sequence (5' TTCCGAGCTCATGCTCCTGGCA CTCCTCCCA 3'), and the 3' primer was specific for the 3' end of the {alpha}-chain constant region (5' TGTGATGCCACGTTGACCGAGAAAAGCTTT 3'). The second round of PCR used a primer specific for the 5' end of the variable region (5' GATGCCCAAGCTCAGTCAGTG 3') with the 3' primer complementary to the 5' end of the constant region (5' CCCAGAACCTGCTGTGTACTCTAGACGG 3'). Both 5' end primers will hybridize equally well to AV3S1, -S2, -S3, -S5, and -S6 (no 5' leader sequence is available for AV3S7). They will, however, not anneal to AV3S4 or AV3S8, which are very divergent members of the AV3 family, having ~75% identitiy at the amino acid level. It has previously been reported that AV3S4 was not identified by cross-hybridization with an AV3S5 probe in BALB/c (23). The product of the second round PCR reaction was isolated and cloned into either of two vectors: pCRII in conjunction with Taq polymerase (Invitrogen, San Diego, CA) in experiment 1; or pCR-script AmpSK(+) with Vent polymerase (Stratagene, San Diego, CA) in experiment 2. Randomly picked clones from each T cell subset were sequenced bidirectionally using the T7 primer and M13 reverse primer. DNA sequencing was performed by the Protein and Nucleic Acids Core facility of The Scripps Research Institute, using the FS dye terminator cycle sequencing method and the Applied Biosystems/Perkin-Elmer models 373x1 and 377 DNA sequencers. Sequences obtained were aligned to published AV3 sequences (23, 25, 27). Nomenclature used for the AV3 and TCRAJ regions are in accordance with References 27 and 28, respectively. Spectratyping to determine the length of CDR3{alpha} in the AV3 populations was performed using the same PCR primers as above, with 32P-labeled 3' primer for the second-step PCR, as described (29). PCR was performed with Taq polymerase. The PCR product was run on a 6% DNA sequencing gel and analyzed using a PhosphorImager and ImageQuaNT software (Molecular Dynamics, Sunnyvale, CA).

Genomic Southern blot analysis

Genomic DNA from the liver of B6 mice was isolated, subjected to complete restriction endonuclease digestion, separated on an 0.8% agarose gel, and blotted onto zeta-probe GT membrane (Bio-Rad, Richmond, CA) according to standard procedures (30). Hybridization was conducted at 68°C with a 220-bp AV3-specific probe, isolated from a genomic subclone of AV3S5J31 (25). This probe spans part of the intron following the leader sequence and ~one-half of the variable region. The filter was washed in 3x SSC/0.1% SDS at 65°C with a final wash in 0.3x SSC/0.1% SDS. Under these fairly stringent conditions, no cross-hybridization to other V{alpha} families is observed.

Statistics

Student’s t test, ANOVA, and Mann-Whitney tests were performed using the program InStat v2.01 (Graphpad Software).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Reciprocal skewing of AV3 family members into the CD4 and CD8 T cell subsets

The frequency of expression of AV3 family members in the CD4+ and CD8+ peripheral T cell subsets in B6 mice was determined by FACS analysis. The AV3S2 TCR was differentiated from the other AV3 family members by the V{alpha}3.2-specific mAb, RR3-16, and is observed to be expressed predominantly in the CD8 population (Fig. 1Go). This Ab distinguishes between the AV3 family members on the basis of the phenylalanine residue at amino acid 27, present only in AV3S2 (18). The rest of the AV3 members were detected by an antiserum raised against AV3S5 and were collectively found in a higher frequency in the CD4 subset of T cells (Fig. 1Go). This antiserum probably does not distinguish between the family members. It is remarkable that closely related members of the same family are reciprocally skewed into the CD4 and CD8 subset of T cells.



View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 1. Ab staining of AV3 family members in CD8+ and CD4+ peripheral T cell subsets. Lymphocytes were triple-stained for FACS analysis as described in Materials and Methods. The frequency of V{alpha}3.2 (AV3S2) present in B6 mice is presented as the percentage of RR3-16+ cells in the respective T cell subsets. For the other AV3 family members, data are calculated as a percentage of cells positive for the V{alpha}3.1 antiserum minus the percentage of RR3-16+ cells in the same T cell population (*). Symbols represent individual mice.

 
Endogenous {alpha}-chains do not influence preferential AV3 transgene skewing

In all previous studies, the preferential skewing of V{alpha} has been observed in the presence of other endogenous V{alpha} elements. It has been suggested that during thymic development and in mature T cells, functional allelic exclusion is maintained by competition between two {alpha}-chains for a single ß-chain (31, 32). It is therefore possible that in transgenic studies, endogenous V{alpha} elements may influence an individual V{alpha} to be over-represented in the CD4 or CD8 subset. To address this question, we bred our panel of AV3 transgenic mice to the TCRA-/- strain so as to limit the choice of {alpha}-chain to that of the transgene (Materials and Methods) (18). Second- and third-generation backcross offspring typed as V{alpha}3 transgene+/TCRA-/- were analyzed for expression of the transgene in the CD4 and CD8 population. When present as the sole expressed {alpha}-chain, the V{alpha}3.1 (AV3S5J31) transgene consistently showed an over-representation of the transgene in the CD4+ subset compared with the CD8+ population (Fig. 2Go). The ratio of the transgene expressed in the CD4+ to that in the CD8+ population (CD4-CD8 ratio ± SD) is 2.24 ± 0.39. In contrast, the three transgenic lines carrying various mutant forms of the AV3 chains showed a relatively higher proportion of CD8+ cells expressing the transgene (Fig. 2Go). The AV3S2-like V{alpha}3.1 m+/TCRA-/- mice had the highest frequency of the mutant V{alpha}3.1 transgene expressed in the CD8+ population with a CD4-CD8 ratio of 0.73 ± 0.36. The two transgenes that each had a single residue from the AV3S2 sequence had a higher CD4-CD8 ratio. The CDR1 m+/TCRA-/- mice had a CD4-CD8 ratio of 1.06 ± 0.20 while that of the CDR2 m+/TCRA-/- was 1.41 ± 0.30. Although the effect of skewing was less prominent on the TCRA-/- than on the wild-type B6 background, these data clearly show that endogenous {alpha}-chains did not affect the preferential skewing of the individual transgenic {alpha}-chains. The strength of selection for class I restriction by the AV3S2 residue appears to be marginally stronger for the CDR1 than for the CDR2 region, with an additive effect as reflected in the V{alpha}3.1 m transgenic line. This is consistent with the notion of preferential interaction with MHC class I or class II transgenic {alpha}-chain.



View larger version (53K):
[in this window]
[in a new window]
  		FIGURE 2. CD4-CD8 ratio in V{alpha}3 transgene+/TCRA-/- mice. Seven V{alpha}3.1 transgene+/TCRA-/- (V{alpha}3.1), 10 V{alpha}3.1 m transgene+/TCRA-/- (V{alpha}3.1 m), 8 CDR1 m transgene+/TCRA-/- (CDR1 m), and 1 CDR2 m transgene+/TCRA-/- (CDR2 m) mice were independently analyzed. Data shown are the CD4-CD8 (mean ± SD) ratio derived from the percentage of the respective V{alpha}3 transgene+-expressing cells that stained positive for either the CD4 or CD8 coreceptors.

 
Lack of ß-chain participation in V{alpha} skewing

Because TCR functions as an {alpha}ß heterodimer and the fact that certain Vß-elements have been reported to show skewed expression themselves (33, 34, 35, 36, 37, 38), the effect of the ß-chain on the preferential V{alpha} selection was investigated. Lymph node T cells from the panel of AV3 transgenic mice were sorted into transgene-expressing CD4+ and transgene-expressing CD8+ T cell populations and stained for various ß-chains. With all nine anti-Vß Abs tested (Vß3, -6, -7, -8, -9, -10, -11, -12, and -13), T cells expressing the V{alpha}3.1, V{alpha}3.1 m, CDR1 m, and CDR2 m transgenes paired with approximately equal frequency with any particular Vß element (Fig. 3Go). An ANOVA test showed no significant differences in these groups, with the possible exception of CD4+ Vß12+ cells, where there was a weakly significant difference (p = 0.05). Student’s t tests between each of the groups showed that there were significant diffferences between CDR2 m and both V{alpha}3.1 m and CDR1 m (p = 0.0105 and 0.0113, respectively). It is unclear whether this is a real difference. If so, we would also have expected a difference between wild-type V{alpha}3.1 transgenic and these transgenics.

The similar pairing of the V{alpha}3 transgenes with different Vßs is observed in both the CD4+ and CD8+ subsets. For example, lymphocytes bearing the V{alpha}3.1 transgene plus Vß3 constitute ~1.70 ± 0.01% (± SD) in the CD8 population; V{alpha}3.1 m/Vß3, 2.67 ± 0.49%; CDR1 m/Vß3, 2.13 ± 0.35; and CDR2 m/Vß3, 2.67 ± 0.60 (Fig. 3GoA). In the CD4 subset, V{alpha}3.1 transgene plus Vß3 is 2.65 ± 0.21%; V{alpha}3.1 m/Vß3, 3.17 ± 0.64%; CDR1 m/Vß3, 2.83 ± 0.47%; and CDR2 m/Vß3, 3.45 ± 0.35% (Fig. 3GoB). Hence, skewing of an individual {alpha}-chain is not influenced by endogenous ß-chains within the T cell subsets. The pairing frequency of the panel of transgenic V{alpha}3 chains for different Vßs is largely a reflection of the frequency of the Vßs expressed in B6 mice (33, 35, 38, 39). For example, all four transgenic V{alpha}3 chains pair most frequently with Vß8, the most common Vß in B6 mice, accounting for an average of ~14% in both T cell populations. Some of the Vß usages vary between CD4 and CD8 subsets. This difference is significant by t test for Vß7 (p = 0.0001), Vß9 (p = 0.0016), Vß11 (p = 0.0014), and Vß13 (p < 0.0001) skewing to CD8 cells and for Vß6 (p = 0.0017) and Vß3 (p = 0.0475) skewing to CD4 cells. The skewing of Vß usage in pairing with the transgenic {alpha}-chains was similar to expression in the whole population (Refs. 35 and 39 and data not shown). The exception to this is with Vß6, where the expression in CD4+ cells is increased in the V{alpha}3+ population (8.5 ± 0.52%) compared with the level in the CD4+ population at large (4.6 ± 0.8%, p = 0.0016) (33, 39). Thus, this Vß element may more frequently pair with the V{alpha} transgenes to make a class II-restricted heterodimer than some other Vßs. Vß6 has been noted as being positively selected on the class II molecule I-E (33, 34).

Amino acid sequences in the CDR1{alpha} and CDR2{alpha} regions of the TCR influence MHC class discrimination

Southern blot analysis of genomic liver DNA from a wild-type B6 mouse digested with EcoRI, BamHI, and HindIII was probed with an AV3-specific probe derived from AV3S5 (Materials and Methods). This Southern analysis yielded four distinct AV3-hybridizing DNA bands for each endonuclease digestion and thus suggests that four genes exist for the AV3 family in this strain (Fig. 4Go). In BALB/c mice, four AV3 family members have been identified (23).



View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 4. Genomic Southern analysis of B6 V{alpha}3 family. Liver DNA isolated from B6 mice was subjected to Southern analysis as described in Materials and Methods. The RFLP pattern obtained for the AV3 family is shown together with the molecular size marker on the left. a = HindIII, b = BamHI, and c = EcoRI.

 
As shown in Figure 1Go, closely related members of the AV3 family are observed to undergo selection by different MHC classes. Due to the lack of good anti-V{alpha} Abs that can differentiate between members of the same family, we have extended our analysis of the expressed repertoire of the AV3 family in B6 mice using DNA sequencing. mRNA from sorted CD4+ and CD8+ T cell subsets was extracted from B6 TCRA hemizygous mice (i.e., F1 mice derived from a cross between a B6 and a TCRA-/-) to avoid the problem of expression of two {alpha}-chain mRNAs (31, 32). By means of reverse transcription followed by two rounds of PCR, the variable regions of the expressed members of the AV3 family were cloned, sequenced, and compared with published data (23, 27, 40). Consistent with the Southern analysis, only four members of the AV3 family were detected by this strategy (Fig. 5Go): AV3S2 (known previously as V{alpha}3.2); AV3S3 (V{alpha}3.3); AV3S5 (V{alpha}3.1); and AV3S9. Identical in amino acid sequences except at position 67, AV3S5 and AV3S9 are two independent genes in B6 with other silent mutations throughout the nucleotide sequences. Both AV3S2 and AV3S9 have been reported elsewhere and have been established as B6 and bm12 TCRAV3 family members, respectively (23, 41, 42). AV3S3 was originally sequenced from the closely related strain, C57BL/10 (23, 41). AV3S5, previously reported from (BALB/c x A/J) TCRAa mice (25), was also expressed frequently in B6 mice. On the other hand, AV3S4 (40), originally derived from B6 and virtually identical with AV3S8 (derived from C.B20; a BALB/c-derived TCRAa strain congenic for the IgH locus) (27), was not detected in our study. This is likely due to the relatively low homology in nucleotide and amino acid sequences of this member to the others in the AV3 family. AV3S4 and AV3S8 are as divergent from the rest of the AV3 family as AV3 is from the AV9 family (27). As shown in the sequence alignments, the B6 TCRAV3 family members displayed very limited sequence diversity at the nucleotide and amino acid levels, sharing >95% sequence homology (Fig. 5Go). Such strong sequence conservation suggests that these AV3 family members are the result of a series of recent gene duplication events. Importantly, the few differences observed between members are often to be found in the CDRs.



View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 5. Nucleotide (A) and deduced amino acid sequence (B) comparison of the four expressed AV3 genes in B6. Only the variable regions are depicted with dashes indicating sequence identity. Both CDR1 (bases 70–93, amino acid residues 24–31) and CDR2 (bases 142–160, amino acid residues 48–55) regions are underlined. The CDR3 region starts with residue 93. The AV3S9 sequence has been deposited in the GenBank database and assigned accession number AF038580. AV3S2, 3, and 5 are X05734, X05732, and M21202, respectively.

 
Of the AV3 {alpha}-chain cDNAs from the CD4+ and CD8+ populations that were randomly picked and sequenced in two independent experiments, a trend in the AV3 family member’s distribution into the CD4 and CD8 T cell subsets was apparent (Table IGo). Analyzing only clones that differ in the CDR3 region (i.e., independent clones), AV3S9, AV3S5, and AV3S3 were observed to be more frequently expressed in the CD4+ than the CD8+ peripheral T cell subset in both experiments, although to varying degrees. In contrast, AV3S2 is the only AV3 member that is strongly skewed into the CD8+ and is the least represented in the CD4+ population. This finding is consistent with FACS staining experiments performed with the antiserum and RR3-16 (Fig. 1Go) and further confirms our transgenic studies (18).


View this table:
[in this window]
[in a new window]
  		Table I. Skewed expression of AV3 family in B6 hemizygous mice into the CD4 and CD8 subsets1

 
Residues 27 and 51 that lie within the CDR1{alpha} and CDR2{alpha} regions, respectively (see Fig. 7Go), are important in determining the specificity for MHC restriction (18). The CD4-skewed TCRAV3 members, AV3S9, AV3S5, and AV3S3, are identical with each other in the CDR2{alpha} regions (Table IGo). In the CDR1{alpha} segment, AV3S9 and AV3S5 are similar to each other while AV3S3 bears an alanine residue in position 28 that differs from the glycine residue found in AV3S9 and AV3S5. In spite of this, all three CD4-biased members share the same amino acid residue in both CDR1{alpha} and CDR2{alpha} that differs in the single CD8-skewed member. In AV3S2, a phenylalanine residue in position 27 and a proline in position 51 replace the serine residue in both positions in the CD4-skewed members. It is therefore likely that the CDR1{alpha} and CDR2{alpha} residues that are unique to AV3S2 are responsible for its strong selection into the class I-restricted population. In contrast, the alanine in position 28, carried by the CD4-skewed AV3S3, is not sufficient or necessary to alter the selection of this V{alpha}3 protein from a class II-preferred to a class I-restricted phenotype. However, the conservative nature of the glycine/alanine change may mask an important role for residue 28 in the MHC interaction.



View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 7. Positions of the various amino acid residues that differ between AV3S5 and the other AV3 members. The 2C TCR structure is presented (protein database ID 1TCR) (16) viewed with the program RasMol. The {alpha}-chain is closer to the viewer and is shown in ribbon form, with the ß-chain shown as strands. The molecule is oriented with the V domains above and the C domains below; thus the MHC-peptide recognition site is at the top of the structure. The residues that are different between AV3S5 and AV3S2 (A), AV3S3 (B), and AV3S9 (C) are shown, with side chains, in space-filling form. For clarity, the differences at positions 91 and 92 are not shown. These residues are involved in internal packing and do not form part of the CDR3.

 
TCRAJ region usage and length of CDR3{alpha}

The TCR {alpha}-chain is generated by rearrangement of V and J gene segments, thereby making the {alpha}-chain J usage an additional factor that can affect the T cell repertoire. As shown in Table IIGo, TCRAJ usage by the numerous {alpha}-chain cDNA clones in the CD4 and CD8 populations shows no clear pattern. Of the 21 TCRAJ segments used in 18 CD8-derived sequences and 22 CD4-derived sequences, only 4 were used in both groups. These are J7, J27, J37, and J39. Of the five most frequently used J regions (J27 was used five times, J21 and J37 were used four times, J34 and J22 were used three times), two were found only in CD8s (J21 and J22), one was seen only in CD4s (J34), and two were shared (J27 and J37). Thus, the overselection of the respective AV3 into the CD4+ or CD8+ peripheral T cell population is independent of a restricted set of J{alpha} segments. The CDR3{alpha} results from VJ joining and N-region nucleotide addition during rearrangement of the TCR. The length of the CDR3 can be used as a measure of diversity. Minute changes in one amino acid in the CDR3 region can produce significant changes in overall TCR structure and alter recognition properties (43). In this study, the actual boundaries of the CDR3{alpha} have been determined from the mouse 2C TCR crystal structure (16). CDR3{alpha} starts at residue 93 and continues to two residues before the phenylalanine in the FGXG J-region motif (or before the leucine residue in the LGXG motif in the case of J7) (16). Although the AV3 clones found in the CD8 subset generally had slightly longer CDR3s than those present in the CD4s (medians of 9 and 10 amino acids, respectively) (Table IIGo), the difference was not statistically significant. Spectratype analysis of CDR3 length showed no significant difference in length between AV3 family members expressed in the CD4 or CD8 subset (Fig. 6Go).


View this table:
[in this window]
[in a new window]
  		Table II. TCRAJ usage and CDR3 length in the CD4 and CD8 subsets1

 


View larger version (113K):
[in this window]
[in a new window]
  		FIGURE 6. Spectratype analysis of the CDR3{alpha} lengths of AV3 mRNAs in the CD4 and CD8 subsets. mRNA from CD4+ and CD8+ TCRA hemizygous mice was subjected to RT-PCR as described in Materials and Methods. The second-round PCR included 32P-labeled 3'-primer. The PCR products were electrophoresed on a 6% DNA sequencing gel and exposed to a PhosphorImager screen. Analysis of the bands in the CD4 and CD8 lanes showed no significant difference in the length distribution.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
It is remarkable that the five anti-V{alpha} Abs (one of which is an antiserum) available in the mouse system show that each V{alpha} segment is preferentially selected into either the CD4 or CD8 subset of peripheral T cells. This phenomenon is not only evident in mouse strains but is also observed in rats and humans (9, 44, 45). Such prevalent skewing that is minimally affected by H-2 alleles is suggestive of positive selection by either MHC class I or II molecules. In the present study, we have provided further evidence for the role of TCR V{alpha} segments in TCR-MHC interactions in repertoire selection.

Closely related members of the AV3 family were found to be reciprocally skewed into the CD4 or CD8 subset. The effect of the skewing was, however, moderated when the panel of AV3 chain transgenic mice were bred onto an TCRA-/- background. Although the data clearly indicate a lack of endogenous {alpha}-chain contribution to the preferential skewing of the individual transgenic {alpha}-chains, some other mechanism reduces the extent of skewing to that of the observed additive effect. This could be because homeostatic mechanisms are governing the production of larger numbers of CD4 cells than CD8 cells, since there is evidence for some precommitment of CD4 or CD8 precursors distinct from the specificity of their TCR (46, 47) (reviewed in Refs. 1 and 2). Thus, there is a larger pool of thymocytes with the potential to be CD4 cells than there are with the potential to become CD8 cells. The panel of Vß specific mAbs used covers ~45 to 55% of the TCRBV repertoire, and yet no major differences in Vß usage were observed between these AV3 family members. The lack of selective Vß pairing, together with no apparent contributions from endogenous V{alpha} elements, indicates that the {alpha}-chain of the TCR-{alpha}ß heterodimer is primarily responsible for T cell repertoire selection. This does not rule out the possibility of a contribution from the ß-chain coming from the CDR3. For example, in CD4 cells with the "CD8-skewed" {alpha}-chain, it is likely that the cells use a repertoire of ß-chains, enabling them to be class II restricted.

To date, 61 mouse TCRAJ elements have been identified (28). Of these, 21 different TCRAJs were used in the 41 AV3 clones in experiment 2. Although some TCRAJ segments are used slightly more frequently than others either in one particular T cell subset or in both, the broad and random TCRAJ usage suggests that overselection does not depend on a restricted set of J{alpha} elements. It has recently been shown that positive repertoire selection and alloreactivity specific for a rat class I molecule, that preferentially affect one V{alpha} element, differ mainly by differential TCRAJ usage and CDR3{alpha} composition. Positive repertoire selection is believed to be independent of any specific CDR3/J{alpha} requirements, while alloreactive responses require a more stringent CDR3/J{alpha} composition to ensure a stronger MHC interaction (44, 45). The length distribution of a given CDR3 region has been used to predict recognition properties of TCR-{gamma}{delta}, TCR-{alpha}ß, and Igs and as a measure for diversity (29, 43). We did not find a significant difference in CDR3{alpha} length between the CD4 and CD8 populations expressing AV3. Overall, the TCR V{alpha} skewing into the CD4 or CD8 subset is due mainly to the V{alpha} segment and is not achieved by differential TCRAJ element usage or contributed by a restricted CDR3{alpha} sequence.

From analysis of published V{alpha} sequences, it is difficult to assign sequence polymorphisms observed as allelic differences or differences between family members (11, 27, 48). AV3S4, previously isolated from B6 and designated as an AV3 member based on amino acid and nucleotide sequence homology to the family, was not detected in the present study. AV3S4 is most homologous to AV3S8 (98.6%). At the amino acid level, AV3S4 is as similar to AV3S1 and AV3S5 as AV3S5 is to AV9S1 and AV9S2 (75–80%). It is as similar to AV3S2, AV3S3, AV3S6, and AV3S7 as AV3S6 and AV3S7 are to AV9S1 and AV9S2 (70–75%). At the amino acid level, AV3S3 is more similar to AV9S1 and AV9S2 (75–80%) than it is to AV3S4 (70–75%). At the nucleotide level, AV3S3 is 75 to 80% identical with AV9S1 and AV9S2, but is 80–90% identical with V3S4. Based on the criteria that V gene segments that show >75% similarity at the nucleotide level are considered members of the same family (49), AV3S4 has been classified as a member of the AV3 family. However, in our Southern blot analysis, only four V{alpha}3-hybridizing bands were detected, which suggests the existence of four AV3 family members. The four different classes of nucleotide sequences obtained from our "library" of AV3 clones did not include sequences resembling AV3S4. With a >75% sequence similarity, AV3S4 should have generated an intense hybridization signal in our Southern analysis. Using a similar AV3 probe isolated from the Ar-5 T cell clone, Tan et al. (23) had also failed to isolate an "allelic form" of AV3S4 from BALB/c, leading them to exclude AV3S4 as a AV3 family member.

Due to the lack of availability of anti-V{alpha} Abs that can differentiate between all members of the same AV family, the present strategy of nucleotide sequencing of expressed V regions from TCRA hemizygous mice was used for the AV3 family. This study provides strong evidence that the composition of the TCR CDR1{alpha} and CDR2{alpha} regions have a major role in selection on MHC class I and II. Single residues can markedly affect selection. Parallel observations are drawn for the TCRAV11 family (manuscript in preparation). The TCR has evolved toward having a strong intrinsic ability for binding to MHC molecules (14, 15). The mouse TCRAV locus is large, and most V{alpha} families have several family members (19, 50, 51, 52, 53, 54). Analysis of published V{alpha} families show that family members tend to have significant variation in their CDR1{alpha} and CDR2{alpha} regions (11, 20, 21, 22, 23, 27). Crystal structures of TCR in complex with their MHC/peptide ligands in both mouse and human models have also revealed significant contact points between the CDR1{alpha} and CDR2{alpha} with the MHC molecules (16, 17). In one of these cases, MHC interactions are provided by both CDR3{alpha} and ß loops and by CDR1 and CDR2 of V{alpha} but not by Vß (17). It is possible that a V{alpha} element can interact better with most alleles of either MHC class I or II because potential TCR contact sites along the {alpha}-helices are remarkably conserved within the MHC class. In the structure of Garboczi et al. (17), CDR1{alpha} contacts six class I residues of which four are conserved. The CDR2{alpha} makes contact with three class I residues, all of which are conserved in different haplotypes. The class II residues in the positions analogous to these TCR contact residues are also conserved within class II alleles, but the residues are different amino acids from those in class I. Therefore, significant structural differences exist between class I and II MHC proteins that can result in class distinction. If each member is biased to recognize either class I or II protein as governed by their CDR1{alpha} and CDR2{alpha} sequences, the relative size and composition of the CD4 and CD8 T cell repertoires will be affected. These data and the conservation of skewed selection across different MHC haplotypes could well explain the maintenance of large families of closely related V{alpha} genes and the concentration of within-family diversity in the CDRs.

Figure 7Go shows the respective positions of the amino acid residues that differ between the AV3 family members with respect to AV3S5. As shown in Figure 7GoA, CDR1{alpha} residue 27 and CDR2{alpha} residue 51, but not residue 85 in AV3S2 that differ from the CD4-skewed AV3 members, are poised for interaction with the MHC molecules. It is therefore not surprising that these residues are critically involved in MHC class selection. Residue 85 lies at the base of ß strand F and is not necessary for MHC class specificity (18). In AV3S3, CDR1{alpha} residue 28, although well positioned for MHC interaction (Fig. 7GoB), was not sufficient or crucial in altering MHC restriction. This could still be an important residue for MHC contact, but with the glycine to alanine change not making a significant difference. The glycine to serine change at residue 61 and the arginine to glutamine change at residue 76 are fairly conservative and do not change the selection. While CDR1{alpha} and CDR2{alpha} undoubtedly play a major role in MHC class specificity, residues located outside these regions may have an effect on the degree of skewing. AV3S5 is less skewed into the CD4 population than AV3S9. Positioned on the fourth variable loop (CDR4) (16), serine 67 in AV3S5 may be less interactive than the bulky isoleucine carried by AV3S9 (Fig. 7GoC). Residues from the CDR4 lie over the MHC-peptide complex (17). A recent study has revealed that N-terminal residues, i.e., not only the canonical TCR CDR regions, can affect TCR engagement with MHC-peptide complex (55). We are currently addressing this question with transgenic mouse studies.


   Footnotes
 
1 This work is supported by National Institutes of Health Grant R01 GM48002 to N.R.J.G. B.-C.S. is supported by the Concern Foundation for Cancer Research. This is Publication 11009-IMM from The Scripps Research Institute. Back

2 Address correspondence and reprint requests to Dr. N..R..J. Gascoigne, Department of Immunology, IMM1, The Scripps Research Institute, 10550 N. Torrey Pines Road, La Jolla, CA 92037. E-mail address: Back

3 Abbreviation used in this paper: CDR, complementarity-determining region. Back

Received for publication July 30, 1997. Accepted for publication October 22, 1997.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Robey, E., B. J. Fowlkes. 1994. Selective events in T cell development. Annu. Rev. Immunol. 12:675.[Medline]
  2. Jameson, S. C., K. A. Hogquist, M. J. Bevan. 1995. Positive selection of thymocytes. Annu. Rev. Immunol. 13:93.[Medline]
  3. Teh, H. S., P. Kisielow, B. Scott, H. Kishi, Y. Uematsu, H. Bluthmann, H. von Boehmer. 1988. Thymic major histocompatibility complex antigens and the {alpha}ß T-cell receptor determine the CD4/CD8 phenotype of T cells. Nature 335:229.[Medline]
  4. Sha, W. C., C. A. Nelson, R. D. Newberry, D. M. Kranz, J. H. Russell, D. Y. Loh. 1988. Selective expression of an antigen receptor on CD8-bearing T lymphocytes in transgenic mice. Nature 335:271.[Medline]
  5. Berg, L. J., A. M. Pullen, B. Fazekas de St. Groth, D. Mathis, C. Benoist, M. M. Davis. 1989. Antigen/MHC-specific T cells are preferentially exported from the thymus in the presence of their MHC ligand. Cell 58:1035.[Medline]
  6. Kaye, J., M.-L. Hsu, M. E. Sauron, S. C. Jameson, N. R. J. Gascoigne, S. M. Hedrick. 1989. Selective development of CD4+ T cells in transgenic mice expressing a class II MHC-restricted antigen receptor. Nature 341:746.[Medline]
  7. Utsunomiya, Y., J. Bill, E. Palmer, K. Gollob, Y. Takagaki, O. Kanagawa. 1989. Analysis of a monoclonal rat antibody directed to the {alpha}-chain variable region (V{alpha}3) of the mouse T cell antigen receptor. J. Immunol. 143:2602.[Abstract]
  8. Tomonari, K.. 1992. Negative selection of Tcra-V8+ CD8+ T cells by MHC class I molecules. Immunogenetics 35:291.[Medline]
  9. DerSimonian, H., H. Band, M. B. Brenner. 1991. Increased frequency of T cell receptor V{alpha}12.1 expression on CD8+ T cells: evidence that V{alpha} participates in shaping the peripheral T cell repertoire. J. Exp. Med. 174:639.[Abstract/Free Full Text]
  10. Jameson, S. C., J. Kaye, N. R. J. Gascoigne. 1990. A T cell receptor V{alpha} region selectively expressed in CD4+ cells. J. Immunol. 145:1324.[Abstract]
  11. Jameson, S. C., P. B. Nakajima, J. L. Brooks, W. Heath, O. Kanagawa, N. R. J. Gascoigne. 1991. The T cell receptor V{alpha}11 gene family: analysis of allelic sequence polymorphism and demonstration of J{alpha}-region dependent recognition by allele-specific antibodies. J. Immunol. 147:3185.[Abstract]
  12. Pircher, H., N. Rebaï, M. Groettrup, C. Grégoire, D. E. Speiser, M. P. Happ, E. Palmer, R. M. Zinkernagel, H. Hengartner, B. Malissen. 1992. Preferential positive selection of V{alpha}2+CD8+ T cells in mouse strains expressing both H-2k and T cell receptor V{alpha}a haplotypes: determination with a V{alpha}2-specific monoclonal antibody. Eur. J. Immunol. 22:399.[Medline]
  13. Saouaf, S. J., M. Katsumata, K. Yui, S. Thayu, N. R. J. Gascoigne, M. I. Greene. 1994. Azobenzenearsonate hapten specific T cell receptor alpha chain transgenic mice. Transgenics 1:185.
  14. Zerrahn, J., W. Held, D. H. Raulet. 1997. The MHC reactivity of the T cell repertoire prior to positive and negative selection. Cell 88:627.[Medline]
  15. Merkenschlager, M., D. Graf, M. Lovatt, U. Bommhardt, R. Zamoyska, A. G. Fisher. 1997. How many thymocytes audition for selection?. J. Exp. Med. 186:1149.[Abstract/Free Full Text]
  16. Garcia, K. C., M. Degano, R. L. Stanfield, A. Brunmark, M. R. Jackson, P. A. Peterson, L. Teyton, I. A. Wilson. 1996. An {alpha}ß T cell receptor structure at 2.5Å and its orientation in the TCR-MHC complex. Science 274:209.[Abstract/Free Full Text]
  17. Garboczi, D. N., P. Ghosh, U. Utz, Q. R. Fan, W. E. Biddison, D. C. Wiley. 1996. Structure of the complex between human T-cell receptor, viral peptide and HLA-A2. Nature 384:134.[Medline]
  18. Sim, B.-C., L. Zerva, M. I. Greene, N. R. J. Gascoigne. 1996. Control of MHC restriction by TCR V{alpha} CDR1 and CDR2. Science 273:963.[Abstract]
  19. Jouvin-Marche, E., I. Hue, P. N. Marche, C. Liebe-Gris, J.-P. Marolleau, B. Malissen, P.-A. Cazenave, M. Malissen. 1990. Genomic organization of the mouse T cell receptor V{alpha} family. EMBO J. 9:2141.[Medline]
  20. Chou, H. S., M. A. Behlke, S. A. Godambe, J. H. Russell, C. G. Brooks, D. Y. Loh. 1986. T cell receptor genes in an alloreactive CTL clone: implications for rearrangement and germline diversity of variable gene segments. EMBO J. 5:2149.[Medline]
  21. Wang, K., C.-L. Kuo, K.-C. Cheng, M.-K. Lee, B. Paeper, B. F. Koop, T.-J. Yoo, L. Hood. 1994. Structural analysis of the mouse T-cell receptor Tcra V2 subfamily. Immunogenetics 40:116.[Medline]
  22. Gahéry-Ségard, H., E. Jouvin-Marche, A. Six, C. Gris-Liebe, M. Malissen, B. Malissen, P. A. Cazenave, P. N. Marche. 1996. Germline genomic structure of the B10. A mouse Tcra-V2 gene subfamily. Immunogenetics 44:298.[Medline]
  23. Tan, K. N., K. Huang, K. V. Myrick, G. Tanigawa. 1996. Diversity of the Tcra-V3 gene family in BALB/c mice. Immunogenetics 44:372.[Medline]
  24. Mombaerts, P., A. R. Clarke, M. A. Rudnicki, J. Iacomini, S. Itohara, J. Lafaille, L. Wang, Y. Ichikawa, R. Jaenisch, M. L. Hooper, S. Tonegawa. 1992. Mutations in T cell receptor genes {alpha} and ß block thymocyte development at different stages. Nature 360:225.[Medline]
  25. Tan, K.-N., B. M. Datlof, J. A. Gilmore, A. C. Kronman, J. H. Lee, A. M. Maxam, A. Rao. 1988. The T cell receptor V{alpha}3 gene segment is associated with reactivity to p-azobenzenearsonate. Cell 54:247.[Medline]
  26. Chomczynski, P., N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156.[Medline]
  27. Arden, B., S. P. Clark, D. Kabelitz, T. W. Mak. 1995. Mouse T-cell receptor variable gene segment families. Immunogenetics 42:501.[Medline]
  28. Koop, B. F., L. Rowen, K. Wang, C. L. Kuo, D. Seto, J. A. Lenstra, S. Howard, W. Shan, P. Deshpande, L. Hood. 1994. The human T-cell receptor TCRAC/TCRDC (C{alpha}/C{delta}) region: organization, sequence, and evolution of 97.6 kb of DNA. Genomics 19:478.[Medline]
  29. Gorski, J., M. Yassai, X. Zhu, B. Kissela, C. Keever, N. Flomenberg. 1994. Circulating T cell repertoire complexity in normal individuals and bone marrow recipients analyzed by CDR3 size spectratyping: correlation with immune status. J. Immunol. 152:5109.[Abstract]
  30. Sambrook, J., E. Fritsch, T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  31. Malissen, M., J. Trucy, E. Jouvin-Marche, P.-A. Cazenave, R. Scollay, B. Malissen. 1992. Regulation of TCR {alpha} and ß gene allelic exclusion during T-cell development. Immunol. Today 13:315.[Medline]
  32. Alam, S. M., I. N. Crispe, N. R. J. Gascoigne. 1995. Allelic exclusion of mouse T cell receptor {alpha} chains occurs at the time of thymocyte TCR up-regulation. Immunity 3:449.[Medline]
  33. Tomonari, K., S. Fairchild. 1992. Positive and negative selection of Tcrb-V6+ T cells. Immunogenetics 36:230.[Medline]
  34. MacDonald, H. R., R. Lees, R. Schneider, R. M. Zinkernagel, H. Hengartner. 1988. Positive selection of CD4+ thymocytes controlled by MHC class II gene products. Nature 336:471.[Medline]
  35. Tomonari, K., R. Hederer, H. Hengartner. 1992. Positive selection of Tcrb-V10b+ T cells. Immunogenetics 35:9.[Medline]
  36. Blackman, M. A., P. Marrack, J. Kappler. 1989. Influence of the major histocompatibility complex on positive thymic selection of Vß17a+ T cells. Science 244:214.[Abstract/Free Full Text]
  37. Liao, N.-S., J. Maltzman, D. H. Raulet. 1989. Positive selection determines T cell receptor Vß14 gene usage by CD8+ T cells. J. Exp. Med. 170:135.[Abstract/Free Full Text]
  38. Tomonari, K., O. A. Rosenwasser, S. P. Fairchild. 1997. The T cell receptor Vß-specific positive selection: importance of the CDR4. K. Tomonari, ed. Viral Superantigens 127. CRC Press, Boca Raton, FL.
  39. Sim, B.-C., P. J. Travers, N. R. J. Gascoigne. 1997. V{alpha}3.2 selection in MHC class I mutant mice: evidence for an alternate orientation of TCR-MHC class I interaction. J. Immunol. 159:3322.[Abstract]
  40. Spinella, D. G., T. H. Hansen, W. D. Walsh, M. A. Behlke, J. P. Tillinghast, H. S. Chou, P. J. Whiteley, J. A. Kapp, C. W. Pierce, E. M. Shevach, D. H. Loh. 1987. Receptor diversity of insulin-specific T cell lines from C57BL (H-2b) mice. J. Immunol. 138:3991.[Abstract]
  41. Iwamoto, A., P. S. Ohashi, H. Pircher, C. L. Walker, E. E. Michalopoulos, F. Rupp, H. Hengartner, T. W. Mak. 1987. T cell receptor variable gene usage in a specific cytotoxic T cell response: primary structure of the antigen-MHC receptor of four hapten-specific cytotoxic T cell clones. J. Exp. Med. 165:591.[Abstract/Free Full Text]
  42. Kobori, J. A., L. Hood, N. Shastri. 1992. Structure-function relationship among T-cell receptors specific for lysozyme peptides bound to Ab or Abm-12 molecules. Proc. Natl. Acad. Sci. USA 89:2940.[Abstract/Free Full Text]
  43. Rock, E. P., P. R. Sibbald, M. M. Davis, Y. Chien. 1994. CDR3 length in antigen-specific immune receptors. J. Exp. Med. 179:323.[Abstract/Free Full Text]
  44. Torres-Nagel, N., T. Herrmann, G. Giegerich, K. Wonigeit, T. Hünig. 1994. Preferential TCR V usage in positive repertoire selection and alloreactivity of rat T-lymphocytes. Int. Immunol. 6:1367.[Abstract/Free Full Text]
  45. Torres-Nagel, N., A. Deutschländer, T. Herrmann, B. Arden, T. Hünig. 1997. Control of TCR V{alpha}-mediated positive repertoire selection and alloreactivity by differential J{alpha} usage and CDR3{alpha} composition. Int. Immunol. 9:1441.[Abstract/Free Full Text]
  46. Crompton, T., R. K. Lees, H. Pircher, H. R. MacDonald. 1993. Precommitment of CD4+CD8+ thymocytes to either CD4 or CD8 lineages. Proc. Natl. Acad. Sci. USA 90:8982.[Abstract/Free Full Text]
  47. Corbella, P., D. Moskophidis, E. Spanopoulou, C. Mamalaki, M. Tolaini, A. Itano, D. Lans, D. Baltimore, E. Robey, D. Kioussis. 1994. Functional commitment to helper T cell lineage precedes positive selection and is independent of T cell receptor MHC specificity. Immunity 1:269.[Medline]
  48. Osman, G. E., M. Toda, O. Kanagawa, L. E. Hood. 1993. Characterization of the T cell receptor repertoire causing collagen arthritis in mice. J. Exp. Med. 177:387.[Abstract/Free Full Text]
  49. Brodeur, P. H., R. Riblet. 1984. The immunoglobulin heavy chain variable region (Igh-V) locus in the mouse. I. One hundred Igh-V genes comprise seven families of homologous genes. Eur. J. Immunol. 14:922.[Medline]
  50. Becker, D. M., P. Patten, Y. Chien, T. Yokota, Z. Eshhar, M. Giedlin, N. R. J. Gascoigne, C. Goodnow, R. Wolf, K. Arai, M. M. Davis. 1985. Variability and repertoire size of T-cell receptor V{alpha} gene segments. Nature 317:430.[Medline]
  51. Singer, P. A., R. J. McEvilly, R. S. Balderas, F. J. Dixon, A. N. Theofilopoulos. 1988. T-cell receptor {alpha}-chain variable-region haplotypes of normal and autoimmune laboratory mouse strains. Proc. Natl. Acad. Sci. USA 85:7729.[Abstract/Free Full Text]
  52. Klotz, J. L., R. K. Barth, G. L. Kiser, L. E. Hood, M. Kronenberg. 1989. Restriction fragment length polymorphisms of the mouse T-cell receptor gene families. Immunogenetics 29:191.[Medline]
  53. Jouvin-Marche, E., M. Goncalves Morgado, N. Trede, P. N. Marche, D. Couez, I. Hue, C. Gris, M. Malissen, P.-A. Cazenave. 1989. Complexity, polymorphism, and recombination of mouse T-cell receptor {alpha} gene families. Immunogenetics 30:99.[Medline]
  54. Gascoigne, N. R. J.. 1995. Genomic organization of T cell receptor genes in the mouse. J. I. Bell, and M. J. Owen, and E. Simpson, eds. T Cell Receptors 288. Oxford University Press, Oxford, U.K.
  55. Seibel, J. L., N. Wilson, H. Kozono, P. Marrack, J. W. Kappler. 1997. Influence of the NH2-terminal amino acid of the T cell receptor {alpha} chain on major histocompatibility complex (MHC) class II plus peptide recognition. J. Exp. Med. 185:1919.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Proc. Natl. Acad. Sci. USAHome page
L. K. Ely, T. Beddoe, C. S. Clements, J. M. Matthews, A. W. Purcell, L. Kjer-Nielsen, J. McCluskey, and J. Rossjohn
Disparate thermodynamics governing T cell receptor-MHC-I interactions implicate extrinsic factors in guiding MHC restriction
PNAS, April 25, 2006; 103(17): 6641 - 6646.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
P. Marrack, J. Bender, M. Jordan, W. Rees, J. Robertson, B. C. Schaefer, and J. Kappler
Presidential Address to The American Association of Immunologists : Major Histocompatibility Complex Proteins and TCRs: Do They Really Go Together Like a Horse and Carriage?
J. Immunol., July 15, 2001; 167(2): 617 - 621.
[Full Text] [PDF]

Home page
 Int ImmunolHome page
J. Vollmer, H. U. Weltzien, K. Gamerdinger, S. Lang, Y. Choleva, and C. Moulon
Antigen contacts by Ni-reactive TCR: typical {alpha}{beta} chain cooperation versus {alpha} chain-dominated specificity
Int. Immunol., December 1, 2000; 12(12): 1723 - 1731.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Correia-Neves, C. Waltzinger, J.-M. Wurtz, C. Benoist, and D. Mathis
Amino Acids Specifying MHC Class Preference in TCR V{alpha}2 Regions
J. Immunol., November 15, 1999; 163(10): 5471 - 5477.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B.-C. Sim and N. R. J. Gascoigne
Reciprocal Expression in CD4 or CD8 Subsets of Different Members of the V{alpha}11 Gene Family Correlates with Sequence Polymorphism
J. Immunol., March 15, 1999; 162(6): 3153 - 3159.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
T. C. Manning, E. A. Parke, L. Teyton, and D. M. Kranz
Effects of Complementarity Determining Region Mutations on the Affinity of an {alpha}/{beta} T Cell Receptor: Measuring the Energy Associated with CD4/CD8 Repertoire Skewing
J. Exp. Med., February 1, 1999; 189(3): 461 - 470.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sim, B.-C.
Right arrow Articles by Gascoigne, N. R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sim, B.-C.
Right arrow Articles by Gascoigne, N. R. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS