The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Davis, H. L.
Right arrow Articles by Krieg, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Davis, H. L.
Right arrow Articles by Krieg, A. M.
The Journal of Immunology, 1998, 160: 870-876.
Copyright © 1998 by The American Association of Immunologists

CpG DNA Is a Potent Enhancer of Specific Immunity in Mice Immunized with Recombinant Hepatitis B Surface Antigen1

Heather L. Davis2,*,{dagger}, Risini Weeranta*, Thomas J. Waldschmidt{ddagger}, Lorraine Tygrett{ddagger}, Joachim Schorr§ and Arthur M. Krieg

* Loeb Research Institute, Ottawa Civic Hospital, Ottawa Canada; {dagger} Faculties of Health Sciences and Medicine, University of Ottawa, Canada; {ddagger} Interdisciplinary Immunology Program and Department of Pathology, University of Iowa College of Medicine, Iowa City, IA 52242; § Qiagen GmbH, Hilden, Germany; and Interdisciplinary Immunology Program and Department of Internal Medicine, University of Iowa College of Medicine, Iowa City, IA, 52242 and Veterans Affairs Medical Center, Iowa City, IA 52246.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODN) cause B cell proliferation and Ig secretion, monocyte cytokine secretion, and activation of NK cell lytic activity and IFN-{gamma} secretion in vivo and in vitro. The potent immune activation by CpG ODN suggests possible utility for enhancing immune responses to vaccines. Mice immunized with recombinant hepatitis B virus surface Ag and a CpG ODN as an immune enhancer have titers of Abs against HBsAg (anti-HBs) that are five times higher than those of mice immunized with HBsAg and the standard adjuvant, aluminum hydroxide (alum). Ab titers in mice immunized with HBsAg and both CpG ODN plus alum were 35 times higher than the titers in mice immunized with alum alone, indicating a strong synergistic interaction between the CpG ODN and alum. ODN without CpG motifs had little or no immune-enhancing activity at the doses used herein. Alum induces a Th2 humoral response (mostly IgG1) and no CTL. In contrast, CpG ODN gives a strong Th1 response with predominantly IgG2a Abs and CTL, even when mixed with alum. In vitro studies to determine possible mechanisms of CpG immune-enhancing effects show that CpG ODN induce expression of costimulatory molecules on Ag-presenting cells and drive B cell isotype switching in the appropriate cytokine milieu. These studies demonstrate that CpG ODN are promising new immune enhancers for vaccination applications.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bacterial DNA, but not vertebrate DNA, has direct immunostimulatory effects on leukocytes in vitro (1, 2). This lymphocyte activation is due to unmethylated CpG dinucleotides (3), which are present at the expected frequency in bacterial DNA (1/16 bases) but are under-represented ("CpG suppression," 1/50 to 1/60 bases) and methylated in vertebrate DNA (4). Activation may also be triggered by synthetic oligodeoxynucleotides (ODN3) that contain one or more unmethylated CpG dinucleotides in particular sequence contexts (CpG motifs) (3). It appears likely that the rapid immune activation in response to CpG DNA may have evolved as one component of the innate immune defense mechanisms that recognize structural patterns specific to microbial molecules (5).

CpG DNA can induce proliferation of almost all (>95%) B cells and triggers polyclonal Ig secretion. This B cell activation by CpG DNA is T cell independent and Ag nonspecific. However, B cell activation by low concentrations of CpG DNA has strong synergy with signals delivered through the B cell Ag receptor for both B cell proliferation and Ig secretion (3). In theory, this strong synergy between the B cell signaling pathways triggered through the B cell Ag receptor and by CpG DNA may promote Ag-immune responses. In addition to its direct effects on B cells, CpG DNA also directly activates monocytes, macrophages, and dendritic cells to secrete a variety of cytokines, including high levels of IL-12 (6, 7, 8). These cytokines stimulate NK cells to secrete IFN-{gamma} and have increased lytic activity (6, 8, 9, 10, 11). It is noteworthy that although IFN-{gamma} inhibits LPS-induced B cell activation, the IFN-{gamma} secreted in response to CpG DNA promotes B cell activation and Ig secretion (12).

Overall, CpG DNA induces a Th1-like pattern of cytokine production dominated by IL-12 and IFN-{gamma} with little secretion of Th2 cytokines (6). Such a Th1 immune response is associated with the production of predominantly IgG2a Abs, while Th2 responses are associated with the production of IgG1 Abs.

The strong activating effects of CpG DNA on B cells, as well as the induction of cytokines that could have indirect effects on B cells via T-help pathways, suggest utility of CpG ODN as a vaccine enhancer. Here we test a CpG ODN alone, and in combination with alum, for its effects on the humoral and cellular responses against recombinant hepatitis B surface Ag (HBsAg) in mice. We show that a CpG ODN drives the production of higher levels of Ag-specific Abs (predominantly Th1) compared with alum and that there is a strong synergistic response when the ODN is used together with alum. We also demonstrate the ability of CpG ODN to induce costimulatory molecule expression in vitro and in vivo and to drive B cell isotype shifting in vitro, suggesting possible mechanisms for the enhancing effects.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Oligodeoxynucleotides

ODN used herein were: 1745, TCCATGAGCTTCCTGAGTCT; 1911, TCCAGGACTTTCCTCAGGTT; 1982, TCCAGGACTTCTCTCAGGTT; 1983, TTTTTTTTTTTTTTTTTTTT; 1668, TCCATGACGTTCCTGATGCT; and 1826, TCCATGACGTTCCTGACGTT (CpG dinucleotides underlined for clarity). All ODN were synthesized with a nuclease-resistant phosphorothioate backbone by Oligos Etc. (Wilsonville, OR), The Na+ salts of the ODN were ethanol precipitated and then resuspended in 10 mM Tris (pH 7.0) 1 mM EDTA for storage at -20°C before dilution into saline for injection. LPS level in ODN was undetectable (less than 1 ng/mg) by Limulus assay (Whittaker Bioproducts, Walkersville, MD).

Immunization of mice against HBsAg

Immunization with HBsAg was conducted on 6- to 8-wk-old female BALB/c mice (Charles River, Montreal, QC, Canada). Each mouse received a single i.m. injection, into the left tibialis anterior muscle, of a solution containing 1 µg recombinant HBsAg (ay subtype) produced in yeast cells (Medix Biotech, Foster City, CA) in a total volume of 50 µl. Control groups (n = 10) received HBsAg in saline or with added Al2O3 (Alhydrogel "85," Superfos Biosector, Vedbaek, Denmark; 2.5 µl 2% Al2O3 per µg HBsAg to give 25 mg Al3+/mg HBsAg). Experimental groups (n = 5 or 10) received HBsAg plus 10, 100, or 500 µg of the indicated ODN. These experiments were performed with ODN in which the backbone was nuclease resistant (phosphorothioate) to improve cell uptake and in vivo stability (13). Some experimental groups received only CpG ODN while others received both CpG ODN plus alum (as above). All component solutions were added at the same time, mixed with a vortex, and left on ice for about 30 min before injection.

Evaluation of in vivo humoral response to HBsAg

Plasma was recovered from mice at various times after immunization as described previously (14). Abs specific to HBsAg were detected and quantified by end-point dilution ELISA assay (in triplicate) on samples from individual animals (15).

In brief, a solid phase of plasma-derived HBsAg particles (ay subtype, 100 µl of 1 µg/ml per well, overnight at room temperature) was used to capture anti-HBs Abs in the plasma (1 h at 37°C), which were then detected with horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG, IgM, IgG1, or IgG2a (1:4000 in PBS-Tween, 10% FBS; 100 µl/well; Southern Biotechnology Inc., Birmingham, AL), followed by o-phenylenediamine dihydrochloride solution (100 µl/well, 30 min at room temperature in the dark; Sigma, St. Louis, MO). End-point titers were defined as the highest plasma dilution that resulted in an absorbance value (OD 450) two times greater than that of nonimmune plasma with a cut-off value of 0.05.

For descriptive purposes, anti-HBs titers were expressed as group means ± SEM of individual animal values, which were themselves the average of triplicate assays. The statistical significance of differences between groups was determined from the means and SDs by Student’s t test (for 2 groups) or 1-factor ANOVA (for three or more groups). All statistical tests were performed using InStat (GraphPad Software, San Diego, CA).

Evaluation of CTL response

Spleens were recovered under sterile conditions from mice 12 to 16 wk after immunization with HBsAg alone or with CpG ODN and/or alum (n = 3/group). Single cell suspensions were prepared and suspended in RPMI 1640 (Life Technologies, Grand Island, NY) tissue culture medium supplemented with 10% FBS (Life Technologies) and penicillin-streptomycin solution (final concentrations of 1000 U/ml and 1 mg/ml respectively) (Sigma, Irvine, U.K.). Splenocytes (3 x 107) were cocultured with 1.5 x 106 syngeneic HBsAg-expressing stimulator cells (P815-preS, generously provided by F.V. Chisari, Scripps Institute, La Jolla, CA), which had been inactivated by irradiation (20,000 rad). The cultures were maintained for 5 days in 10 ml of media in upright 25 cm2 tissue culture flasks in a humidified atmosphere (5% CO2) at 37°C and then were harvested and washed in media. These effector cells were serially diluted and cultured with 5 x 103 51Cr-labeled HBsAg-expressing targets (P815S) or control target cells (P815) at 37°C in round-bottom 96-well microtiter plates, with each sample in triplicate. After 4 h of incubation, 100 µl of supernatant was removed for radiation (gamma) counting. The percent lysis was calculated as [(experimental release - spontaneous release)/(total release - spontaneous release)] x 100. Spontaneous release was determined by incubating target cells without effector cells, and total release was determined by adding 100 µl of 2% Triton X-100 to the target cells. The percent specific lysis was calculated as follows: % lysis with P815S cells - % lysis P815 cells.

In vivo ODN treatment and flow cytometric analysis

BALB/c mice were given a single i.p. dose (500 µg) of ODN suspended in saline (0.15 M NaCl). At designated time points after injection, mice were killed and spleen cells analyzed by flow cytometry. Specifically, Ficoll-spun splenocytes were incubated with conjugated Abs for 20 min at 4°C, followed by washing and incubation with the FITC-avidin. In the first incubation, 15 µg of the anti-Fc{gamma}RII Ab 2.4G2 and 10 µl of rat serum were added to minimize nonspecific staining. Cells were stained with Cyanine 5.18-conjugated anti-B220 (6B2) and either biotin-conjugated anti-MHC class II (M5/114), anti-B7.2 (GL1), or anti-Ly-6C (15.1.1). Conjugated purified rat IgG (Jackson ImmunoResearch, West Grove, PA) served as isotype controls. Stained cells were run on a dual laser Becton Dickinson FACS 440 with a minimum of 3 x 104 cells collected per sample. The FACS 440 data were analyzed using a VAX station 3200 computer equipped with DESK software (kindly supplied by Wayne Moore, Stanford University, Stanford, CA). Final graphic output was performed with Macintosh Canvas software (Deneba Software, South Miami, FL).

Preparation and culture of purified B cells for isotype switch studies

Spleens were obtained from 6- to 8-wk-old female BALB/c mice or BALB/c mice genetically lacking the IFN-{gamma} gene (The Jackson Laboratory, Bar Harbor ME) that had been maintained under specific pathogen-free conditions in the University of Iowa Animal Care Facility. Splenocyte suspensions were treated with anti-Thy 1 (HO13.4) and baby rabbit complement to eliminate T cells, followed by sedimentation through a discontinuous (50%/60%/70%/75%) Percoll gradient. Dense B cells at the 70 to 75% Percoll interface were collected, washed in balanced salt solution (BSS), and suspended in complete medium consisting of RPMI 1640 with FBS (10%), penicillin (100 unit/ml), streptomycin (100 unit/ml), L-glutamine (2 mM), and 2-ME (0.05 mM). In selected experiments, T cell-depleted splenic B cells were stained with Cyanine 5.18-conjugated anti-B220 (6B2) and FITC-conjugated anti-IgD (11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26) followed by sort purification of the B220+IgD+ cells on a dual laser Coulter Epics 753 (Hialeah, FL).

Percoll dense or sort-purified B cells were cultured in flat-bottom 96-well plates at 1 x 105 cells per well in 200 µl of complete medium. Cultures were stimulated with 6 µg/ml of CpG or non-CpG ODN alone or with either recombinant IL-4 (Peprotech, Rocky Hill, NJ) at 1000 U/ml or IFN-{gamma} (kindly provided by Immunex Corp., Seattle, WA) at 20 or 100 U/ml as indicated. LPS (Escherichia coli 0111:B4 LPS; Difco, Detroit MI) at 40 µg/ml served as positive control. Culture supernatants were harvested after 6 days and assayed for Ig levels.

Isotype-specific Ig ELISA assays

Isotype specific ELISA assays were designed for the measurement of total IgM, IgG1, IgG2a, and IgE from culture supernatants. For each ELISA, 50 µl of culture supernatant was assayed and quantified based on a standard curve. These ELISA utilized a biotinylated detection Ab followed by alkaline phosphatase streptavidin (Zymed, San Francisco, CA), and subsequent reaction with phosphatase substrate (Sigma Chemical Co., St. Louis, MO). Capture and detection Abs for the various isotype-specific ELISA were as follows: IgM, goat anti-mouse µ-chain-specific Ab (capture) and monoclonal rat anti-mouse IgM b-7–6 (detection); IgG1, goat anti-mouse {gamma}1 Ab (capture and detection); IgG2a, goat anti-mouse {gamma}2a Ab (capture and detection); IgE, monoclonal rat anti-mouse {epsilon}-chain B1E3 (capture); and monoclonal rat anti-mouse {epsilon}-chain EM95 (detection). All goat Ab preparations were obtained from Southern Biotechnology Associates (Birmingham, AL). Affinity-purified anti-TNP IgM, IgG1, IgG2a, and IgE mAbs were used as standards.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CpG ODN is a potent enhancer of immunization against HBsAg in mice

BALB/c mice immunized on a single occasion by i.m. injection of 1 µg of HBsAg without adjuvant attained only low titers of Abs against HBsAg (anti-HBs) by 12 wk (mean endpoint dilution ELISA titer of total IgG about 400). Titers of anti-HBs were nearly seven times higher when the standard adjuvant for humans, aluminum hydroxide (Al2O3, commonly known as alum), was added at the same ratio (0.5 mg/ml) as used in the commercial hepatitis B vaccines (e.g., Engerix-B, SmithKline Beecham; Recombivax-HB, Merck). In contrast, anti-HBs titers were 20 times higher when HBsAg was mixed with the immune activating CpG ODN 1826 and 180 times higher with this ODN and alum together (Fig. 1Go). The enhancing effects of ODN 1826 were surprisingly potent, as anti-HBs titers were not significantly different between groups receiving 10-, 100-, or 500-µg doses, nor between groups receiving these doses of ODN mixed with alum. In other experiments we found that doses of 1 µg or below had reduced effect (not shown). Anti-HBs titers in animals receiving ODN without CpG motifs (#1982 and 1983), alone or with alum, were not significantly different from those in the respective control groups (HBsAg alone or HBsAg plus alum) (Fig. 2Go). Treatment with CpG DNA was well tolerated by all mice, which exhibited no apparent ruffling of fur, diarrhea, or other signs of toxicity, even with the 500-µg dose.



View larger version (57K):
[in this window]
[in a new window]
 
FIGURE 1. Kinetics and strength of humoral responses in BALB/c mice immunized against HBsAg by i.m. injection of 1 µg of recombinant HBsAg protein, which was given alone (x), with alum (25 mg Al3+/mg HBsAg) (*), or with CpG ODN (1826) in doses of 10 ({blacktriangleup}), 100 (•), or 500 (squlf) µg. ODN was either given alone (open symbols) or together with alum (closed symbols). Each point represents the group mean (n = 8–10) for titers of anti-HBs (total IgG) as determined in triplicate by end-point dilution ELISA assay. End-point titers were defined as the highest plasma dilution that resulted in an absorbance value (OD 450) two times greater than that of control nonimmune plasma with a cut-off value of 0.05.

 


View larger version (59K):
[in this window]
[in a new window]
 
FIGURE 2. Strength of humoral response in BALB/c mice immunized i.m. with 1 µg recombinant HBsAg without adjuvant or with 10 µg of ODN and/or alum. Stippled bars indicate groups without alum and solid bars with alum. Each bar represents the group mean (n = 5 for 1982, 1983; n = 10 for none, 1826) for anti-HBs ELISA titers (total IgG) at 4 wk. Vertical lines represent the SEs of the mean.

 
CpG ODN induces a Th1-like response even in the presence of alum

Immunization with HBsAg alone gave a mixed Th1/Th2 response, but with more anti-HBs Abs of the IgG2a (Th1) than IgG1 (Th2) isotype (Fig. 3Go). When alum was added as adjuvant, the response became predominantly Th2 with almost all anti-HBs Abs being of the IgG1 isotype. In contrast, in mice injected with HBsAg with CpG ODN (1826), the majority of Abs were IgG2a, indicating a very strong Th1-type response. Remarkably, even when combined with alum, the CpG ODN induced significantly more IgG2a than IgG1, indicating that the effects of CpG ODN dominate over those of alum with respect to T-help. Control ODN without CpG motifs (1982 and 1983) did not affect the isotype profile (Fig. 3Go).



View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 3. Ab isotypes in BALB/c mice 4 wk after immunization with 1 µg recombinant HBsAg protein without adjuvant, or with 10 µg ODN and/or alum. Each bar represents the group mean (n = 5 for 1982, 1983; n = 10 for none, 1826) for anti-HBs titers as determined by end-point dilution ELISA assay. Stippled-hatched portions indicate IgG1 isotype (Th2) and solid portions indicate IgG2a isotype (Th1). Note different scale for 1826 with alum.

 
These observations were further confirmed by the results of the CTL assays. Low levels of CTL were induced by immunization with HBsAg alone, and no CTL were detected with alum. The CTL response was much stronger with the addition of an immunostimulatory CpG ODN (1826), even in the presence of alum, confirming the ability of CpG ODN to overcome the Th2 bias of alum (Fig. 4Go). There were no differences between results obtained with 10, 100, or 500 µg of the CpG ODN in the absence of alum (results not shown), indicating that complete immunostimulatory effects are realized at low doses. The non-CpG control ODN (1982) augmented the CTL response in the absence of alum, although to a much lesser degree than did 1826, and had very little effect in the presence of alum (Fig. 4Go).



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 4. CTL activity in splenocytes removed from mice 3 to 6 wk after immunization with 1 µg HBsAg, which was given without alum (open symbols) or with alum (solid symbols) with the addition of either no oligo (58), 100 µg CpG ODN 1826 ({blacksquare}), or 100 µg non-CpG ODN 1982 (•). Each point represents the means of three animals that were each assayed in triplicate. E:T ratios are indicated on the horizontal axis. The vertical axis shows HBsAg-specific lysis as a percentage of the total possible lysis (% specific lysis).

 
CpG ODN induce costimulatory molecule expression in vitro and in vivo

Administration of CpG ODN with Ag or with Ag and alum resulted in the production of increased levels of Ab. This effect can be attributed to a number of CpG-mediated activities including the stimulation of monocytic/dendritic cells, the induction of proinflammatory cytokines, and the activation of B cell proliferation and differentiation (5). Collectively, these activities may create an environment highly conducive to Ag presentation and may trigger the expression of costimulatory molecules on Ag-presenting cells, which is required for the induction of T cell differentiation. To test this assumption, the expression of selected surface molecules was monitored on B cells after either in vitro or in vivo exposure to CpG ODN. In the first set of experiments, T cell-depleted spleen cells (containing predominantly B cells and a minor population of non-B, non-T cells) were cultured with ODN for 48 h and tested for expression of MHC class II, B7.2, and Ly-6C. As shown in Figure 5Go, B cells treated with CpG ODN demonstrated a marked up-regulation of MHC class II and B7.2, key molecules involved in both the induction of Th cells, and Th cell-B cell cognate interactions. Ly-6C is also up-regulated on B cells, an indicator of IFN-{alpha} or -{gamma} production in the culture (T. J. Waldschmidt, unpublished observations). The IFN is likely produced by the small number of NK or monocytic cells present in the culture and is seen in all three groups. Of interest, at high doses the non-CpG ODN also induced increases in MHC class II and B7.2, although the level of expression was lower than that observed with the CpG ODN.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 5. CpG ODN-mediated induction of costimulatory molecules. T cell-depleted spleen cells were incubated in medium alone, 6 µg/ml CpG ODN 1826, or 6 µg/ml non-CpG ODN 1911. After 48 h of culture, cells were harvested, washed, and stained with Abs to MHC class II, B7.2, or Ly-6C followed by flow cytometric analysis. The isotype controls (shaded histograms) are shown for comparison. The derived MFI of the class II MHC stain was 10.84 for cells cultured in medium, 13.47 for non-CpG, and 18.53 for CpG; for the B7.2 stain the MFI was 1.14 for cells cultured in medium, 3.03 for non-CpG, and 5.92 for CpG; for the Ly-6C stain the MFI was 1.16 for cells cultured in medium, 1.60 for non-CpG, and 3.13 for CpG. Thus, although some activation of expression of these markers was observed in the cells treated with the non-CpG ODN, the average levels were approximately twice as high on the cells treated with the CpG ODN. These data are typical of those obtained in three separate experiments. Histograms are derived from the gated viable cells, as determined by forward and orthogonal light scatter.

 
To determine whether these in vitro activities would also be detectable in vivo, additional experiments were performed in which 500 µg of CpG or non-CpG ODN was injected into mice i.p. and splenic B cell phenotype was assessed 2 and 6 days later by flow cytometry. The results of such an experiment, illustrated in Figure 6Go, are consistent with the in vitro studies in that B cell MHC class II and B7.2 were elevated at day 2 in mice receiving CpG ODN. At 6 days postinjection, class II remained high, whereas B7.2 dropped to near baseline levels. Expression of Ly-6C was markedly increased at day 2 in response to CpG ODN and was still elevated at day 6. This latter observation suggests that CpG ODN induce high and sustained levels of proinflammatory cytokines, including IFN-{alpha} and -{gamma}. As in the in vitro experiments, the non-CpG ODN exhibited some biologic activity although its effects were generally less potent. Collectively, these data indicate that CpG ODN up-regulate costimulatory molecules on Ag-presenting cells and further enhance the priming environment by inducing the expression of proinflammatory cytokines.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 6. In vivo effects of CpG ODN on B cell phenotype. BALB/c mice were injected i.p. with 500 µg of either CpG ODN 1826 or non-CpG ODN 1911. Splenocytes were harvested 2 or 6 days after injection and stained with anti-B220 and either anti-MHC class II, anti-B7.2, or anti-Ly-6C followed by flow cytometric analysis. Spleen cells from an uninjected control mouse are shown for comparison. All histograms are derived from the B220+ gated B cells.

 
CpG ODN promote in vitro B cell isotype switching

From the perspective of the B cell, CpG ODN may promote in vivo Ag-specific IgG production either directly, by facilitating isotype switching of Ag-selected B cells, or indirectly, by inducing a strong Th cell response. Activation of the switch recombination program in naive B cells is known to require a strong differentiation signal and a specific cytokine that directs which heavy chain locus will be accessible (IFN-{gamma} promotes selection of IgG2a; IL-4 promotes the selection of IgE and IgG1) (16). To evaluate the ability of CpG ODN to induce B cell isotype switching, we tested two CpG ODN, 1668 and 1826, which activate B cell differentiation and IFN-{gamma} secretion from NK cells, as well as a control non-CpG ODN (1745), which has little effect (8, 10, 17).

Resting B cells were purified by Percoll sedimentation and then cultured with LPS (as positive control), CpG ODN, or control non-CpG ODN. To mimic the Th1-like cytokine milieu induced in vivo by the CpG ODN, recombinant IFN-{gamma} was added to the cultures. After 6 days, culture supernatants were assayed for the presence of downstream isotypes. Both LPS and CpG ODN induced high levels of IgM secretion, but in the absence of IFN-{gamma} there was minimal secretion of IgG2a (Table IGo). Upon addition of IFN-{gamma} however, both LPS and CpG ODN promoted a marked increase in IgG2a secretion, strongly suggesting the induction of isotype switching. Of interest, the non-CpG ODN allowed for a modest level of IgM and IgG2a secretion, consistent with the low level of biologic activity observed in the other studies (Figs. 5Go, 6Go).


View this table:
[in this window]
[in a new window]
 
Table I. Induction of Th-1-like Ab secretion by CpG ODN + IFN-{gamma}

 
In a second set of experiments, the capacity of CpG ODN and IL-4 to promote switching to IgG1 and IgE was examined. In the first experiment, as shown in Table IIGo, Percoll-sedimented B cells were cultured with LPS, CpG ODN, or non-CpG ODN in the presence or absence of IL-4. LPS and CpG ODN again promoted a strong IgM response but, in the absence of IL-4, induced little IgG1 and IgE secretion. In the presence of IL-4, however, both LPS and CpG ODN induced heightened levels of IgG1 and IgE although LPS proved to be a stronger stimulus. Non-CpG ODN induced a modest level of IgM but failed to promote secretion of the downstream isotypes. These results again suggest that CpG ODN directly promotes switch recombination in the presence of cytokines.


View this table:
[in this window]
[in a new window]
 
Table II. Induction of Th-2-like Ab secretion by CpG ODN + IL-4

 
The cytokine dependence of IgG1 and IgE secretion is evidence that CpG ODN are not simply promoting Ig secretion from B cells that have already undergone switch recombination. However, to exclude this possibility more rigorously, we repeated the experiment using a highly purified population of naive B cells, which can be distinguished by the fact that they are IgD. IgDhighB220+ B cells were sort purified and stimulated as in experiment 1. The results show that CpG ODN induce IgG1 and IgE secretion only in the presence of IL-4 and confirm the interpretation that the combined action of these signals has induced switch recombination (experiment 2, Table IIGo).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Alum (e.g., Al2O3) was developed for therapeutic use about 75 years ago and is still the only adjuvant approved for human use. In the studies presented herein, we show that CpG ODN can induce higher Ab titers than alum, even at low doses. An advantage of the ODN over alum is that it could be used to enhance immune responses to live-attenuated or multivalent vaccines that cannot be mixed with alum. In situations where a particularly potent adjuvant is required, for example with a poorly immunogenic Ag or to overcome non- or hyporesponsiveness, it may be possible to take advantage of the synergistic effect of CpG ODN and alum together. Our studies indicate that the CpG-enhancing effect requires only a single CpG motif (i.e., ODN 1668). In ongoing studies to determine the optimal number and spacing of CpG motifs, we have found that the effect can be somewhat further enhanced with ODN containing two motifs but that additional motifs do not seem to contribute a further increase in the immune response (H. L. Davis et al., unpublished results).

Our studies demonstrate that the in vivo immune-enhancing effect of CpG DNA is associated with the induction of costimulatory molecule expression including class II MHC and B7.2. The induction of class II MHC, a marker for lymphocyte activation and Ly-6C, a marker for the presence of IFNs, persisted for at least 6 days following injection of CpG ODN. Since previous studies have shown that the cytokine induction by CpG DNA lasts for less than 24 h (6, 18), this sustained expression demonstrates that the cytokine effect outlasts the elevated cytokine levels. These data suggest that CpG DNA may improve the efficiency with which local Ag-presenting cells present coinjected Ags to T cells and induce T helper cell activity. Indeed, in support of this hypothesis, we have found that the effect of CpG DNA depends on coadministration with the Ag and is substantially reduced if the Ag and ODN are injected in separate sites (G. Weiner et al., H. L. Davis et al., unpublished data). A consistent but less dramatic stimulatory effect of the control ODN on costimulatory molecule expression was also noted. We consistently observed that phosphorothioate backbone ODN without a CpG caused a dose-dependent, non-sequence-specific B cell proliferation and monocyte/macrophage activation, which, while weaker than that seen with phosphorothioate CpG ODN, was more substantial at higher ODN concentrations (not shown). These results are in agreement with the data of Monteith et al., who showed that all phosphorothioate backbone ODN can induce B cell proliferation and splenomegaly in vivo, indicating an inherent immune stimulatory effect of the phosphorothioate backbone (19).

In addition to its ability to enhance Ag presentation, and thereby provide T cell help, our previous studies have shown that CpG ODN directly stimulate murine B cells to proliferate and secrete IgM (3). The possibility thus arises that together with appropriate cytokine signals, CpG ODN may directly promote switch recombination at the level of the individual B cell. It is clear from numerous studies that two signals are required to induce the switch recombination program in naive B cells (16). In addition to a specific cytokine that directs which heavy chain locus will be accessible, B cells require a strong differentiation signal. Murine cytokines known to direct isotype-specific switching include IL-4, which promotes switching to IgG1 and IgE (20, 21, 22, 23), and IFN-{gamma}, which induces switching to IgG2a (24). In the mouse, LPS or reagents that engage CD40 have been demonstrated to supply the necessary differentiation signals for switch recombination. Based on these findings, we tested whether CpG ODN could also induce isotype switching in combination with either IL-4 or IFN-{gamma}. Our studies confirmed the ability of CpG ODN to promote isotype switching in either the Th1 or Th2 direction, depending on the cytokine environment. Unlike LPS, CpG DNA induces a high level of IFN-{gamma} secretion from NK cells, which explains the predominance of IgG2a isotypes observed in the in vivo studies.

Strong cell-mediated immunity, including CTL activity, is essential for protection against many diseases and is therefore desirable with almost all vaccines. Although not essential for protective immunity against HBV, CTL may be important for avoiding or overcoming the chronic carrier state. Indeed, many previously infected individuals, even years after clinical and serologic recovery, have traces of HBV in their blood and have HBV-specific CTL that express activation markers indicative of recent contact with Ag (25). These results suggest that sterilizing immunity may not occur after HBV infection and that chronic activation of CTL is responsible for keeping the virus under control. There are currently more than 250 million chronic HBV carriers in the world, many of whom will eventually suffer from cirrhosis or hepatocellular carcinoma (26). Repeated doses of an HBsAg subunit vaccine (with alum) reduced viral replication in 50% of vaccinated chronic carriers (27). Addition of CpG ODN would presumably improve these results through its strong Th1 bias and induction of CTL. This might be far more effective than the currently used IFN therapy, which cures only 10 to 20% of treated individuals (28) and would also be much less expensive, an important factor since the highest incidence of HBV chronicity is in less developed areas of the world. Anti-viral drugs (e.g., lamivudine) are also expensive and, although they can reduce the circulating virus to undetectable levels, there is usually a return to pretreatment levels if the drug is stopped.

An important disadvantage of alum is the induction of a Th2- rather than a Th1-type immune response. In the case of recombinant HBsAg, the use of alum as an adjuvant appears to interfere with cell-mediated immunity and blocks activation of CD8+ CTL (29). In contrast, our studies show that CpG ODN induces strong Th1-type immune responses to HBsAg and can even overcome the Th2 bias of alum for both Ab isotype and CTL response when the two agents are used together. Thus it is possible to induce strong humoral responses, owing to synergistic action of the alum and CpG ODN, while still permitting CTL.

The Th1 effect of CpG DNA may also be relevant to asthma, an immune-mediated inflammatory disease characterized by Th2 immune responses to innocuous, inhaled environmental Ags. The much higher prevalence of asthma in developed nations has been linked to the high hygiene level and rapid treatment of childhood infections (30). We hypothesize that early exposure to bacterial DNA (and its Th1-immunostimulatory CpG motifs) would push the immune system away from Th2- and toward a Th1-type response to environmental Ags. This may account for the lower incidence of asthma in less developed countries, where there is a much higher frequency of childhood upper respiratory infections. Addition of CpG ODN to all pediatric vaccines could re-establish a Th1-type response to environmental Ags. Indeed, we have recently found that CpG ODN are effective at preventing and treating asthma in a mouse model.4

Phosphorothioate-modified ODN can be easily produced on a large scale under Good Manufacturing Practices conditions at a cost of approximately $200/g. In antisense studies, ODN have been found to be safe when administered at doses above 100 mg/kg, which is several orders of magnitude over the dose of 10 µg used herein (0.36 mg/kg). It is noteworthy that human clinical trials have reached continuous daily doses of up to 4 mg/kg without apparent drug-related toxicity (31, 32). Moreover, in other studies we and others have demonstrated that human cells also show immune activation in response to CpG DNA (10, 33). Together, these factors suggest that CpG ODN could be safe, effective, and economical replacements or supplements for alum in human and animal vaccine formulations.


    Acknowledgments
 
We thank Darlene Anderson, Debbie Campbell, Laurie Love-Homan, and Yong Yuan Zhang for technical assistance and Teresa Duling for expert operation of the flow cytometer.


    Footnotes
 
1 This research was supported in part by an operating grant from the Medical Research Council (Canada) to H.L.D., from the National Institutes of Health (RO 1 AI31265) to T.J.W., and from the Department of Veteran Affairs (USA), University of Iowa Diabetes and Endocrine Research Center (National Institutes of Health DK25295), and National Institutes of Health (R29AR42556 and PO1 CA665070) to A.M.K. H.L.D. is the recipient of a Career Scientist Award from the Ontario Ministry of Health. Back

2 Address correspondence and reprint requests to Dr. Heather L. Davis, Loeb Research Institute, Ottawa Civic Hospital, 725 Parkdale Avenue, Ottawa, ON, Canada K1Y 4E9. E-mail address: Back

3 Abbreviations used in this paper: ODN, oligodeoxynucleotides; alum, aluminum hydroxide (Al2O3); HBsAG, hepatitis B surface Ag; HBV, hepatitis B virus; MFI, mean fluorescence intensity. Back

4 J. N. Kline, T. R. Businga, T. J. Waldschmidt, J. V. Weinstock, and A. M. Krieg. 1997. Modulation of the asthmatic response by CpG oligodeoxynucleotides. Submitted for publication. Back

Received for publication June 13, 1997. Accepted for publication October 1, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Tokunaga, T., H. Yamamoto, S. Shimada, H. Abe, T. Fukuda, Y. Fujisawa, Y. Furutani, O. Yano, T. Kataoka, T. Sudo, N. Makiguchi, T. Suganuma. 1984. Antitumor activity of deoxyribonucleic acid fraction from mycobacterium bovis GCG. I. Isolation, physicochemical characterization, and antitumor activity. J. Natl. Cancer Inst. 72:955.
  2. Messina, J. P., G. S. Gilkeson, D. S. Pisetsky. 1991. Stimulation of in vitro murine lymphocyte proliferation by bacterial DNA. J. Immunol. 147:1759.[Abstract]
  3. Krieg, A. K., A.-K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. Koretzky, D. Klinman. 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374:546.[Medline]
  4. Bird, A. P.. 1987. CpG islands as gene markers in the vertebrate nucleus. Trends Genet. 3:342.
  5. Krieg, A. M.. 1996. An innate immune defense mechanism based on the recognition of CpG motifs in microbial DNA. J. Lab. Clin. Med. 128:128.[Medline]
  6. Klinman, D., A.-K. Yi, S. L. Beaucage, J. Conover, A. M. Krieg. 1996. CpG motifs expressed by bacterial DNA rapidly induce lymphocytes to secrete IL-6, IL-12 and IFN. Proc. Natl. Acad. Sci. USA 93:2879.[Abstract/Free Full Text]
  7. Halpern, M. D., R. J. Kurlander, D. S. Pisetsky. 1996. Bacterial DNA induces murine interferon-{gamma} production by stimulation of interleukin-12 and tumor necrosis factor-{alpha}. Cell. Immunol. 167:72.[Medline]
  8. Cowdery, J. S., J. H. Chace, A. M. Krieg. 1996. Bacterial DNA induces in vivo interferon-{gamma} production by NK cells and increases sensitivity to endotoxin. J. Immunol. 156:4570.[Abstract]
  9. Yamamoto, S., T. Yamamoto, S. Shimada, E. Kuramoto, O. Yano, T. Kataoka, T. Tokunaga. 1992. DNA from bacteria, but not from vertebrates, induces interferons, activates natural killer cells and inhibits tumor growth. Microbiol. Immunol. 36:983.[Medline]
  10. Ballas, Z. K., W. L. Rasmussen, A. M. Krieg. 1996. Induction of natural killer activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J. Immunol. 157:1840.[Abstract]
  11. Chace, J. H., N. A. Hooker, K. L. Mildenstein, A. M. Krieg, J. S. Cowdery. 1997. Bacterial DNA-induced NK cell IFN-{gamma} production is dependent on macrophage secretion of IL-12. Clin. Immunol. Immunopath. 84:185.[Medline]
  12. Yi, A.-K., J. S. Cowdery, J. H. Chace, A. M. Krieg. 1996. IFN-{gamma} promotes IL-6 and Ig-M secretion in response to CpG motifs in bacterial DNA and ODN. J. Immunol. 156:558.[Abstract]
  13. Zhao, Q., S. Matson, C. J. Herrara, E. Fisher, H. Yu, A. Waggoner, A. M. Krieg. 1993. Comparison of cellular binding and uptake of antisense phosphodiester, phosphorothioate, and mixed phosphorothioate and methylphosphonate oligonucleotides. Antisense Res. Dev. 3:53.[Medline]
  14. Michel, M. L., H. L. Davis, M. Schleef, M. Mancini, P. Tiollais, R. G. Whalen. 1995. DNA-mediated immunization to the hepatitis B surface antigen in mice: aspects of the humoral response mimic hepatitis B viral infection in humans. Proc. Natl. Acad. Sci. USA 92:5307.[Abstract/Free Full Text]
  15. Davis, H. L., M. Mancini, M.-L. Michel, R. G. Whalen. 1996. DNA-mediated immunization to hepatitis B surface antigen: longevity of primary response and effect of boost. Vaccine 14:910.[Medline]
  16. Stavnezer, J.. 1996. Antibody class switching. Adv. Immunol. 61:79.[Medline]
  17. Yi, A.-K., P. Hornbeck, D. E. Lafrenz, A. M. Krieg. 1996. CpG DNA rescue of murine B lymphoma cells from anti-IgM-induced growth arrest and programmed cell death is associated with increased expression of c-myc and bcl-xL. J. Immunol. 157:4918.[Abstract]
  18. Yi, A.-K., D. M. Klinman, T. L. Martin, S. Matson, A. M. Krieg. 1996. Rapid immune activation by CpG motifs in bacterial DNA: systemic induction of IL-6 transcription through an antioxidant-sensitive pathway. J. Immunol. 157:5394.[Abstract]
  19. Monteith, D. K., S. P. Henry, R. B. Howard, S. Flournoy, A. A. Levin, C. F. Bennett, S. T. Crooke. 1997. Immune stimulation: a class effect of phosphorothioate oligodeoxynucleotides in rodents. Anticancer Drug Des. 12:421.[Medline]
  20. Coffman, R. L., J. Ohara, M. W. Bond, J. Carty, A. Zlotnik, W. E. Paul. 1986. B cell stimulatory factor-1 enhances the IgE response of lipopolysaccharide-activated B cells. J. Immunol. 136:4538.[Abstract]
  21. Snapper, C. M., W. E. Paul. 1987. B cell stimulatory factor-1 (interleukin 4) prepares resting murine B cells to secrete IgG1 upon subsequent stimulation with bacterial lipopolysaccharide. J. Immunol. 139:10.[Abstract]
  22. Rothman, P., S. Lutzker, W. Cook, R. Coffman, F. W. Alt. 1988. Mitogen plus interleukin 4 induction of C{epsilon} transcripts in B lymphoid cells. J. Exp. Med. 168:2385.[Abstract/Free Full Text]
  23. Berton, M. T., J. W. Uhr, E. S. Vitetta. 1989. Synthesis of germ-line g1 immunoglobulin heavy-chain transcripts in resting B cells: induction by interleukin 4 and inhibition by interferon {gamma}. Proc. Natl. Acad. Sci. USA 86:2829.[Abstract/Free Full Text]
  24. Collins, J. T., W. A. Dunnick. 1993. Germline transcripts of the murine immunoglobulin g2a gene: structure and induction by IFN-{gamma}. Int. Immunol. 5:885.[Abstract/Free Full Text]
  25. Rehermann, B., C. Ferrari, C. Pasquinelli, F. V. Chisari. 1996. The hepatitis B virus persists for decades after patient’s recovery from acute viral hepatitis despite active maintenance of cytotoxic T-lymphocyte response. Nat. Med. 2:1104.[Medline]
  26. R. W. Ellis, ed. Hepatitis B Vaccines in Clinical Practice 1993 Marcel Dekker, Inc, New York.
  27. Pol, S., F. Driss, M.-L. Michel, B. Nalpas, P. Berthelot, C. Brechot. 1994. Specific vaccine therapy in chronic hepatitis B infection. Lancet 334:342.
  28. Niederau, C., T. Heintges, S. Lange, G. Goldmann, C. M. Niederau, L. Mohr, D. Haussinger. 1996. Long-term follow-up of HBeAg-positive patients treated with interferon alpha for chronic hepatitis B. N. Engl. J. Med. 334:1422.[Abstract/Free Full Text]
  29. Schirmbeck, R., K. Melber, A. Kuhrber, Z. A. Janowicz, J. Reimann. 1994. Immunization with soluble hepatitis B virus surface protein elicits murine H-2 class I-restricted CD8+ cytotoxic T lymphocyte responses in vivo. J. Immunol. 152:1110.[Abstract]
  30. Cookson, W. O. C. M., M. F. Moffatt. 1997. Asthma: an epidemic in the absence of infection?. Science 275:41.[Free Full Text]
  31. Agrawal, S.. 1996. Antisense oligonucleotides: towards clinical trials. Trends Biotech. 14:376.[Medline]
  32. Crooke, S. T.. 1996. Progress in antisense therapeutics. Med. Res. Rev. 16:319.[Medline]
  33. Liang, H., Y. Nishioka, C. F. Reich, D. S. Pisetsky, P. E. Lipsky. 1996. Activation of human B cells by phosphorothioate oligodeoxynucleotides. J. Clin. Invest. 98:1119.[Medline]



This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
J. Kovacs-Nolan, J. W. Mapletoft, Z. Lawman, L. A. Babiuk, and S. van Drunen Littel-van den Hurk
Formulation of bovine respiratory syncytial virus fusion protein with CpG oligodeoxynucleotide, cationic host defence peptide and polyphosphazene enhances humoral and cellular responses and induces a protective type 1 immune response in mice
J. Gen. Virol., August 1, 2009; 90(8): 1892 - 1905.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
H. Suzuki, Y. Suzuki, I. Narita, M. Aizawa, M. Kihara, T. Yamanaka, T. Kanou, H. Tsukaguchi, J. Novak, S. Horikoshi, et al.
Toll-Like Receptor 9 Affects Severity of IgA Nephropathy
J. Am. Soc. Nephrol., December 1, 2008; 19(12): 2384 - 2395.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
J. Sun, X. Song, and S. Hu
Ginsenoside Rg1 and Aluminum Hydroxide Synergistically Promote Immune Responses to Ovalbumin in BALB/c Mice
Clin. Vaccine Immunol., February 1, 2008; 15(2): 303 - 307.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
J. W. Mapletoft, M. Oumouna, J. Kovacs-Nolan, L. Latimer, G. Mutwiri, L. A. Babiuk, and S. van Drunen Littel-van den Hurk
Intranasal immunization of mice with a formalin-inactivated bovine respiratory syncytial virus vaccine co-formulated with CpG oligodeoxynucleotides and polyphosphazenes results in enhanced protection
J. Gen. Virol., January 1, 2008; 89(1): 250 - 260.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Merlo, C. Calcaterra, S. Menard, and A. Balsari
Cross-talk between Toll-like receptors 5 and 9 on activation of human immune responses
J. Leukoc. Biol., September 1, 2007; 82(3): 509 - 518.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
A. M. Krieg
Antiinfective Applications of Toll-like Receptor 9 Agonists
Proceedings of the ATS, July 1, 2007; 4(3): 289 - 294.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
D. S. Spinner, R. B. Kascsak, G. LaFauci, H. C. Meeker, X. Ye, M. J. Flory, J. I. Kim, G. B. Schuller-Levis, W. R. Levis, T. Wisniewski, et al.
CpG oligodeoxynucleotide-enhanced humoral immune response and production of antibodies to prion protein PrPSc in mice immunized with 139A scrapie-associated fibrils
J. Leukoc. Biol., June 1, 2007; 81(6): 1374 - 1385.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. H. Bae, Y.-J. Park, J.-B. Park, Y. S. Choi, M. S. Kim, and J.-I. Sin
Therapeutic Synergy of Human Papillomavirus E7 Subunit Vaccines plus Cisplatin in an Animal Tumor Model: Causal Involvement of Increased Sensitivity of Cisplatin-Treated Tumors to CTL-Mediated Killing in Therapeutic Synergy
Clin. Cancer Res., January 1, 2007; 13(1): 341 - 349.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
R. Liang, J. V. van den Hurk, L. A. Babiuk, and S. van Drunen Littel-van den Hurk
Priming with DNA encoding E2 and boosting with E2 protein formulated with CpG oligodeoxynucleotides induces strong immune responses and protection from Bovine viral diarrhea virus in cattle.
J. Gen. Virol., October 1, 2006; 87(Pt 10): 2971 - 2982.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. P. Sester, K. Brion, A. Trieu, H. S. Goodridge, T. L. Roberts, J. Dunn, D. A. Hume, K. J. Stacey, and M. J. Sweet
CpG DNA Activates Survival in Murine Macrophages through TLR9 and the Phosphatidylinositol 3-Kinase-Akt Pathway
J. Immunol., October 1, 2006; 177(7): 4473 - 4480.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. M. Giuliani, J. Adu-Bobie, M. Comanducci, B. Arico, S. Savino, L. Santini, B. Brunelli, S. Bambini, A. Biolchi, B. Capecchi, et al.
Inaugural Article: A universal vaccine for serogroup B meningococcus
PNAS, July 18, 2006; 103(29): 10834 - 10839.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
X. Wu, W. Hou, S. Sun, E. Bi, Y. Wang, M. Shi, J. Zang, C. Dong, and B. Sun
Novel Function of IFN-{gamma}: Negative Regulation of Dendritic Cell Migration and T Cell Priming
J. Immunol., July 15, 2006; 177(2): 934 - 943.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
W.-P. Woo, T. Doan, K. A. Herd, H.-J. Netter, and R. W. Tindle
Hepatitis B surface antigen vector delivers protective cytotoxic T-lymphocyte responses to disease-relevant foreign epitopes.
J. Virol., April 1, 2006; 80(8): 3975 - 3984.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
H. Yu, H. Huang, J. Xiang, L. A. Babiuk, and S. van Drunen Littel-van den Hurk
Dendritic cells pulsed with hepatitis C virus NS3 protein induce immune responses and protection from infection with recombinant vaccinia virus expressing NS3
J. Gen. Virol., January 1, 2006; 87(1): 1 - 10.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
C. P. A. Ivory, K. Keller, and K. Chadee
CpG-Oligodeoxynucleotide Is a Potent Adjuvant with an Entamoeba histolytica Gal-Inhibitable Lectin Vaccine against Amoebic Liver Abscess in Gerbils
Infect. Immun., January 1, 2006; 74(1): 528 - 536.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. J. Wettstein, N. D. Borson, J. G. Park, K. T. McNallan, and A. M. Reed
Cysteine-Tailed Class I-Binding Peptides Bind to CpG Adjuvant and Enhance Primary CTL Responses
J. Immunol., September 15, 2005; 175(6): 3681 - 3689.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Radhakrishnan, E. Celis, and L. R. Pease
B7-DC cross-linking restores antigen uptake and augments antigen-presenting cell function by matured dendritic cells
PNAS, August 9, 2005; 102(32): 11438 - 11443.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Matsumoto, M. Matsumoto, K. Umemori, Y. Ozeki, M. Furugen, T. Tatsuo, Y. Hirayama, S. Yamamoto, T. Yamada, and K. Kobayashi
DNA Augments Antigenicity of Mycobacterial DNA-Binding Protein 1 and Confers Protection against Mycobacterium tuberculosis Infection in Mice
J. Immunol., July 1, 2005; 175(1): 441 - 449.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Oumouna, J. W. Mapletoft, B. C. Karvonen, L. A. Babiuk, and S. van Drunen Littel-van den Hurk
Formulation with CpG Oligodeoxynucleotides Prevents Induction of Pulmonary Immunopathology following Priming with Formalin-Inactivated or Commercial Killed Bovine Respiratory Syncytial Virus Vaccine
J. Virol., February 15, 2005; 79(4): 2024 - 2032.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
H. Xie, I. Gursel, B. E. Ivins, M. Singh, D. T. O'Hagan, J. B. Ulmer, and D. M. Klinman
CpG Oligodeoxynucleotides Adsorbed onto Polylactide-Co-Glycolide Microparticles Improve the Immunogenicity and Protective Activity of the Licensed Anthrax Vaccine
Infect. Immun., February 1, 2005; 73(2): 828 - 833.
[Abstract] [Full Text] [PDF]


Home page
Clin. Microbiol. Rev.Home page
R. A. Cox and D. M. Magee
Coccidioidomycosis: Host Response and Vaccine Development
Clin. Microbiol. Rev., October 1, 2004; 17(4): 804 - 839.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
H. Yu, L. A. Babiuk, and S. van Drunen Littel-van den Hurk
Priming with CpG-enriched plasmid and boosting with protein formulated with CpG oligodeoxynucleotides and Quil A induces strong cellular and humoral immune responses to hepatitis C virus NS3
J. Gen. Virol., June 1, 2004; 85(6): 1533 - 1543.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
X. Jiao, R. Y.-H. Wang, Q. Qiu, H. J. Alter, and J. W.-K. Shih
Enhanced hepatitis C virus NS3 specific Th1 immune responses induced by co-delivery of protein antigen and CpG with cationic liposomes
J. Gen. Virol., June 1, 2004; 85(6): 1545 - 1553.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
H.-J. Anders, B. Banas, and D. Schlondorff
Signaling Danger: Toll-Like Receptors and their Potential Roles in Kidney Disease
J. Am. Soc. Nephrol., April 1, 2004; 15(4): 854 - 867.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
G. Lee, R. Thangavel, V. M. Sharma, J. M. Litersky, K. Bhaskar, S. M. Fang, L. H. Do, A. Andreadis, G. Van Hoesen, and H. Ksiezak-Reding
Phosphorylation of Tau by Fyn: Implications for Alzheimer's Disease
J. Neurosci., March 3, 2004; 24(9): 2304 - 2312.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. Kumar, T. R. Jones, M. S. Oakley, H. Zheng, S. P. Kuppusamy, A. Taye, A. M. Krieg, A. W. Stowers, D. C. Kaslow, and S. L. Hoffman
CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine
Infect. Immun., February 1, 2004; 72(2): 949 - 957.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Storni, C. Ruedl, K. Schwarz, R. A. Schwendener, W. A. Renner, and M. F. Bachmann
Nonmethylated CG Motifs Packaged into Virus-Like Particles Induce Protective Cytotoxic T Cell Responses in the Absence of Systemic Side Effects
J. Immunol., February 1, 2004; 172(3): 1777 - 1785.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
D. J. Lefeber, B. Benaissa-Trouw, J. F. G. Vliegenthart, J. P. Kamerling, W. T. M. Jansen, K. Kraaijeveld, and H. Snippe
Th1-Directing Adjuvants Increase the Immunogenicity of Oligosaccharide-Protein Conjugate Vaccines Related to Streptococcus pneumoniae Type 3
Infect. Immun., December 1, 2003; 71(12): 6915 - 6920.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Shao, S. Lei, S. L. Sun, J. Xiang, H. J. Kaplan, and D. Sun
CpG-Containing Oligodeoxynucleotide 1826 Converts the Weak Uveitogenic Rat Interphotoreceptor Retinoid-Binding Protein Peptide 1181-1191 into a Strong Uveitogen
J. Immunol., November 1, 2003; 171(9): 4780 - 4785.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
D. Loirat, M. Mancini-Bourgine, J.-P. Abastado, and M.-L. Michel
HBsAg/HLA-A2 transgenic mice: a model for T cell tolerance to hepatitis B surface antigen in chronic hepatitis B virus infection
Int. Immunol., October 1, 2003; 15(10): 1125 - 1136.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Elias, J. Flo, R. A. Lopez, J. Zorzopulos, A. Montaner, and J. M. Rodriguez
Strong Cytosine-Guanosine-Independent Immunostimulation in Humans and Other Primates by Synthetic Oligodeoxynucleotides with PyNTTTTGT Motifs
J. Immunol., October 1, 2003; 171(7): 3697 - 3704.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
Z. Su, M.-F. Tam, D. Jankovic, and M. M. Stevenson
Vaccination with Novel Immunostimulatory Adjuvants against Blood-Stage Malaria in Mice
Infect. Immun., September 1, 2003; 71(9): 5178 - 5187.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Kuchtey, M. Pennini, R. K. Pai, and C. V. Harding
CpG DNA Induces a Class II Transactivator-Independent Increase in Class II MHC by Stabilizing Class II MHC mRNA in B Lymphocytes
J. Immunol., September 1, 2003; 171(5): 2320 - 2325.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Tritel, A. M. Stoddard, B. J. Flynn, P. A. Darrah, C.-y. Wu, U. Wille, J. A. Shah, Y. Huang, L. Xu, M. R. Betts, et al.
Prime-Boost Vaccination with HIV-1 Gag Protein and Cytosine Phosphate Guanosine Oligodeoxynucleotide, Followed by Adenovirus, Induces Sustained and Robust Humoral and Cellular Immune Responses
J. Immunol., September 1, 2003; 171(5): 2538 - 2547.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. Davila, R. Kennedy, and E. Celis
Generation of Antitumor Immunity by Cytotoxic T Lymphocyte Epitope Peptide Vaccination, CpG-oligodeoxynucleotide Adjuvant, and CTLA-4 Blockade
Cancer Res., June 15, 2003; 63(12): 3281 - 3288.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S.-M. Kang and R. W. Compans
Enhancement of Mucosal Immunization with Virus-Like Particles of Simian Immunodeficiency Virus
J. Virol., March 15, 2003; 77(6): 3615 - 3623.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T.-Y. Kim, H.-J. Myoung, J.-H. Kim, I.-S. Moon, T.-G. Kim, W.-S. Ahn, and J.-I. Sin
Both E7 and CpG-Oligodeoxynucleotide Are Required for Protective Immunity against Challenge with Human Papillomavirus 16 (E6/E7) Immortalized Tumor Cells: Involvement of CD4+ and CD8+ T Cells in Protection
Cancer Res., December 15, 2002; 62(24): 7234 - 7240.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. La Rosa, Z. Wang, J. C. Brewer, S. F. Lacey, M. C. Villacres, R. Sharan, R. Krishnan, M. Crooks, S. Markel, R. Maas, et al.
Preclinical development of an adjuvant-free peptide vaccine with activity against CMV pp65 in HLA transgenic mice
Blood, November 15, 2002; 100(10): 3681 - 3689.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
Q. He, A. Mitchell, T. Morcol, and S. J. D. Bell
Calcium Phosphate Nanoparticles Induce Mucosal Immunity and Protection against Herpes Simplex Virus Type 2
Clin. Vaccine Immunol., September 1, 2002; 9(5): 1021 - 1024.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Jung, A.-K. Yi, X. Zhang, J. Choe, L. Li, and Y. S. Choi
Distinct Response of Human B Cell Subpopulations in Recognition of an Innate Immune Signal, CpG DNA
J. Immunol., September 1, 2002; 169(5): 2368 - 2373.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
X. P. Ioannou, P. Griebel, R. Hecker, L. A. Babiuk, and S. van Drunen Littel-van den Hurk
The Immunogenicity and Protective Efficacy of Bovine Herpesvirus 1 Glycoprotein D plus Emulsigen Are Increased by Formulation with CpG Oligodeoxynucleotides
J. Virol., August 12, 2002; 76(18): 9002 - 9010.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Sfondrini, D. Besusso, M. T. Zoia, M. Rodolfo, A. M. Invernizzi, M. Taniguchi, T. Nakayama, M. P. Colombo, S. Menard, and A. Balsari
Absence of the CD1 Molecule Up-Regulates Antitumor Activity Induced by CpG Oligodeoxynucleotides in Mice
J. Immunol., July 1, 2002; 169(1): 151 - 158.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Zheng, D. M. Klinman, M. Gierynska, and B. T. Rouse
DNA containing CpG motifs induces angiogenesis
PNAS, June 25, 2002; 99(13): 8944 - 8949.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. J. Cho, T. Hayashi, S. K. Datta, K. Takabayashi, J. H. Van Uden, A. Horner, M. Corr, and E. Raz
IFN-{alpha}{beta} Promote Priming of Antigen-Specific CD8+ and CD4+ T Lymphocytes by Immunostimulatory DNA-Based Vaccines
J. Immunol., May 15, 2002; 168(10): 4907 - 4913.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Andreae, F. Piras, N. Burdin, and F. Triebel
Maturation and Activation of Dendritic Cells Induced by Lymphocyte Activation Gene-3 (CD223)
J. Immunol., April 15, 2002; 168(8): 3874 - 3880.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Verthelyi, R. T. Kenney, R. A. Seder, A. A. Gam, B. Friedag, and D. M. Klinman
CpG Oligodeoxynucleotides as Vaccine Adjuvants in Primates
J. Immunol., February 15, 2002; 168(4): 1659 - 1663.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
K. A. Near, A. W. Stowers, D. Jankovic, and D. C. Kaslow
Improved Immunogenicity and Efficacy of the Recombinant 19-Kilodalton Merozoite Surface Protein 1 by the Addition of Oligodeoxynucleotide and Aluminum Hydroxide Gel in a Murine Malaria Vaccine Model
Infect. Immun., February 1, 2002; 70(2): 692 - 701.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. Miconnet, S. Koenig, D. Speiser, A. Krieg, P. Guillaume, J.-C. Cerottini, and P. Romero
CpG Are Efficient Adjuvants for Specific CTL Induction Against Tumor Antigen-Derived Peptide
J. Immunol., February 1, 2002; 168(3): 1212 - 1218.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
H. Renz and U. Herz
The bidirectional capacity of bacterial antigens to modulate allergy and asthma
Eur. Respir. J., January 1, 2002; 19(1): 158 - 171.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
N. P. Juffermans, J. C. Leemans, S. Florquin, A. Verbon, A. H. Kolk, P. Speelman, S. J. H. van Deventer, and T. van der Poll
CpG Oligodeoxynucleotides Enhance Host Defense during Murine Tuberculosis
Infect. Immun., January 1, 2002; 70(1): 147 - 152.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Z. K. Ballas, A. M. Krieg, T. Warren, W. Rasmussen, H. L. Davis, M. Waldschmidt, and G. J. Weiner
Divergent Therapeutic and Immunologic Effects of Oligodeoxynucleotides with Distinct CpG Motifs
J. Immunol., November 1, 2001; 167(9): 4878 - 4886.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. Gursel, M. Gursel, K. J. Ishii, and D. M. Klinman
Sterically Stabilized Cationic Liposomes Improve the Uptake and Immunostimulatory Activity of CpG Oligonucleotides
J. Immunol., September 15, 2001; 167(6): 3324 - 3328.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
F.-G. Zhu and D. S. Pisetsky
Role of the Heat Shock Protein 90 in Immune Response Stimulation by Bacterial DNA and Synthetic Oligonucleotides
Infect. Immun., September 1, 2001; 69(9): 5546 - 5552.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. H. Baek, S. J. Ha, and Y. C. Sung
A Novel Function of Phosphorothioate Oligodeoxynucleotides as Chemoattractants for Primary Macrophages
J. Immunol., September 1, 2001; 167(5): 2847 - 2854.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
Y. Chen, J. Zhang, S. A. Moore, Z. K. Ballas, J. P. Portanova, A. M. Krieg, and D. J. Berg
CpG DNA induces cyclooxygenase-2 expression and prostaglandin production
Int. Immunol., August 1, 2001; 13(8): 1013 - 1020.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. A. Horner, S. K. Datta, K. Takabayashi, I. M. Belyakov, T. Hayashi, N. Cinman, M.-D. Nguyen, J. H. Van Uden, J. A. Berzofsky, D. D. Richman, et al.
Immunostimulatory DNA-Based Vaccines Elicit Multifaceted Immune Responses Against HIV at Systemic and Mucosal Sites
J. Immunol., August 1, 2001; 167(3): 1584 - 1591.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. Malanchere-Bres, P. J. Payette, M. Mancini, P. Tiollais, H. L. Davis, and M.-L. Michel
CpG Oligodeoxynucleotides with Hepatitis B Surface Antigen (HBsAg) for Vaccination in HBsAg-Transgenic Mice
J. Virol., July 15, 2001; 75(14): 6482 - 6491.
[Abstract] [Full Text]


Home page
J. Nutr.Home page
H. Jyonouchi, S. Sun, T. Winship, and M. J. Kuchan
Dietary Ribonucleotides Modulate Type 1 and Type 2 T-Helper Cell Responses against Ovalbumin in Young BALB/cJ Mice
J. Nutr., April 1, 2001; 131(4): 1165 - 1170.
[Abstract] [Full Text]


Home page
Infect. Immun.Home page
R. A. Gramzinski, D. L. Doolan, M. Sedegah, H. L. Davis, A. M. Krieg, and S. L. Hoffman
Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice
Infect. Immun., March 1, 2001; 69(3): 1643 - 1649.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W. S. Gallichan, R. N. Woolstencroft, T. Guarasci, M. J. McCluskie, H. L. Davis, and K. L. Rosenthal
Intranasal Immunization with CpG Oligodeoxynucleotides as an Adjuvant Dramatically Increases IgA and Protection Against Herpes Simplex Virus-2 in the Genital Tract
J. Immunol., March 1, 2001; 166(5): 3451 - 3457.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
B. Jahrsdörfer, G. Hartmann, E. Racila, W. Jackson, L. Mühlenhoff, G. Meinhardt, S. Endres, B. K. Link, A. M. Krieg, and G. J. Weiner
CpG DNA increases primary malignant B cell expression of costimulatory molecules and target antigens
J. Leukoc. Biol., January 1, 2001; 69(1): 81 - 88.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
D. Askew, R. S. Chu, A. M. Krieg, and C. V. Harding
CpG DNA Induces Maturation of Dendritic Cells with Distinct Effects on Nascent and Recycling MHC-II Antigen-Processing Mechanisms
J. Immunol., December 15, 2000; 165(12): 6889 - 6895.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. L. Warren, S. K. Bhatia, A. M. Acosta, C. E. Dahle, T. L. Ratliff, A. M. Krieg, and G. J. Weiner
APC Stimulated by CpG Oligodeoxynucleotide Enhance Activation of MHC Class I-Restricted T Cells
J. Immunol., December 1, 2000; 165(11): 6244 - 6251.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. M. Leutenegger, F. S. Boretti, C. N. Mislin, J. N. Flynn, M. Schroff, A. Habel, C. Junghans, S. A. Koenig-Merediz, B. Sigrist, A. Aubert, et al.
Immunization of Cats against Feline Immunodeficiency Virus (FIV) Infection by Using Minimalistic Immunogenic Defined Gene Expression Vector Vaccines Expressing FIV gp140 Alone or with Feline Interleukin-12 (IL-12), IL-16, or a CpG Motif
J. Virol., November 15, 2000; 74(22): 10447 - 10457.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
D. P. Sester, S. Naik, S. J. Beasley, D. A. Hume, and K. J. Stacey
Phosphorothioate Backbone Modification Modulates Macrophage Activation by CpG DNA
J. Immunol., October 15, 2000; 165(8): 4165 - 4173.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. J. Weiner
The immunobiology and clinical potential of immunostimulatory CpG oligodeoxynucleotides
J. Leukoc. Biol., October 1, 2000; 68(4): 455 - 463.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
S. W. Lee, M. K. Song, K. H. Baek, Y. Park, J. K. Kim, C. H. Lee, H.-K. Cheong, C. Cheong, and Y. C. Sung
Effects of a Hexameric Deoxyriboguanosine Run Conjugation into CpG Oligodeoxynucleotides on Their Immunostimulatory Potentials
J. Immunol., October 1, 2000; 165(7): 3631 - 3639.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
W. Olszewska, C. D. Partidos, and M. W. Steward
Antipeptide Antibody Responses following Intranasal Immunization: Effectiveness of Mucosal Adjuvants
Infect. Immun., September 1, 2000; 68(9): 4923 - 4929.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
T. Scharton-Kersten, J.-m. Yu, R. Vassell, D. O'Hagan, C. R. Alving, and G. M. Glenn
Transcutaneous Immunization with Bacterial ADP-Ribosylating Exotoxins, Subunits, and Unrelated Adjuvants
Infect. Immun., September 1, 2000; 68(9): 5306 - 5313.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
P. A. Johnson, M. A. Conway, J. Daly, C. Nicolson, J. Robertson, and K. H. G. Mills
Plasmid DNA encoding influenza virus haemagglutinin induces Th1 cells and protection against respiratory infection despite its limited ability to generate antibody responses
J. Gen. Virol., July 1, 2000; 81(7): 1737 - 1745.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
E. Davila and E. Celis
Repeated Administration of Cytosine-Phosphorothiolated Guanine-Containing Oligonucleotides Together with Peptide/Protein Immunization Results in Enhanced CTL Responses with Anti-Tumor Activity
J. Immunol., July 1, 2000; 165(1): 539 - 547.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
E. Ban, L. Dupre, E. Hermann, W. Rohn, C. Vendeville, B. Quatannens, P. Ricciardi-Castagnoli, A. Capron, and G. Riveau
CpG motifs induce Langerhans cell migration in vivo
Int. Immunol., June 1, 2000; 12(6): 737 - 745.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. F. Carpentier, J. Xie, K. Mokhtari, and J.-Y. Delattre
Successful Treatment of Intracranial Gliomas in Rat by Oligodeoxynucleotides Containing CpG Motifs
Clin. Cancer Res., June 1, 2000; 6(6): 2469 - 2473.
[Abstract] [Full Text]


Home page
JEMHome page
J. He, S. Gurunathan, A. Iwasaki, B. Ash-Shaheed, and B. L. Kelsall
Primary Role for GI Protein Signaling in the Regulation of Interleukin 12 Production and the Induction of T Helper Cell Type 1 Responses
J. Exp. Med., May 1, 2000; 191(9): 1605 - 1610.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Schirmbeck, J. Wild, D. Stober, H. E. Blum, F. V. Chisari, M. Geissler, and J. Reimann
Ongoing Murine T1 or T2 Immune Responses to the Hepatitis B Surface Antigen Are Excluded from the Liver that Expresses Transgene-Encoded Hepatitis B Surface Antigen
J. Immunol., April 15, 2000; 164(8): 4235 - 4243.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
R. S. Chu, T. McCool, N. S. Greenspan, J. R. Schreiber, and C. V. Harding
CpG Oligodeoxynucleotides Act as Adjuvants for Pneumococcal Polysaccharide-Protein Conjugate Vaccines and Enhance Antipolysaccharide Immunoglobulin G2a (IgG2a) and IgG3 Antibodies
Infect. Immun., March 1, 2000; 68(3): 1450 - 1456.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. M. Vabulas, H. Pircher, G. B. Lipford, H. Hacker, and H. Wagner
CpG-DNA Activates In Vivo T Cell Epitope Presenting Dendritic Cells to Trigger Protective Antiviral Cytotoxic T Cell Responses
J. Immunol., March 1, 2000; 164(5): 2372 - 2378.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Hartmann, R. D. Weeratna, Z. K. Ballas, P. Payette, S. Blackwell, I. Suparto, W. L. Rasmussen, M. Waldschmidt, D. Sajuthi, R. H. Purcell, et al.
Delineation of a CpG Phosphorothioate Oligodeoxynucleotide for Activating Primate Immune Responses In Vitro and In Vivo
J. Immunol., February 1, 2000; 164(3): 1617 - 1624.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Hartmann and A. M. Krieg
Mechanism and Function of a Newly Identified CpG DNA Motif in Human Primary B Cells
J. Immunol., January 15, 2000; 164(2): 944 - 953.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. G. Chiaramonte, M. Hesse, A. W. Cheever, and T. A. Wynn
CpG Oligonucleotides Can Prophylactically Immunize Against Th2-Mediated Schistosome Egg-Induced Pathology by an IL-12-Independent Mechanism
J. Immunol., January 15, 2000; 164(2): 973 - 985.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
L.-Y. Huang, A. M. Krieg, N. Eller, and D. E. Scott
Induction and Regulation of Th1-Inducing Cytokines by Bacterial DNA, Lipopolysaccharide, and Heat-Inactivated Bacteria
Infect. Immun., December 1, 1999; 67(12): 6257 - 6263.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
A.-K. Yi, D. W. Peckham, R. F. Ashman, and A. M. Krieg
CpG DNA rescues B cells from apoptosis by activating NF{kappa}B and preventing mitochondrial membrane potential disruption via a chloroquine-sensitive pathway
Int. Immunol., December 1, 1999; 11(12): 2015 - 2024.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. F. Carpentier, L. Chen, F. Maltonti, and J.-Y. Delattre
Oligodeoxynucleotides Containing CpG Motifs Can Induce Rejection of a Neuroblastoma in Mice
Cancer Res., November 1, 1999; 59(21): 5429 - 5432.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Lobell, R. Weissert, S. Eltayeb, C. Svanholm, T. Olsson, and H. Wigzell
Presence of CpG DNA and the Local Cytokine Milieu Determine the Efficacy of Suppressive DNA Vaccination in Experimental Autoimmune Encephalomyelitis
J. Immunol., November 1, 1999; 163(9): 4754 - 4762.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. J. Parks, J. L. Bramson, Y. Wan, C. L. Addison, and F. L. Graham
Effects of Stuffer DNA on Transgene Expression from Helper-Dependent Adenovirus Vectors
J. Virol., October 1, 1999; 73(10): 8027 - 8034.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Iho, T. Yamamoto, T. Takahashi, and S. Yamamoto
Oligodeoxynucleotides Containing Palindrome Sequences with Internal 5'-CpG-3' Act Directly on Human NK and Activated T Cells to Induce IFN-{gamma} Production In Vitro
J. Immunol., October 1, 1999; 163(7): 3642 - 3652.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Wild, M. J. Grusby, R. Schirmbeck, and J. Reimann
Priming MHC-I-Restricted Cytotoxic T Lymphocyte Responses to Exogenous Hepatitis B Surface Antigen Is CD4+ T Cell Dependent
J. Immunol., August 15, 1999; 163(4): 1880 - 1887.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. A. Calarota, A.-C. Leandersson, G. Bratt, J. Hinkula, D. M. Klinman, K. J. Weinhold, E. Sandstrom, and B. Wahren
Immune Responses in Asymptomatic HIV-1-Infected Patients After HIV-DNA Immunization Followed by Highly Active Antiretroviral Treatment
J. Immunol., August 15, 1999; 163(4): 2330 - 2338.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. Hartmann, G. J. Weiner, and A. M. Krieg
CpG DNA: A potent signal for growth, activation, and maturation of human dendritic cells
PNAS, August 3, 1999; 96(16): 9305 - 9310.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
K. J. Stacey and J. M. Blackwell
Immunostimulatory DNA as an Adjuvant in Vaccination against Leishmania major
Infect. Immun., August 1, 1999; 67(8): 3719 - 3726.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. M. Rodrigues, M. Ribeirao, V. Pereira-Chioccola, L. Renia, and F. Costa
Predominance of CD4 Th1 and CD8 Tc1 Cells Revealed by Characterization of the Cellular Immune Response Generated by Immunization with a DNA Vaccine Containing a Trypanosoma cruzi Gene
Infect. Immun., August 1, 1999; 67(8): 3855 - 3863.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. S. Chu, D. Askew, E. H. Noss, A. Tobian, A. M. Krieg, and C. V. Harding
CpG Oligodeoxynucleotides Down-Regulate Macrophage Class II MHC Antigen Processing
J. Immunol., August 1, 1999; 163(3): 1188 - 1194.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
R. Schirmbeck, K. Melber, and J. Reimann
Adjuvants that enhance priming of cytotoxic T cells to a Kb-restricted epitope processed from exogenous but not endogenous hepatitis B surface antigen
Int. Immunol., July 1, 1999; 11(7): 1093 - 1102.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. A. Schwartz, C. L. Wohlford-Lenane, T. J. Quinn, and A. M. Krieg
Bacterial DNA or Oligonucleotides Containing Unmethylated CpG Motifs Can Minimize Lipopolysaccharide-Induced Inflammation in the Lower Respiratory Tract Through an IL-12-Dependent Pathway
J. Immunol., July 1, 1999; 163(1): 224 - 231.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
K. Bachmaier, N. Neu, L. M. de la Maza, S. Pal, A. Hessel, and J. M. Penninger
Chlamydia Infections and Heart Disease Linked Through Antigenic Mimicry
Science, February 26, 1999; 283(5406): 1335 - 1339.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
J. Kovarik, P. Bozzotti, L. Love-Homan, M. Pihlgren, H. L. Davis, P.-H. Lambert, A. M. Krieg, and C.-A. Siegrist
CpG Oligodeoxynucleotides Can Circumvent the Th2 Polarization of Neonatal Responses to Vaccines But May Fail to Fully Redirect Th2 Responses Established by Neonatal Priming
J. Immunol., February 1, 1999; 162(3): 1611 - 1617.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. L. B. Millan, R. Weeratna, A. M. Krieg, C.-A. Siegrist, and H. L. Davis
CpG DNA can induce strong Th1 humoral and cell-mediated immune responses against hepatitis B surface antigen in young mice
PNAS, December 22, 1998; 95(26): 15553 - 15558.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
S. Sun, X. Zhang, D. F. Tough, and J. Sprent
Type I Interferon-mediated Stimulation of T Cells by CpG DNA
J. Exp. Med., December 21, 1998; 188(12): 2335 - 2342.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H.-M. Liu, S. E. Newbrough, S. K. Bhatia, C. E. Dahle, A. M. Krieg, and G. J. Weiner
Immunostimulatory CpG Oligodeoxynucleotides Enhance the Immune Response to Vaccine Strategies Involving Granulocyte-Macrophage Colony-Stimulating Factor
Blood, November 15, 1998; 92(10): 3730 - 3736.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Davis, H. L.
Right arrow Articles by Krieg, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Davis, H. L.
Right arrow Articles by Krieg, A. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS