| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Laboratory of Host Defense and Germfree Life, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine, Nagoya, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and LPS, which expressed an abundant level of alternative exon
5. These results suggest that normal IL-15 production in stimulated
macrophages is regulated by splicing of alternative exon
5. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ß T, 
T, B, and NK cells that use ß-
and -chains of IL-2R for signal transduction and shares many
properties with IL-2 (1, 2, 3, 4, 5, 6). Although IL-15 belongs to the four-helix
bundle cytokine family, the primary structure of IL-15 has no
significant homology with IL-2 (1, 7). Analysis of the genomic
structure of IL-15 revealed that the IL-15 locus contains eight exons
and seven introns, which differs from the four exon/three intron
structure of several cytokine genes including that of IL-2 (1, 7). The
putative amino acid sequences from full length IL-15 cDNA revealed that
it encodes a 162-amino acid precursor peptide with an extremely long
48-amino acid leader peptide in both humans and mice (1, 7). IL-2 is
produced mainly by T cells, while IL-15 mRNA is expressed most
abundantly in placenta, skeletal muscle, kidney, and LPS-stimulated
monocytes/macrophages (1). We and others showed that the expression
levels of IL-15 mRNA are increased in macrophage/monocytes by
stimulation with IFN- and LPS, infection of Salmonella
choleraesuis, Mycobacteria tuberculosis,
Toxoplasma gondii, or Herpes virus-6 (4, 5, 8, 9). It thus
appears that IL-15 has some functions other than those shared with
IL-2, such as a role in the cellular response of defense against
invading pathogens. However, it has been difficult to demonstrate IL-15
in the supernatants of various cells/tissues that express message for
this cytokine. Secretion of biologically active IL-15 has been detected
in a few cell lines such as CV-1-EBNA, from which the simian IL-15 gene
was originally cloned, and
HTLV-I3-infected cell line HuT-102 (1, 2).
IL-15 synthesis by HuT-102 involves a marked increase in IL-15 mRNA
translation, secondary to the putative proximal integration of the
HTLV-I provirus with the proviral fragment and the consequent
production of a fusion HTLV-IR/IL-15 mRNA that lacks many upstream AUGs
(10). This suggests that normal IL-15 production is regulated at the
protein level by post-transcriptional control in addition to the
controls of transcription and message stabilization.
In this study, to understand the regulatory mechanism of IL-15
production, we cloned three types of murine IL-15 cDNA generated by
alternative splicing and compared the efficiency of translation among
these mRNA. Sequence analysis of the cloned cDNA revealed mRNA
containing all exons, exon 2-deleted isoform, or exon 2-deleted isoform
containing an additional sequence, which we termed 
, between exons 4
and 5. The genomic sequence between exons 4 and 5 revealed that the new
sequence matched exactly the sequence located just upstream originally
defined exon 5. This suggests that the IL-15 mRNA isoform with
alternative exon 5 is generated by alternative splicing at a different
splice site upstream of exon 5. Although there was no difference in the
level of transcription among the three splicing products as assessed by
Northern hybridization, the translation efficiency of isoform
containing alternative exon 5 with the novel sequence was significantly
higher than those of the IL-15 cDNA with exon 5. The translation
product of the isoform containing an alternative exon 5 has a shorter
open reading frame (ORF) due to stop codons in the novel sequence,
followed by a new AUG codon, and displays a shorter leader sequence but
shares the same amino acid composition as mature IL-15 protein. The
shorter isoform of IL-15 precursor was detected in peritoneal
macrophages stimulated with IFN-/LPS, which expressed an abundant
level of an alternative exon 5. The implications of these findings
concerning post-transcriptional control of IL-15 production are
discussed.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The monocyte/macrophage cell lines J774A.1 derived from BALB/c
mice, provided by the American Type Culture Collection (Bethesda, MD),
were cultured in RPMI 1640 medium, supplemented with
L-glutamine (4 mM) and 10% heat-inactivated FCS. The cells
were subcultured twice weekly. Peritoneal macrophages were prepared as
described (11). Briefly, peritoneal exuded cells were plated and
allowed to adhere for 2 h at 37°C. More than 95% of adherent
cells were macrophages as assessed by morphologic characteristics,
esterase staining using -naphtylacetate (Sigma, St. Louis, MO), and
latex ingestion (1.1 µm diameter) (Dow Chemical, Indianapolis,
IN).
Antibodies
Neutralizing mAb (rat IgG1, G277-3588) to the murine IL-15 was purchased from PharMingen (San Diego, CA). Neutralizing anti-IL-2 mAb (rat IgG2ak, (No. 40014) and anti-IL-4 mAb (rat IgG1k, No. 40034) were purchased from Becton Dickinson (Bedford, MA). Isotype control Abs (rat IgG) were purchased from Inter-Cell Technologies (Hopewell, NJ).
RT-PCR
mRNA was extracted from the stimulated-macrophages using a
QuickPrep Micro mRNA Purification Kit (Pharmacia Biotech, Uppsala,
Sweden). First-strand cDNA synthesis and RT-PCR proceeded as described
by Saiki et al. (12). First-strand cDNA was synthesized from 2 µg of
mRNA using reverse transcriptase SuperScriptTM II RT (Life
Technologies, Gaithersburg, MD) and 20 pmol of random primer (Life
Technologies) in 20 µl of reaction mixture, according to the
manufacturer’s instructions. The synthesized first strand of cDNA (2
µl) was amplified by means of the PCR using 40 pmol of each primer
with 2.5 U of recombinant Taq (Takara Shuzou, Osaka, Japan) in a total
volume of 100 µl of reaction buffer consisting of 10 mM Tris-HCl (pH
8.3), 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin, and 0.2 µM
dNTP, as well as 20 pmol of specific primers for IL-15 exons (7) and
ß-actin as follows: exon 1 sense, GCTGTGTTTGGAAGGCTGAGTT
(position 203–224 in murine IL-15 cDNA sequence); exon 3 sense,
AGCTCTTACCTGGGCATTAA (position 443–462); exon 4 sense,
TCCATCTCGTGCTACTTGTGTTTCC (position 499–523); antisense,
AACACAAGTAGCACGAGATGGA (position 499–520); exon 6 and 7 sense,
GTGACTTTCATCCCAGTTGC (position 695–714); exon 8 sense,
CGTGCTCATGGCTGGTGCAAAG (position 856–875); antisense,
ATGGAGCTGTGCTGCCTCT (position 1010–1028); additional sequence
antisense, AAGCAACGGAACAATCAAGA (position 56–75 in additional sequence
); ß-actin sense, TGGAATCCTGTGGCATCCATGAAAC; antisense,
TAAAACGCAGCTCAGTAACAGTCCG.
PCR thermocycles consisted of 1 min at 94°C, followed by 1 min at 54°C, and 30 s at 72°C. Before the first cycle, a denaturation step for 7 min at 94°C was included, and after 28 cycles the extension was prolonged for 4 min at 72°C. The PCR product was resolved by electrophoresis on a 1.8% agarose gel (Nakalai Tesque, Kyoto, Japan) and transferred to a GeneScreen plus filter (NEN Research Products, Boston, MA), then hybridized with a 32P-labeled oligo probe as follows: IL-15 exon 7 (5'-GCAATGAACTGCTTTCTCCTG-3', position 724–744 in murine cDNA sequence) (7). After the membranes were incubated for 16 h at 60°C in 1 M NaCl, 10% dextran sulfate, and 100 µg/ml heat-denatured salmon sperm DNA, they were washed for 30 min in 2x SSC and 1% SDS at 60°C and exposed to a phosphor imaging plate for visualization on a Fuji BAS-2000 phosphor imaging system (Fuji Photo Film Co., Tokyo, Japan). Raw data of radioactivity are presented as photo-stimulated luminescence value (PSL)/area (mm2) according to manufacturer’s instruction.
Cloning of IL-15 cDNA and nucleotide sequencing
RT-PCR products were resolved in low-melting agarose gels, isolated, and cloned into TA vector PCR II (Invitrogen, San Diego, CA). Purified dsDNAs were sequenced using the Taq Dye Primer Cycle Sequencing Kit and an ABI 373A DNA sequencer (Applied Biosystems, Foster City, CA).
Cloning of intron between exons 4 and 5 of murine IL-15 gene
Introns between exons 4 and 5 of murine IL-15 gene were cloned by PCR of genomic DNA using specific primer for exon 5 and Promoter Finder DNA Walking Kits (Clontech Laboratories, Palo Alto, CA). Genomic DNA from DraI library in the kit was amplified by two rounds of PCR. The sense primers provided in the kit were used. The antisense primer for first-round PCR was exon 5-1 (5'-TAAGGCTTTCAATTTTCTCCAGGTC-3', position 631–655 in murine IL-15 cDNA sequence), and the antisense primer for second-round PCR was exon 5-2 (5'-TCTTACATCTATCCAGTTGGCCTCT-3', position 603–627) (7). The PCR products approximately 2 kbp were subcloned into TA vector PCR II (Invitrogen) and subjected to sequence analysis.
In vitro transcription/translation assay
IL-15 cDNA was cloned into PCR III vectors (Invitrogen) containing a T7 promoter site and a bovine growth hormone polyadenylation signal. We used the TNT T7 (transcription and translation)-coupled reticulocyte lysate system (Promega, Madison, WI) and a cloned IL-15 PCR III vector (1 µg). We followed recommendations of Promega for [35S]methionine labeling. We examined the transcriptional level in the reticulocyte lysate by Northern hybridization using an IL-15 cDNA probe. Briefly, total RNA was extracted from the programmed lysates with acid guanidinium thiocyanate-phenol-chloroform (13). RNA was fractionated on a 1.0% agarose-formaldehyde gel, transferred to a GeneScreen plus membrane (NEN), then hybridized with 32P-labeled murine IL-15 cDNA. The translational product in the reticulocyte lysates was boiled in Laemmli buffer (14) and separated on an SDS-15% polyacrylamide gel.
Quantitation of IL-15 protein synthesis
To quantitate T cell stimulatory activity by the CTLL-2 bioassay, serial dilutions of translational products programmed with nonlabeled methionine were added to 15,000 washed CTLL-2 cells/well. Triplicate cultures were assayed in the presence of saturating levels of anti-IL-2, -IL-4, or -IL-15 mAbs to ensure that the effect was due to IL-15. The cells were cultured for 48 h at 37°C in 5% CO2 in air, pulsed with 1 µl (0.25 µCi) of [3H]TdR (Amersham, Buckinghamshire, U.K.) to each well 24 h before harvested. After the culture period, the cells were then harvested onto glass fiber filter paper and the T cell-stimulatory activity was assessed by [3H]TdR incorporation, determined in a liquid scintillation counter.
Immunoprecipitation assays
Peritoneal macrophages were cultured with 100 U/ml IFN-, 5
µg/ml LPS, and 100 µCi/ml [35S]methionine in
methionine-free MEM without FBS for 6 h at 37°C. After three
washes with PBS, macrophages were lysed by immunoprecipitation buffer A
(10 mM Tris-HCl, 1% Nonidet P-40, 0.15 M NaCl, 1 mM EDTA, and 10
µg/ml aprotinin). Five micrograms of anti-murine IL-15 mAb (rat
IgG, PharMingen) or isotype control rat IgG were added to 200 µl of
lysate. After an incubation at 4°C for 60 min, 40 µl of protein
G-Sepharose 4 Fast Flow (Pharmacia Biotech) was added. After incubation
at 4°C for 60 min, the immune complexes were precipitated by
centrifugation and washed five times with buffer A. Associated proteins
were eluted by boiling in Laemmli buffer (14) and separated on an
SDS-15% polyacrylamide gel.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We reported that the expression level of IL-15 mRNA in macrophages
increased progressively 6 h after infection with Salmonella
choleraesuis in mice as assessed by RT-PCR with specific primers
for exons 6 and 8 (4). To clone the full length cDNA of murine IL-15,
the cDNA from macrophages stimulated with LPS for 6 h was
amplified by PCR with specific primers for exons 1 and 8 in the
untranslated region of IL-15 cDNA, and the amplified products were
hybridized with an internal probe for exon 7. As shown in Figure 1
, RT-PCR using primers for exons 1 and 8
demonstrated two transcripts in macrophages stimulated with LPS, while
exons 6 and 8 of the translated region showed a single band (4) (data
not shown). These two amplified products differed by approximately 120
bp (710 bp and 830 bp). The expression of these transcripts increased
equally 6 h after stimulation with LPS.
|
A). Five clones had the exon
2 deleted-isoform generated by alternative splicing. The other two
clones had the exon 2 deleted isoform containing an additional
sequence, which we termed , between originally described exons 4
and 5.
|
in the IL-15
isoform, we cloned an intron between exons 4 and 5 from a genomic DNA
using Promoter Finder DNA Walking Kits as described in Materials
and Methods. A 2-kbp fragment amplified by specific primers for
exon 5 of murine IL-15 cDNA was cloned and the nucleotide sequence was
determined. The novel sequence was identical to the just upstream
genomic sequence of exon 5 and upstream the novel sequence seems to
have an intron termination characterized by adenine guanine (AG)
splice-acceptor sequence and pyrimidine-enriched stretch although it
differed by three nucleotides from consensus sequence for the 3' splice
site (Fig. 2
B). These results suggest that the alternative
exon 5 with the novel sequence in the isoform was generated by an
alternative splicing upstream of exon 5. Notably, five stop codons were
found in the 136-bp sequence followed by a new AUG (Fig. 2A). The predicted IL-15 precursor isoform encoded by the
new ORF contains a short leader peptide of 26 amino acids, but shares
the same amino acid composition as mature IL-15 protein (Fig. 2, C and D). However, the new leader peptide
displayed the no net charge of N-terminal basically-charged region
assessed by McGeoch’s methods (15). The von Heijne signal score of the
new leader peptide was too low for a signal sequence (-0.53 vs 2.03 of
the original leader peptide) (16). This means the possibility of not
possessing a signal sequence in the leader peptide, indicating that the
shorter isoform of murine IL-15 precursor may be restricted in the
cytoplasm. In vitro transcription/translation of splicing isoforms of IL-15 mRNA
We next compared the transcriptional or translational efficiency
among the IL-15 mRNA isoforms with exon 5 or alternative exon 5 using
the rabbit reticulocyte translation/transcription coupled system.
First, we examined the transcription level in rabbit reticulocyte
lysates programmed with the splicing isoform of IL-15 cDNA by Northern
hybridization using a murine IL-15 full length cDNA probe. Consistent
with RT-PCR in LPS-stimulated macrophages, there seems not to be much
difference in the level of in vitro transcription among three splicing
isoforms as shown in Figure 3. We then
examined the translational level of the splicing isoforms using the
rabbit reticulocyte-coupled system. The translational efficiency of the
exon 2-deleted isoform with normal exon 5 was 1.4-fold higher than the
typical IL-15 cDNA sequence containing all eight exons as reported
(20.7 kDa) (Fig. 4). Surprisingly, the translational efficiency of the
exon 2-deleted isoform containing an alternative exon 5 between exons 4
and 5 (16.0 kDa) was 4.1-fold higher than those of IL-15 exon 2-deleted
isoform with normal exon 5 (20.7 kDa) (Fig. 4). As expected, the molecular mass of
the translation product from exon 2-deleted isoform containing an
alternative exon 5 corresponded to the predicted shorter isoform of
IL-15 precursor isoform encoded by the new ORF (predicted mass is 15.9
kDa). To confirm that these translational products are derived from the
IL-15-coding region in the cDNA-splicing isoform, we immunoprecipitated
the products with anti-murine IL-15 mAb. The immunoprecipitation
profile was identical to that of the SDS-PAGE separation of the
translational products (data not shown). To confirm the biologic
activity of the translational products, we examined the stimulatory
activity of the products by the CTLL-2 proliferation assay. The
translation product programmed with the exon 2-deleted isoform
containing an alternative exon 5 promoted more growth of CTLL-2 than
those of the IL-15 isoform cDNA with normal exon 5, and the promoting
activity was significantly inhibited by an anti-IL-15-neutralizing
mAb (data not shown). These results suggested that translational
efficiency is up-regulated by the alternative splicing of exon 5 in
murine IL-15 mRNA.
|
|
We showed the post-transcriptional regulation of IL-15 mRNA in
LPS-stimulated J774A.1 cell line. To generalize this regulation of
IL-15 secretion to conventional macrophages in mice, we examined the
expression of the mRNA isoform generated by alternative splicing in
peritoneal macrophages from BALB/c mice. As shown in Figure 5, high expression levels of isoform
containing an alternative exon 5 were detected in peritoneal
macrophages stimulated with IFN-/LPS or those infected with
Salmonella using specific primers for murine IL-15 exon 3
and a novel sequence within an alternative exon 5. The mRNA isoform
with exon 2 (320 bp) was also predominantly expressed in peritoneal
macrophages stimulated with IFN-/LPS or infected with S.
choleraesuis compared with that without exon 2 (280 bp) as
assessed by specific primers for exons 1 and 4. Thus, the mRNA isoforms
generated by alternative splicing were expressed in conventional
macrophages after stimulation with IFN-/LPS or by bacterial
infection, but transcription of exon 2-deleted isoform containing
alternative exon 5 is not predominant in the macrophages stimulated
with LPS.
|
/LPS.
As shown in Figure 6, the shorter protein
that was detected in stimulated macrophages was identical to that of
the in vitro translational products, with a m.w. of approximately 16
kDa. Thus, the alternative splicing upstream of exon 5 in stimulated
macrophages may be closely associated with up-regulation of
intracellular IL-15 production.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
/LPS, which expressed an abundant
level of an alternative exon 5. These results suggest that normal IL-15
production in stimulated macrophages is regulated by splicing of
alternative exon 5.
Anderson et al. have reported murine genomic structure of IL-15, which
consisted of eight exons spanning at least 34 kb in chromosome 8 (7).
It has been recently reported that an isoform with novel exon is
generated by alternative splicing in human IL-15 (17). Although the
novel exon arose from 494 bp downstream of the end of exon 2 in human
IL-15 mRNA, the precise location of the exon remains to be elucidated.
Here we found a murine IL-15 mRNA isoform containing an additional
136-bp sequence between exons 4 and 5. Genomic sequence between
exons 4 and 5 reveals that this additional sequence arose from just
upstream of exon 5 and had an alternative intron termination 3' site
further upstream. It would thus appear that the alternative exon 5 with
additional sequence is generated by usage of the alternative 3' splice
site upstream of exon 5. The alternative 3' splicing site further
upstream of alternative exon 5 has three nucleotides that differ from
the known consequence sequence for the 3' splice site, whereas the
sequence of the 3' splice site of exon 5 differs by only one nucleotide
from the consensus sequence (18). Therefore, we can speculate that the
splicing at the alternative 3' splice site, being capable of producing
an alternative exon 5, may be inefficient and easily skipped, thereby
resulting in generation of IL-15 mRNA with normal exon 5 using the next
downstream 3' splice site. The alternative splicing pathway represents
a mechanism whereby diversity is generated in a reversible fashion
without a requirement for the expression of a new gene (19). Changes in
the alternative splicing of specific pre-mRNA molecules may be
associated with unique function of each isoform. Many examples of
alternative RNA splicing are used to generate various forms of mRNA in
many viral and eukaryote systems (20). However, the alternative spliced
internal exons we found here are uncommon in vertebrate gene and, more
importantly, the uses of an alternative exon to enhance the
translational efficiency is a novel mechanisms for the
post-transcriptional regulation of protein synthesis. Although
alternative splicing is known to be related to changes in intracellular
pH, cell cycle, or tissue specificity (21), the mechanism governing
alternative splicing of IL-15 remains elusive. The further analysis of
mechanisms controlling internal splicing of an exon of IL-15 may
provide a clue to understand how protein synthesis is regulated by an
alternative splicing of RNA transcript.
It is emphasized that the presence of upstream AUGs in the 5'-UTR of mRNA dramatically reduces the efficiency of translation (22). In general, 5'-UTR of effectively translated mRNA are short and unencumbered by upstream AUGs in the initiation AUG. On analysis of human IL-15 cDNA, the 5'-UTR is long (316 bp) and includes multiple upstream AUGs (1). Bamford et al. showed that IL-15 synthesis by the adult T cell leukemia line HuT-102 involves an increase in IL-15 mRNA transcription and translation secondary to the production of the HTLV-I R element fusion message that lacks many upstream AUGs (10). This indicates that the presence of these 10 upstream AUGs interferes with IL-15 mRNA translation in humans. In the murine IL-15 sequence, there are five upstream AUGs in an unusually long 5'-untranslated region (UTR) (465 bp) (7). However, from our studies, the translational efficiency of IL-15 mRNA lacking exon 2 including three AUGs generated by alternative splicing was also inhibited at the same level as the full length IL-15 mRNA. The splicing isoform containing an alternative exon 5 showed a higher efficiency of translation and generated a shorter isoform of IL-15 precursor. This suggests that translation uses a mechanism of internal initiation on alternative exon 5, which would bypass the IL-15-impeded 5'-UTR.
A full length cDNA clone encodes a 162-amino acid precursor polypeptide containing an unusually long 48-amino acid leader sequence that is cleaved at the experimentally determined NH2-terminus to form the mature protein (1, 7). However, the translational efficiency of the mRNA was very low in vivo and in vitro, and thus secretion of the protein was only a marginal level, if any (10). Onu et al. showed that secretion clearly increases after replacing the IL-15 leader peptide with a foreign one, such as CD33 leader peptide (23). This suggests that the naive leader sequence is involved in the control of cytokine secretion. On the other hand, murine shorter IL-15 precursor encoded by alternative splicing mRNA containing alternative exon 5, which displayed high efficiency of translation, lacks hydrophobic domains of signal sequence in the leader peptide. This indicates that the shorter isoform of murine IL-15 precursor may be restricted in the cytoplasm.
We tried to examine the biologic activity of cDNA isoform containing
alternative exon 5 in vivo using COS-7 cells transfected with cDNA in
eukaryotic expression vector. Although the transcription of the isoform
was significantly high in the transfectant, there is no activity of
IL-15 in the culture supernatant using CTLL-2 assay (data not shown).
This result indicates that IL-15 protein encoded by the mRNA isoform is
accumulated in cytoplasm of the transfectant. However, we cannot at
present define the amount of IL-15 produced in cytoplasm of the
transfectant at the protein level because the Ab against mouse IL-15 is
not available for immunostaining assay. Bamford et al. reported that
activated purified monocytes made a large amount of IL-15 mRNA, but the
IL-15 biologic activity was not demonstrable in the supernatants of
such cells by biologic means and ELISA (10). However, Doherty et al.
reported that culture supernatants from macrophages stimulated in the
presence of IFN- enhanced the proliferation of CTLL-2 cells, even in
the presence of saturating quantities of anti-IL-2 or anti-IL-4
Ab (8). We also showed that biologically significant levels of IL-15
that stimulate T cells are produced by macrophages infected with
Salmonella choleraesuis 31N-1, because T cells
produced IFN- in response to J774A.1, which expressed abundant
levels of IL-15 mRNA, the production of which was inhibited
significantly by anti-IL-15 Ab (4). We presently do not understand
the reason for this discrepancy. It is possible to build up one
hypothesis that a specific stimulus is needed to induce secretion of
IL-15 after accumulation of intracellular IL-15 precursor. This
suggests that the mechanism of IL-15 secretion is distinct from the
typical secretory proteins, and may present a novel pathway of protein
secretion, such as the mechanism of IL-1 or IFN--inducing factor
secretion (24, 25, 26).
In conclusion, we cloned various forms of murine IL-15 cDNA generated
by alternative splicing and showed that the translation efficiency of
the isoform-containing alternative exon 5 was significantly higher than
those of splicing isoforms with normal exon 5. The shorter isoform of
the IL-15 precursor was predominantly detected in peritoneal
macrophages stimulated with IFN-/LPS, which expressed an abundant
level of an alternative exon 5. These results suggest that normal IL-15
production in stimulated macrophages is regulated by splicing of
alternative exon 5.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Hitoshi Nishimura, Laboratory of Host Defense and Germfree Life, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine, Nagoya 466, Japan.
3 Abbreviations used in this paper: HTLV-I, human T cell lymphotropic virus type I; AUG, adenine uracil guanine; PEC, peritoneal exuded cells; ORF, open reading frame; UTR, untranslated region; PSL, photo-stimulated luminescence value.
Received for publication May 9, 1997. Accepted for publication October 1, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
chains of the IL-2 receptor by the novel cytokine IL-15. EMBO J. 14:3654.[Medline]
T cells induced by Salmonella infection. J. Immunol. 156:663.[Abstract]
T cells in priming macrophages to produce tumor necrosis factor-. Eur. J. Immunol. 25:1465.[Medline]
production by T cells. Nature 378:88.[Medline]
This article has been cited by other articles:
|
|
 |
|
  C. Bergamaschi, R. Jalah, V. Kulkarni, M. Rosati, G.-M. Zhang, C. Alicea, A. S. Zolotukhin, B. K. Felber, and G. N. Pavlakis Secretion and Biological Activity of Short Signal Peptide IL-15 Is Chaperoned by IL-15 Receptor Alpha In Vivo J. Immunol., September 1, 2009; 183(5): 3064 - 3072. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Miyazaki, F. Ishikawa, K. Shimizu, T. Ubagai, P. H. Edelstein, and K. Yamaguchi Gr-1high Polymorphonuclear Leukocytes and NK Cells Act via IL-15 to Clear Intracellular Haemophilus influenzae in Experimental Murine Peritonitis and Pneumonia J. Immunol., October 15, 2007; 179(8): 5407 - 5414. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Wang, J. W. Holland, A. Carrington, J. Zou, and C. J. Secombes Molecular and Functional Characterization of IL-15 in Rainbow Trout Oncorhynchus mykiss: A Potent Inducer of IFN-{gamma} Expression in Spleen Leukocytes J. Immunol., August 1, 2007; 179(3): 1475 - 1488. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Marcucci, F. E. Baralle, and M. Romano Complex splicing control of the human Thrombopoietin gene by intronic G runs Nucleic Acids Res., January 12, 2007; 35(1): 132 - 142. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Yu, C. Tang, S. Xun, T. Yajima, K. Takeda, and Y. Yoshikai MyD88-Dependent Signaling for IL-15 Production Plays an Important Role in Maintenance of CD8{alpha}{alpha} TCR{alpha}beta and TCR{gamma}{delta} Intestinal Intraepithelial Lymphocytes J. Immunol., May 15, 2006; 176(10): 6180 - 6185. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Nishimura, A. Fujimoto, N. Tamura, T. Yajima, W. Wajjwalku, and Y. Yoshikai A novel autoregulatory mechanism for transcriptional activation of the IL-15 gene by a nonsecretable isoform of IL-15 generated by alternative splicing FASEB J, January 1, 2005; 19(1): 19 - 28. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Yajima, H. Nishimura, R. Ishimitsu, T. Watase, D. H. Busch, E. G. Pamer, H. Kuwano, and Y. Yoshikai Overexpression of IL-15 In Vivo Increases Antigen-Driven Memory CD8+ T Cells Following a Microbe Exposure J. Immunol., February 1, 2002; 168(3): 1198 - 1203. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Mattei, G. Schiavoni, F. Belardelli, and D. F. Tough IL-15 Is Expressed by Dendritic Cells in Response to Type I IFN, Double-Stranded RNA, or Lipopolysaccharide and Promotes Dendritic Cell Activation J. Immunol., August 1, 2001; 167(3): 1179 - 1187. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Suzuki, H. Nakazato, H. Matsui, M. Hasumi, Y. Shibata, K. Ito, Y. Fukabori, K. Kurokawa, and H. Yamanaka NK cell-mediated anti-tumor immune response to human prostate cancer cell, PC-3: immunogene therapy using a highly secretable form of interleukin-15 gene transfer J. Leukoc. Biol., April 1, 2001; 69(4): 531 - 537. [Abstract] [Full Text]
|
|
|
|
|
|
M. Umemura, K. Hirose, W. Wajjwalku, H. Nishimura, T. Matsuguchi, Y. Gotoh, M. Takahashi, M. Makino, and Y. Yoshikai Impaired IL-15 production associated with susceptibility of murine AIDS to mycobacterial infection J. Leukoc. Biol., January 1, 2001; 69(1): 138 - 148. [Abstract] [Full Text]
|
|
|
|
 |
|
 T. A. Fehniger and M. A. Caligiuri Interleukin 15: biology and relevance to human disease Blood, January 1, 2001; 97(1): 14 - 32. [Full Text] [PDF]
|
|
|
|
|
|
M. Cazzola and R. C. Skoda Translational pathophysiology: a novel molecular mechanism of human disease Blood, June 1, 2000; 95(11): 3280 - 3288. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Nishimura, T. Yajima, Y. Naiki, H. Tsunobuchi, M. Umemura, K. Itano, T. Matsuguchi, M. Suzuki, P. S. Ohashi, and Y. Yoshikai Differential Roles of Interleukin 15 mRNA Isoforms Generated by Alternative Splicing in Immune Responses in Vivo J. Exp. Med., January 3, 2000; 191(1): 157 - 170. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Musso, L. Calosso, M. Zucca, M. Millesimo, D. Ravarino, M. Giovarelli, F. Malavasi, A. N. Ponzi, R. Paus, and S. Bulfone-Paus Human Monocytes Constitutively Express Membrane-Bound, Biologically Active, and Interferon-{gamma}-Upregulated Interleukin-15 Blood, May 15, 1999; 93(10): 3531 - 3539. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Hirose, H. Suzuki, H. Nishimura, A. Mitani, J. Washizu, T. Matsuguchi, and Y. Yoshikai Interleukin-15 May Be Responsible for Early Activation of Intestinal Intraepithelial Lymphocytes after Oral Infection with Listeria monocytogenes in Rats Infect. Immun., December 1, 1998; 66(12): 5677 - 5683. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Ghilardi, A. Wiestner, and R. C. Skoda Thrombopoietin Production Is Inhibited by a Translational Mechanism Blood, December 1, 1998; 92(11): 4023 - 4030. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Takano, H. Nishimura, Y. Kimura, Y. Mokuno, J. Washizu, S. Itohara, Y. Nimura, and Y. Yoshikai Protective Roles of gamma delta T Cells and Interleukin-15 in Escherichia coli Infection in Mice Infect. Immun., July 1, 1998; 66(7): 3270 - 3278. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Kurys, Y. Tagaya, R. Bamford, J. A. Hanover, and T. A. Waldmann The Long Signal Peptide Isoform and Its Alternative Processing Direct the Intracellular Trafficking of Interleukin-15 J. Biol. Chem., September 22, 2000; 275(39): 30653 - 30659. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
