|
|
||||||||
Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037
| Abstract |
|---|
|
|
|---|
and CDR2
are
important in determining MHC class specificity. We have now extended
these observations to survey the expressed repertoire of the AV3 family
in C57BL/6 mice. Three of the four expressed AV3 members are
preferentially selected into the CD4+ subset of T
cells. These share the same amino acid residue in both CDR1
and
CDR2
that differ from the only CD8-skewed member. Preferential
expression of an individual AV3 is not caused by other endogenous
-
or ß-chains, by any conserved CDR3 sequence, or by the usage of TCRAJ
regions. This study shows that residues in the CDR1 and CDR2 regions
are primary determinants for MHC class discrimination and suggests that
polymorphism found within a TCRAV family has an important effect on the
overall shaping of the T cell repertoire. | Introduction |
|---|
|
|
|---|
3.2,
V
8, and human V
12.1 are consistently found in a higher proportion
in the CD8+ cells (7, 8, 9); while V
3.1, V
2, and
V
11.1/11.2 are more predominant in the CD4+ population
of T cells (10, 11, 12, 13). Because this phenomenon is generally independent
of MHC haplotype, it has been strongly suggested that each of these
V
elements is positively selected by either MHC class I or MHC class
II molecules. This view is consistent with reports that the TCR has an
intrinsic ability to interact with MHC molecules (14, 15). In addition,
the crystal structure of TCR-MHC class I complexes show the
germline-encoded complementarity-determining regions
(CDR)3 CDR1
and CDR2
of
the TCR making significant contact with the MHC molecule (16, 17). In
one case, the CDR1
and CDR2
contact the class I molecule, but the
CDR1ß and CDR2ß have little or no interaction (17).
In C57BL/6 (B6) mice, the closely related V
3.1 (AV3S5) and V
3.2
(AV3S2) elements are reciprocally skewed into the CD4+ and
CD8+ T cell subsets, respectively (7, 13). Comparison of
the sequences of AV3S5 and AV3S2 shows that four amino acid residues
differ between them. These are at positions 27, 51, 85, and 92. It has
previously been shown that T cells expressing an AV3S5 transgene are
skewed preferentially into the CD4+ subset (13, 18). Using
a panel of mutant AV3S5 transgenes, we determined that residue 27 in
the CDR1
region and residue 51 in the CDR2
region are sufficient
for determining MHC specificity. When either of these residues in AV3S5
were mutated to the corresponding residue from AV3S2, the transgene
expression was skewed to the CD8 cells (18).
The mouse TCRAV locus contains many more V regions than the TCRBV
locus. Having undergone several rounds of gene duplication, most V
families have several family members (19). Analysis of published V
families shows that much of the within-family diversity is in the
CDR1
and CDR2
regions (11, 20, 21, 22, 23). With the presence of many
closely related V
genes with a high degree of polymorphism in
CDR1
and CDR2
, which we know can result in biased usage of the
various members of a V
family in class I- or class II-restricted T
cells, it is likely that the T cell repertoire will be affected. We
therefore analyzed the expressed closely related members of the AV3
family in B6 mice. Only one of the four AV3 members observed in B6 is
strongly over-represented in the CD8+ T cell subset, with
the other three family members being biased to the CD4+
population to varying degrees. The three CD4-skewed members share
similar amino acid residues in both the CDR1
and CDR2
and differ
from particular residues found in the single CD8-skewed member. There
appears to be no preference in TCRAJ usage in either T cell population.
Taking into account the lack of obvious influence by endogenous
-chains, ß-chains, and J regions, the unique residues present in
the CDR1
and CDR2
are probably crucial for controlling selection
into class I- or II-restricted T cells. Polymorphism within a TCRAV
family will have a strong impact on MHC class discrimination which
inevitably will contribute to the overall T cell repertoire.
| Materials and Methods |
|---|
|
|
|---|
The B6 mice were obtained from The Scripps Research Institute
vivarium. The TCRA knockout mice,
C57BL/6J-Tcratm1Mom (24)
(TCRA-/-) were a seventh generation backcross to B6 and
were purchased from The Jackson Laboratory (Bar Harbor, ME). The panel
of V
3 transgenic mice, namely V
3.1, V
3.1 m, CDR1 m, and CDR2
m, are described in detail elsewhere (18). Briefly, the
-chain from
the T cell clone Ar-5 (25), AV3S5J31, was used to generate the V
3.1
transgenic mice. Specific point mutations were made in the wild-type
AV3S5 gene to resemble the closely related AV3S2 element giving rise to
the three mutant transgenic lines. Therefore, the V
3.1 m transgenic
mice bear three mutations in the AV3S5 gene at position 27 from serine
(S27) to phenylalanine (F) (i.e., S27F), S51P, and S85W; the CDR1 m
transgenic mice carry the S27F single amino acid mutation in the
CDR1
region, while the CDR2 m mice have the S51P mutation in the
CDR2
.
FACS analysis and Abs
Erythrocyte-free PBL were subjected to three-color FACS
analysis. The wild-type V
3.1 and CDR2 m transgene-expressing cells
were detected with an antiserum raised against AV3S5 (13, 18), while
lymphocytes expressing the V
3.1 m and the CDR1 m transgene were
stained with the AV3S2-specific RR3-16 Ab. We previously showed that
the epitope for this Ab depends on phenylalanine 27, present in AV3S2
and these two mutants (18). Thy-1.2+ lymphocytes were
further divided into the CD4 and CD8 subsets. In the V
3Vß pairing
experiments described in Figure 3
, lymphocytes isolated from lymph
nodes were subjected to four-color FACS analysis. To enrich
transgene-expressing CD4+ cells and transgene-expressing
CD8+ cells, lymphocytes expressing the respective
transgenes were first sorted into the appropriate T cell populations
followed by staining with the panel of Vß Abs. Data acquired are
represented as a percentage of the respective V
3Vß pair in the
CD4+ and CD8+ subsets.
|
3.2 (RR3-16) and anti-CD8
(53-6.7)
were used as FITC-conjugated Abs; and anti-Vß3 (KJ-25),
anti-Vß6 (RR4-7), anti-Vß7 (TR310), and
anti-Vß8.1/8.2 (MR5-2) were conjugated with phycoerythrin. The
AV3S5 antiserum (13) was provided by Drs. L. Zerva and M. Greene
(University of Pennsylvania, Philadelphia, PA) with goat
anti-rabbit (heavy chain + light chain)-FITC as the
second-step reagent (Jackson ImmunoResearch Labs, Inc., West Grove,
PA). mAbs against TCRVß9 (MR10-2), Vß10 (B21.5), Vß11 (RR3-15),
Vß12 (MR11-1), Vß13 (MR12-3), were used in biotinylated form with
streptavidin-phycoerythrin as the second-step reagent. Anti-CD8
allophycocyanin, anti-CD8 RED613, and anti-CD4 RED613 (H129.19)
Abs were purchased from Life Technologies (Grand Island, NY). RT-PCR, spectratyping, and sequencing
Lymphocytes from spleens and lymph nodes were isolated from
(B6 x TCRA-/-)F1 mice,
double-stained with anti-CD4 RED613 and anti-CD8
-FITC, and
sorted into the respective CD4+ and CD8+ T cell
subsets. Total RNAs from the sorted CD4+ and
CD8+ population of T cells were extracted following
standard procedures (26). First strand cDNA was reverse transcribed
using a cDNA kit (Life Technologies, Grand Island, NY) and subjected to
two rounds of PCR with nested AV3 primers. In the first round of PCR,
the 5' primer used was specific for the AV3 leader sequence (5'
TTCCGAGCTCATGCTCCTGGCA CTCCTCCCA 3'), and the 3' primer was specific
for the 3' end of the
-chain constant region (5'
TGTGATGCCACGTTGACCGAGAAAAGCTTT 3'). The second round of PCR used a
primer specific for the 5' end of the variable region (5'
GATGCCCAAGCTCAGTCAGTG 3') with the 3' primer complementary to the 5'
end of the constant region (5' CCCAGAACCTGCTGTGTACTCTAGACGG 3').
Both 5' end primers will hybridize equally well to AV3S1, -S2, -S3,
-S5, and -S6 (no 5' leader sequence is available for AV3S7). They will,
however, not anneal to AV3S4 or AV3S8, which are very divergent members
of the AV3 family, having
75% identitiy at the amino acid level. It
has previously been reported that AV3S4 was not identified by
cross-hybridization with an AV3S5 probe in BALB/c (23). The product of
the second round PCR reaction was isolated and cloned into either of
two vectors: pCRII in conjunction with Taq polymerase
(Invitrogen, San Diego, CA) in experiment 1; or pCR-script AmpSK(+)
with Vent polymerase (Stratagene, San Diego, CA) in experiment 2.
Randomly picked clones from each T cell subset were sequenced
bidirectionally using the T7 primer and M13 reverse primer. DNA
sequencing was performed by the Protein and Nucleic Acids Core facility
of The Scripps Research Institute, using the FS dye terminator cycle
sequencing method and the Applied Biosystems/Perkin-Elmer models 373x1
and 377 DNA sequencers. Sequences obtained were aligned to published
AV3 sequences (23, 25, 27). Nomenclature used for the AV3 and TCRAJ
regions are in accordance with References 27 and 28, respectively.
Spectratyping to determine the length of CDR3
in the AV3 populations
was performed using the same PCR primers as above, with
32P-labeled 3' primer for the second-step PCR, as described
(29). PCR was performed with Taq polymerase. The PCR
product was run on a 6% DNA sequencing gel and analyzed using a
PhosphorImager and ImageQuaNT software (Molecular Dynamics,
Sunnyvale, CA).
Genomic Southern blot analysis
Genomic DNA from the liver of B6 mice was isolated, subjected to
complete restriction endonuclease digestion, separated on an 0.8%
agarose gel, and blotted onto zeta-probe GT membrane (Bio-Rad,
Richmond, CA) according to standard procedures (30). Hybridization was
conducted at 68°C with a 220-bp AV3-specific probe, isolated from a
genomic subclone of AV3S5J31 (25). This probe spans part of the intron
following the leader sequence and
one-half of the variable region.
The filter was washed in 3x SSC/0.1% SDS at 65°C with a final wash
in 0.3x SSC/0.1% SDS. Under these fairly stringent conditions, no
cross-hybridization to other V
families is observed.
Statistics
Students t test, ANOVA, and Mann-Whitney tests were performed using the program InStat v2.01 (Graphpad Software).
| Results |
|---|
|
|
|---|
The frequency of expression of AV3 family members in the
CD4+ and CD8+ peripheral T cell subsets in
B6 mice was determined by FACS analysis. The AV3S2 TCR was
differentiated from the other AV3 family members by the
V
3.2-specific mAb, RR3-16, and is observed to be expressed
predominantly in the CD8 population (Fig. 1
). This Ab distinguishes between the AV3
family members on the basis of the phenylalanine residue at amino acid
27, present only in AV3S2 (18). The rest of the AV3 members were
detected by an antiserum raised against AV3S5 and were collectively
found in a higher frequency in the CD4 subset of T cells (Fig. 1
). This
antiserum probably does not distinguish between the family members. It
is remarkable that closely related members of the same family are
reciprocally skewed into the CD4 and CD8 subset of T cells.
|
-chains do not influence preferential AV3 transgene
skewing
In all previous studies, the preferential skewing of V
has been
observed in the presence of other endogenous V
elements. It has been
suggested that during thymic development and in mature T cells,
functional allelic exclusion is maintained by competition between two
-chains for a single ß-chain (31, 32). It is therefore possible
that in transgenic studies, endogenous V
elements may influence an
individual V
to be over-represented in the CD4 or CD8 subset. To
address this question, we bred our panel of AV3 transgenic mice to the
TCRA-/- strain so as to limit the choice of
-chain to that of the transgene (Materials and
Methods) (18). Second- and third-generation
backcross offspring typed as V
3
transgene+/TCRA-/- were analyzed for
expression of the transgene in the CD4 and CD8 population. When present
as the sole expressed
-chain, the V
3.1 (AV3S5J31) transgene
consistently showed an over-representation of the transgene in the
CD4+ subset compared with the CD8+ population
(Fig. 2
). The ratio of the transgene
expressed in the CD4+ to that in the CD8+
population (CD4-CD8 ratio ± SD) is 2.24 ± 0.39. In
contrast, the three transgenic lines carrying various mutant forms of
the AV3 chains showed a relatively higher proportion of
CD8+ cells expressing the transgene (Fig. 2
). The
AV3S2-like V
3.1 m+/TCRA-/- mice had the
highest frequency of the mutant V
3.1 transgene expressed in the
CD8+ population with a CD4-CD8 ratio of 0.73 ± 0.36.
The two transgenes that each had a single residue from the AV3S2
sequence had a higher CD4-CD8 ratio. The CDR1
m+/TCRA-/- mice had a CD4-CD8 ratio of
1.06 ± 0.20 while that of the CDR2
m+/TCRA-/- was 1.41 ± 0.30. Although
the effect of skewing was less prominent on the TCRA-/-
than on the wild-type B6 background, these data clearly show that
endogenous
-chains did not affect the preferential skewing of the
individual transgenic
-chains. The strength of selection for class I
restriction by the AV3S2 residue appears to be marginally stronger for
the CDR1 than for the CDR2 region, with an additive effect as reflected
in the V
3.1 m transgenic line. This is consistent with the notion of
preferential interaction with MHC class I or class II transgenic
-chain.
|
skewing
Because TCR functions as an
ß heterodimer and the fact that
certain Vß-elements have been reported to show skewed expression
themselves (33, 34, 35, 36, 37, 38), the effect of the ß-chain on the preferential
V
selection was investigated. Lymph node T cells from the panel of
AV3 transgenic mice were sorted into transgene-expressing
CD4+ and transgene-expressing CD8+ T cell
populations and stained for various ß-chains. With all nine
anti-Vß Abs tested (Vß3, -6, -7, -8, -9, -10, -11, -12, and
-13), T cells expressing the V
3.1, V
3.1 m, CDR1 m, and CDR2 m
transgenes paired with approximately equal frequency with any
particular Vß element (Fig. 3
). An
ANOVA test showed no significant differences in these groups, with the
possible exception of CD4+ Vß12+ cells, where
there was a weakly significant difference (p =
0.05). Students t tests between each of the groups showed
that there were significant diffferences between CDR2 m and both
V
3.1 m and CDR1 m (p = 0.0105 and 0.0113,
respectively). It is unclear whether this is a real difference. If so,
we would also have expected a difference between wild-type V
3.1
transgenic and these transgenics.
The similar pairing of the V
3 transgenes with different Vßs is
observed in both the CD4+ and CD8+ subsets. For
example, lymphocytes bearing the V
3.1 transgene plus Vß3
constitute
1.70 ± 0.01% (± SD) in the CD8 population;
V
3.1 m/Vß3, 2.67 ± 0.49%; CDR1 m/Vß3, 2.13 ± 0.35;
and CDR2 m/Vß3, 2.67 ± 0.60 (Fig. 3
A). In the
CD4 subset, V
3.1 transgene plus Vß3 is 2.65 ± 0.21%;
V
3.1 m/Vß3, 3.17 ± 0.64%; CDR1 m/Vß3, 2.83 ±
0.47%; and CDR2 m/Vß3, 3.45 ± 0.35% (Fig. 3
B). Hence, skewing of an individual
-chain is not
influenced by endogenous ß-chains within the T cell subsets. The
pairing frequency of the panel of transgenic V
3 chains for different
Vßs is largely a reflection of the frequency of the Vßs expressed
in B6 mice (33, 35, 38, 39). For example, all four transgenic V
3
chains pair most frequently with Vß8, the most common Vß in B6
mice, accounting for an average of
14% in both T cell populations.
Some of the Vß usages vary between CD4 and CD8 subsets. This
difference is significant by t test for Vß7
(p = 0.0001), Vß9 (p
= 0.0016), Vß11 (p = 0.0014), and Vß13
(p < 0.0001) skewing to CD8 cells and for
Vß6 (p = 0.0017) and Vß3
(p = 0.0475) skewing to CD4 cells. The skewing
of Vß usage in pairing with the transgenic
-chains was similar to
expression in the whole population (Refs. 35 and 39 and data not
shown). The exception to this is with Vß6, where the expression in
CD4+ cells is increased in the V
3+
population (8.5 ± 0.52%) compared with the level in the
CD4+ population at large (4.6 ± 0.8%,
p = 0.0016) (33, 39). Thus, this Vß element may more
frequently pair with the V
transgenes to make a class II-restricted
heterodimer than some other Vßs. Vß6 has been noted as being
positively selected on the class II molecule I-E (33, 34).
Amino acid sequences in the CDR1
and CDR2
regions of the TCR
influence MHC class discrimination
Southern blot analysis of genomic liver DNA from a wild-type B6
mouse digested with EcoRI, BamHI, and
HindIII was probed with an AV3-specific probe derived from
AV3S5 (Materials and Methods). This Southern
analysis yielded four distinct AV3-hybridizing DNA bands for each
endonuclease digestion and thus suggests that four genes exist for the
AV3 family in this strain (Fig. 4
). In
BALB/c mice, four AV3 family members have been identified
(23).
|
Abs that can differentiate between members of the
same family, we have extended our analysis of the expressed repertoire
of the AV3 family in B6 mice using DNA sequencing. mRNA from sorted
CD4+ and CD8+ T cell subsets was extracted from
B6 TCRA hemizygous mice (i.e., F1 mice derived from a cross
between a B6 and a TCRA-/-) to avoid the problem of
expression of two
-chain mRNAs (31, 32). By means of reverse
transcription followed by two rounds of PCR, the variable regions of
the expressed members of the AV3 family were cloned, sequenced, and
compared with published data (23, 27, 40). Consistent with the Southern
analysis, only four members of the AV3 family were detected by this
strategy (Fig. 5
3.2); AV3S3 (V
3.3); AV3S5 (V
3.1); and AV3S9.
Identical in amino acid sequences except at position 67, AV3S5 and
AV3S9 are two independent genes in B6 with other silent mutations
throughout the nucleotide sequences. Both AV3S2 and AV3S9 have been
reported elsewhere and have been established as B6 and bm12 TCRAV3
family members, respectively (23, 41, 42). AV3S3 was originally
sequenced from the closely related strain, C57BL/10 (23, 41). AV3S5,
previously reported from (BALB/c x A/J) TCRAa mice
(25), was also expressed frequently in B6 mice. On the other hand,
AV3S4 (40), originally derived from B6 and virtually identical with
AV3S8 (derived from C.B20; a BALB/c-derived TCRAa strain
congenic for the IgH locus) (27), was not detected in our study. This
is likely due to the relatively low homology in nucleotide and amino
acid sequences of this member to the others in the AV3 family. AV3S4
and AV3S8 are as divergent from the rest of the AV3 family as AV3 is
from the AV9 family (27). As shown in the sequence alignments, the B6
TCRAV3 family members displayed very limited sequence diversity at the
nucleotide and amino acid levels, sharing >95% sequence homology
(Fig. 5
|
-chain cDNAs from the CD4+ and
CD8+ populations that were randomly picked and sequenced in
two independent experiments, a trend in the AV3 family members
distribution into the CD4 and CD8 T cell subsets was apparent (Table I
|
and CDR2
regions,
respectively (see Fig. 7
regions (Table I
segment, AV3S9 and AV3S5 are similar to each other
while AV3S3 bears an alanine residue in position 28 that differs from
the glycine residue found in AV3S9 and AV3S5. In spite of this, all
three CD4-biased members share the same amino acid residue in both
CDR1
and CDR2
that differs in the single CD8-skewed member. In
AV3S2, a phenylalanine residue in position 27 and a proline in position
51 replace the serine residue in both positions in the CD4-skewed
members. It is therefore likely that the CDR1
and CDR2
residues
that are unique to AV3S2 are responsible for its strong selection into
the class I-restricted population. In contrast, the alanine in position
28, carried by the CD4-skewed AV3S3, is not sufficient or necessary to
alter the selection of this V
3 protein from a class II-preferred to
a class I-restricted phenotype. However, the conservative nature of the
glycine/alanine change may mask an important role for residue 28 in the
MHC interaction.
|

The TCR
-chain is generated by rearrangement of V and J gene
segments, thereby making the
-chain J usage an additional factor
that can affect the T cell repertoire. As shown in Table II
, TCRAJ usage by the numerous
-chain
cDNA clones in the CD4 and CD8 populations shows no clear pattern. Of
the 21 TCRAJ segments used in 18 CD8-derived sequences and 22
CD4-derived sequences, only 4 were used in both groups. These are J7,
J27, J37, and J39. Of the five most frequently used J regions (J27 was
used five times, J21 and J37 were used four times, J34 and J22 were
used three times), two were found only in CD8s (J21 and J22), one was
seen only in CD4s (J34), and two were shared (J27 and J37). Thus, the
overselection of the respective AV3 into the CD4+ or
CD8+ peripheral T cell population is independent of a
restricted set of J
segments. The CDR3
results from VJ
joining and N-region nucleotide addition during rearrangement of the
TCR. The length of the CDR3 can be used as a measure of diversity.
Minute changes in one amino acid in the CDR3 region can produce
significant changes in overall TCR structure and alter recognition
properties (43). In this study, the actual boundaries of the CDR3
have been determined from the mouse 2C TCR crystal structure (16).
CDR3
starts at residue 93 and continues to two residues before the
phenylalanine in the FGXG J-region motif (or before the
leucine residue in the LGXG motif in the case of J7) (16).
Although the AV3 clones found in the CD8 subset generally had slightly
longer CDR3s than those present in the CD4s (medians of 9 and 10 amino
acids, respectively) (Table II
), the difference was not statistically
significant. Spectratype analysis of CDR3 length showed no significant
difference in length between AV3 family members expressed in the CD4 or
CD8 subset (Fig. 6
).
|
|
| Discussion |
|---|
|
|
|---|
Abs (one of which is
an antiserum) available in the mouse system show that each V
segment
is preferentially selected into either the CD4 or CD8 subset of
peripheral T cells. This phenomenon is not only evident in mouse
strains but is also observed in rats and humans (9, 44, 45). Such
prevalent skewing that is minimally affected by H-2 alleles is
suggestive of positive selection by either MHC class I or II molecules.
In the present study, we have provided further evidence for the role of
TCR V
segments in TCR-MHC interactions in repertoire selection.
Closely related members of the AV3 family were found to be reciprocally
skewed into the CD4 or CD8 subset. The effect of the skewing was,
however, moderated when the panel of AV3 chain transgenic mice were
bred onto an TCRA-/- background. Although the data
clearly indicate a lack of endogenous
-chain contribution to the
preferential skewing of the individual transgenic
-chains, some
other mechanism reduces the extent of skewing to that of the observed
additive effect. This could be because homeostatic mechanisms are
governing the production of larger numbers of CD4 cells than CD8 cells,
since there is evidence for some precommitment of CD4 or CD8 precursors
distinct from the specificity of their TCR (46, 47) (reviewed in Refs.
1 and 2). Thus, there is a larger pool of thymocytes with the potential
to be CD4 cells than there are with the potential to become CD8 cells.
The panel of Vß specific mAbs used covers
45 to 55% of the TCRBV
repertoire, and yet no major differences in Vß usage were observed
between these AV3 family members. The lack of selective Vß pairing,
together with no apparent contributions from endogenous V
elements,
indicates that the
-chain of the TCR-
ß heterodimer is primarily
responsible for T cell repertoire selection. This does not rule out the
possibility of a contribution from the ß-chain coming from the CDR3.
For example, in CD4 cells with the "CD8-skewed"
-chain, it is
likely that the cells use a repertoire of ß-chains, enabling them to
be class II restricted.
To date, 61 mouse TCRAJ elements have been identified (28). Of these,
21 different TCRAJs were used in the 41 AV3 clones in experiment 2.
Although some TCRAJ segments are used slightly more frequently than
others either in one particular T cell subset or in both, the broad and
random TCRAJ usage suggests that overselection does not depend on a
restricted set of J
elements. It has recently been shown that
positive repertoire selection and alloreactivity specific for a rat
class I molecule, that preferentially affect one V
element, differ
mainly by differential TCRAJ usage and CDR3
composition. Positive
repertoire selection is believed to be independent of any specific
CDR3/J
requirements, while alloreactive responses require a more
stringent CDR3/J
composition to ensure a stronger MHC interaction
(44, 45). The length distribution of a given CDR3 region has been used
to predict recognition properties of TCR-
, TCR-
ß, and Igs
and as a measure for diversity (29, 43). We did not find a significant
difference in CDR3
length between the CD4 and CD8 populations
expressing AV3. Overall, the TCR V
skewing into the CD4 or CD8
subset is due mainly to the V
segment and is not achieved by
differential TCRAJ element usage or contributed by a restricted CDR3
sequence.
From analysis of published V
sequences, it is difficult to assign
sequence polymorphisms observed as allelic differences or differences
between family members (11, 27, 48). AV3S4, previously isolated from B6
and designated as an AV3 member based on amino acid and nucleotide
sequence homology to the family, was not detected in the present study.
AV3S4 is most homologous to AV3S8 (98.6%). At the amino acid level,
AV3S4 is as similar to AV3S1 and AV3S5 as AV3S5 is to AV9S1 and AV9S2
(7580%). It is as similar to AV3S2, AV3S3, AV3S6, and AV3S7 as AV3S6
and AV3S7 are to AV9S1 and AV9S2 (7075%). At the amino acid level,
AV3S3 is more similar to AV9S1 and AV9S2 (7580%) than it is to AV3S4
(7075%). At the nucleotide level, AV3S3 is 75 to 80% identical with
AV9S1 and AV9S2, but is 8090% identical with V3S4. Based on the
criteria that V gene segments that show >75% similarity at the
nucleotide level are considered members of the same family (49), AV3S4
has been classified as a member of the AV3 family. However, in our
Southern blot analysis, only four V
3-hybridizing bands were
detected, which suggests the existence of four AV3 family members. The
four different classes of nucleotide sequences obtained from our
"library" of AV3 clones did not include sequences resembling AV3S4.
With a >75% sequence similarity, AV3S4 should have generated an
intense hybridization signal in our Southern analysis. Using a similar
AV3 probe isolated from the Ar-5 T cell clone, Tan et al. (23) had also
failed to isolate an "allelic form" of AV3S4 from BALB/c, leading
them to exclude AV3S4 as a AV3 family member.
Due to the lack of availability of anti-V
Abs that can
differentiate between all members of the same AV family, the present
strategy of nucleotide sequencing of expressed V regions from TCRA
hemizygous mice was used for the AV3 family. This study provides strong
evidence that the composition of the TCR CDR1
and CDR2
regions
have a major role in selection on MHC class I and II. Single residues
can markedly affect selection. Parallel observations are drawn for the
TCRAV11 family (manuscript in preparation). The TCR has evolved toward
having a strong intrinsic ability for binding to MHC molecules (14, 15). The mouse TCRAV locus is large, and most V
families have
several family members (19, 50, 51, 52, 53, 54). Analysis of published V
families show that family members tend to have significant variation in
their CDR1
and CDR2
regions (11, 20, 21, 22, 23, 27). Crystal structures
of TCR in complex with their MHC/peptide ligands in both mouse and
human models have also revealed significant contact points between the
CDR1
and CDR2
with the MHC molecules (16, 17). In one of these
cases, MHC interactions are provided by both CDR3
and ß loops and
by CDR1 and CDR2 of V
but not by Vß (17). It is possible that a
V
element can interact better with most alleles of either MHC class
I or II because potential TCR contact sites along the
-helices are
remarkably conserved within the MHC class. In the structure of Garboczi
et al. (17), CDR1
contacts six class I residues of which four are
conserved. The CDR2
makes contact with three class I residues, all
of which are conserved in different haplotypes. The class II residues
in the positions analogous to these TCR contact residues are also
conserved within class II alleles, but the residues are different
amino acids from those in class I. Therefore, significant
structural differences exist between class I and II MHC proteins that
can result in class distinction. If each member is biased to recognize
either class I or II protein as governed by their CDR1
and CDR2
sequences, the relative size and composition of the CD4 and CD8 T cell
repertoires will be affected. These data and the conservation of skewed
selection across different MHC haplotypes could well explain the
maintenance of large families of closely related V
genes and the
concentration of within-family diversity in the CDRs.
Figure 7
shows the respective positions
of the amino acid residues that differ between the AV3 family members
with respect to AV3S5. As shown in Figure 7
A, CDR1
residue 27 and CDR2
residue 51, but not residue 85 in AV3S2 that
differ from the CD4-skewed AV3 members, are poised for interaction with
the MHC molecules. It is therefore not surprising that these residues
are critically involved in MHC class selection. Residue 85 lies at the
base of ß strand F and is not necessary for MHC class specificity
(18). In AV3S3, CDR1
residue 28, although well positioned for MHC
interaction (Fig. 7
B), was not sufficient or crucial
in altering MHC restriction. This could still be an important residue
for MHC contact, but with the glycine to alanine change not making a
significant difference. The glycine to serine change at residue 61 and
the arginine to glutamine change at residue 76 are fairly conservative
and do not change the selection. While CDR1
and CDR2
undoubtedly
play a major role in MHC class specificity, residues located outside
these regions may have an effect on the degree of skewing. AV3S5 is
less skewed into the CD4 population than AV3S9. Positioned on the
fourth variable loop (CDR4) (16), serine 67 in AV3S5 may be less
interactive than the bulky isoleucine carried by AV3S9 (Fig. 7
C). Residues from the CDR4 lie over the MHC-peptide
complex (17). A recent study has revealed that N-terminal residues,
i.e., not only the canonical TCR CDR regions, can affect TCR engagement
with MHC-peptide complex (55). We are currently addressing this
question with transgenic mouse studies.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. N..R..J. Gascoigne, Department of Immunology, IMM1, The Scripps Research Institute, 10550 N. Torrey Pines Road, La Jolla, CA 92037. E-mail address: ![]()
3 Abbreviation used in this paper: CDR, complementarity-determining region. ![]()
Received for publication July 30, 1997. Accepted for publication October 22, 1997.
| References |
|---|
|
|
|---|
ß T-cell receptor determine the CD4/CD8 phenotype of T cells. Nature 335:229.[Medline]
-chain variable region (V
3) of the mouse T cell antigen receptor. J. Immunol. 143:2602.[Abstract]
12.1 expression on CD8+ T cells: evidence that V
participates in shaping the peripheral T cell repertoire. J. Exp. Med. 174:639.
region selectively expressed in CD4+ cells. J. Immunol. 145:1324.[Abstract]
11 gene family: analysis of allelic sequence polymorphism and demonstration of J
-region dependent recognition by allele-specific antibodies. J. Immunol. 147:3185.[Abstract]
2+CD8+ T cells in mouse strains expressing both H-2k and T cell receptor V
a haplotypes: determination with a V
2-specific monoclonal antibody. Eur. J. Immunol. 22:399.[Medline]
ß T cell receptor structure at 2.5Å and its orientation in the TCR-MHC complex. Science 274:209.
CDR1 and CDR2. Science 273:963.[Abstract]
family. EMBO J. 9:2141.[Medline]
and ß block thymocyte development at different stages. Nature 360:225.[Medline]
3 gene segment is associated with reactivity to p-azobenzenearsonate. Cell 54:247.[Medline]
/C
) region: organization, sequence, and evolution of 97.6 kb of DNA. Genomics 19:478.[Medline]
and ß gene allelic exclusion during T-cell development. Immunol. Today 13:315.[Medline]
chains occurs at the time of thymocyte TCR up-regulation. Immunity 3:449.[Medline]
3.2 selection in MHC class I mutant mice: evidence for an alternate orientation of TCR-MHC class I interaction. J. Immunol. 159:3322.[Abstract]
-mediated positive repertoire selection and alloreactivity by differential J
usage and CDR3
composition. Int. Immunol. 9:1441.
gene segments. Nature 317:430.[Medline]
-chain variable-region haplotypes of normal and autoimmune laboratory mouse strains. Proc. Natl. Acad. Sci. USA 85:7729.
gene families. Immunogenetics 30:99.[Medline]
chain on major histocompatibility complex (MHC) class II plus peptide recognition. J. Exp. Med. 185:1919.This article has been cited by other articles:
![]() |
L. K. Ely, T. Beddoe, C. S. Clements, J. M. Matthews, A. W. Purcell, L. Kjer-Nielsen, J. McCluskey, and J. Rossjohn Disparate thermodynamics governing T cell receptor-MHC-I interactions implicate extrinsic factors in guiding MHC restriction PNAS, April 25, 2006; 103(17): 6641 - 6646. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Marrack, J. Bender, M. Jordan, W. Rees, J. Robertson, B. C. Schaefer, and J. Kappler Presidential Address to The American Association of Immunologists : Major Histocompatibility Complex Proteins and TCRs: Do They Really Go Together Like a Horse and Carriage? J. Immunol., July 15, 2001; 167(2): 617 - 621. [Full Text] [PDF] |
||||
![]() |
J. Vollmer, H. U. Weltzien, K. Gamerdinger, S. Lang, Y. Choleva, and C. Moulon Antigen contacts by Ni-reactive TCR: typical {alpha}{beta} chain cooperation versus {alpha} chain-dominated specificity Int. Immunol., December 1, 2000; 12(12): 1723 - 1731. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Correia-Neves, C. Waltzinger, J.-M. Wurtz, C. Benoist, and D. Mathis Amino Acids Specifying MHC Class Preference in TCR V{alpha}2 Regions J. Immunol., November 15, 1999; 163(10): 5471 - 5477. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-C. Sim and N. R. J. Gascoigne Reciprocal Expression in CD4 or CD8 Subsets of Different Members of the V{alpha}11 Gene Family Correlates with Sequence Polymorphism J. Immunol., March 15, 1999; 162(6): 3153 - 3159. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. C. Manning, E. A. Parke, L. Teyton, and D. M. Kranz Effects of Complementarity Determining Region Mutations on the Affinity of an alpha /beta T Cell Receptor: Measuring the Energy Associated with CD4/CD8 Repertoire Skewing J. Exp. Med., February 1, 1999; 189(3): 461 - 470. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |