|
|
||||||||



*
Loeb Research Institute, Ottawa Civic Hospital, Ottawa Canada;
Faculties of Health Sciences and Medicine, University of Ottawa, Canada;
Interdisciplinary Immunology Program and Department of Pathology, University of Iowa College of Medicine, Iowa City, IA 52242;
§
Qiagen GmbH, Hilden, Germany; and
¶
Interdisciplinary Immunology Program and Department of Internal Medicine, University of Iowa College of Medicine, Iowa City, IA, 52242 and Veterans Affairs Medical Center, Iowa City, IA 52246.
| Abstract |
|---|
|
|
|---|
secretion in vivo and in vitro. The potent immune
activation by CpG ODN suggests possible utility for enhancing immune
responses to vaccines. Mice immunized with recombinant hepatitis B
virus surface Ag and a CpG ODN as an immune enhancer have titers of Abs
against HBsAg (anti-HBs) that are five times higher than those of
mice immunized with HBsAg and the standard adjuvant, aluminum hydroxide
(alum). Ab titers in mice immunized with HBsAg and both CpG ODN plus
alum were 35 times higher than the titers in mice immunized with alum
alone, indicating a strong synergistic interaction between the CpG ODN
and alum. ODN without CpG motifs had little or no immune-enhancing
activity at the doses used herein. Alum induces a Th2 humoral response
(mostly IgG1) and no CTL. In contrast, CpG ODN gives a strong Th1
response with predominantly IgG2a Abs and CTL, even when mixed with
alum. In vitro studies to determine possible mechanisms of CpG
immune-enhancing effects show that CpG ODN induce expression of
costimulatory molecules on Ag-presenting cells and drive B cell isotype
switching in the appropriate cytokine milieu. These studies demonstrate
that CpG ODN are promising new immune enhancers for vaccination
applications. | Introduction |
|---|
|
|
|---|
CpG DNA can induce proliferation of almost all (>95%) B
cells and triggers polyclonal Ig secretion. This B cell activation by
CpG DNA is T cell independent and Ag nonspecific. However, B cell
activation by low concentrations of CpG DNA has strong synergy with
signals delivered through the B cell Ag receptor for both B cell
proliferation and Ig secretion (3). In theory, this strong synergy
between the B cell signaling pathways triggered through the B cell Ag
receptor and by CpG DNA may promote Ag-immune responses. In addition to
its direct effects on B cells, CpG DNA also directly activates
monocytes, macrophages, and dendritic cells to secrete a variety of
cytokines, including high levels of IL-12 (6, 7, 8). These cytokines
stimulate NK cells to secrete IFN-
and have increased lytic activity
(6, 8, 9, 10, 11). It is noteworthy that although IFN-
inhibits LPS-induced
B cell activation, the IFN-
secreted in response to CpG DNA promotes
B cell activation and Ig secretion (12).
Overall, CpG DNA induces a Th1-like pattern of cytokine production
dominated by IL-12 and IFN-
with little secretion of Th2 cytokines
(6). Such a Th1 immune response is associated with the production of
predominantly IgG2a Abs, while Th2 responses are associated with the
production of IgG1 Abs.
The strong activating effects of CpG DNA on B cells, as well as the induction of cytokines that could have indirect effects on B cells via T-help pathways, suggest utility of CpG ODN as a vaccine enhancer. Here we test a CpG ODN alone, and in combination with alum, for its effects on the humoral and cellular responses against recombinant hepatitis B surface Ag (HBsAg) in mice. We show that a CpG ODN drives the production of higher levels of Ag-specific Abs (predominantly Th1) compared with alum and that there is a strong synergistic response when the ODN is used together with alum. We also demonstrate the ability of CpG ODN to induce costimulatory molecule expression in vitro and in vivo and to drive B cell isotype shifting in vitro, suggesting possible mechanisms for the enhancing effects.
| Materials and Methods |
|---|
|
|
|---|
ODN used herein were: 1745, TCCATGAGCTTCCTGAGTCT; 1911, TCCAGGACTTTCCTCAGGTT; 1982, TCCAGGACTTCTCTCAGGTT; 1983, TTTTTTTTTTTTTTTTTTTT; 1668, TCCATGACGTTCCTGATGCT; and 1826, TCCATGACGTTCCTGACGTT (CpG dinucleotides underlined for clarity). All ODN were synthesized with a nuclease-resistant phosphorothioate backbone by Oligos Etc. (Wilsonville, OR), The Na+ salts of the ODN were ethanol precipitated and then resuspended in 10 mM Tris (pH 7.0) 1 mM EDTA for storage at -20°C before dilution into saline for injection. LPS level in ODN was undetectable (less than 1 ng/mg) by Limulus assay (Whittaker Bioproducts, Walkersville, MD).
Immunization of mice against HBsAg
Immunization with HBsAg was conducted on 6- to 8-wk-old female BALB/c mice (Charles River, Montreal, QC, Canada). Each mouse received a single i.m. injection, into the left tibialis anterior muscle, of a solution containing 1 µg recombinant HBsAg (ay subtype) produced in yeast cells (Medix Biotech, Foster City, CA) in a total volume of 50 µl. Control groups (n = 10) received HBsAg in saline or with added Al2O3 (Alhydrogel "85," Superfos Biosector, Vedbaek, Denmark; 2.5 µl 2% Al2O3 per µg HBsAg to give 25 mg Al3+/mg HBsAg). Experimental groups (n = 5 or 10) received HBsAg plus 10, 100, or 500 µg of the indicated ODN. These experiments were performed with ODN in which the backbone was nuclease resistant (phosphorothioate) to improve cell uptake and in vivo stability (13). Some experimental groups received only CpG ODN while others received both CpG ODN plus alum (as above). All component solutions were added at the same time, mixed with a vortex, and left on ice for about 30 min before injection.
Evaluation of in vivo humoral response to HBsAg
Plasma was recovered from mice at various times after immunization as described previously (14). Abs specific to HBsAg were detected and quantified by end-point dilution ELISA assay (in triplicate) on samples from individual animals (15).
In brief, a solid phase of plasma-derived HBsAg particles (ay subtype, 100 µl of 1 µg/ml per well, overnight at room temperature) was used to capture anti-HBs Abs in the plasma (1 h at 37°C), which were then detected with horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG, IgM, IgG1, or IgG2a (1:4000 in PBS-Tween, 10% FBS; 100 µl/well; Southern Biotechnology Inc., Birmingham, AL), followed by o-phenylenediamine dihydrochloride solution (100 µl/well, 30 min at room temperature in the dark; Sigma, St. Louis, MO). End-point titers were defined as the highest plasma dilution that resulted in an absorbance value (OD 450) two times greater than that of nonimmune plasma with a cut-off value of 0.05.
For descriptive purposes, anti-HBs titers were expressed as group means ± SEM of individual animal values, which were themselves the average of triplicate assays. The statistical significance of differences between groups was determined from the means and SDs by Students t test (for 2 groups) or 1-factor ANOVA (for three or more groups). All statistical tests were performed using InStat (GraphPad Software, San Diego, CA).
Evaluation of CTL response
Spleens were recovered under sterile conditions from mice 12 to 16 wk after immunization with HBsAg alone or with CpG ODN and/or alum (n = 3/group). Single cell suspensions were prepared and suspended in RPMI 1640 (Life Technologies, Grand Island, NY) tissue culture medium supplemented with 10% FBS (Life Technologies) and penicillin-streptomycin solution (final concentrations of 1000 U/ml and 1 mg/ml respectively) (Sigma, Irvine, U.K.). Splenocytes (3 x 107) were cocultured with 1.5 x 106 syngeneic HBsAg-expressing stimulator cells (P815-preS, generously provided by F.V. Chisari, Scripps Institute, La Jolla, CA), which had been inactivated by irradiation (20,000 rad). The cultures were maintained for 5 days in 10 ml of media in upright 25 cm2 tissue culture flasks in a humidified atmosphere (5% CO2) at 37°C and then were harvested and washed in media. These effector cells were serially diluted and cultured with 5 x 103 51Cr-labeled HBsAg-expressing targets (P815S) or control target cells (P815) at 37°C in round-bottom 96-well microtiter plates, with each sample in triplicate. After 4 h of incubation, 100 µl of supernatant was removed for radiation (gamma) counting. The percent lysis was calculated as [(experimental release - spontaneous release)/(total release - spontaneous release)] x 100. Spontaneous release was determined by incubating target cells without effector cells, and total release was determined by adding 100 µl of 2% Triton X-100 to the target cells. The percent specific lysis was calculated as follows: % lysis with P815S cells - % lysis P815 cells.
In vivo ODN treatment and flow cytometric analysis
BALB/c mice were given a single i.p. dose (500 µg) of ODN
suspended in saline (0.15 M NaCl). At designated time points after
injection, mice were killed and spleen cells analyzed by flow
cytometry. Specifically, Ficoll-spun splenocytes were incubated with
conjugated Abs for 20 min at 4°C, followed by washing and incubation
with the FITC-avidin. In the first incubation, 15 µg of the
anti-Fc
RII Ab 2.4G2 and 10 µl of rat serum were added to
minimize nonspecific staining. Cells were stained with Cyanine
5.18-conjugated anti-B220 (6B2) and either biotin-conjugated
anti-MHC class II (M5/114), anti-B7.2 (GL1), or anti-Ly-6C
(15.1.1). Conjugated purified rat IgG (Jackson ImmunoResearch, West
Grove, PA) served as isotype controls. Stained cells were run on a dual
laser Becton Dickinson FACS 440 with a minimum of 3 x
104 cells collected per sample. The FACS 440 data were
analyzed using a VAX station 3200 computer equipped with DESK software
(kindly supplied by Wayne Moore, Stanford University, Stanford, CA).
Final graphic output was performed with Macintosh Canvas software
(Deneba Software, South Miami, FL).
Preparation and culture of purified B cells for isotype switch studies
Spleens were obtained from 6- to 8-wk-old female BALB/c mice or
BALB/c mice genetically lacking the IFN-
gene (The Jackson
Laboratory, Bar Harbor ME) that had been maintained under specific
pathogen-free conditions in the University of Iowa Animal Care
Facility. Splenocyte suspensions were treated with anti-Thy 1
(HO13.4) and baby rabbit complement to eliminate T cells, followed by
sedimentation through a discontinuous (50%/60%/70%/75%) Percoll
gradient. Dense B cells at the 70 to 75% Percoll interface were
collected, washed in balanced salt solution (BSS), and suspended in
complete medium consisting of RPMI 1640 with FBS (10%), penicillin
(100 unit/ml), streptomycin (100 unit/ml), L-glutamine
(2 mM), and 2-ME (0.05 mM). In selected experiments, T cell-depleted
splenic B cells were stained with Cyanine 5.18-conjugated anti-B220
(6B2) and FITC-conjugated anti-IgD (11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26) followed by sort
purification of the B220+IgD+ cells on a dual
laser Coulter Epics 753 (Hialeah, FL).
Percoll dense or sort-purified B cells were cultured in flat-bottom
96-well plates at 1 x 105 cells per well in 200 µl
of complete medium. Cultures were stimulated with 6 µg/ml of CpG or
non-CpG ODN alone or with either recombinant IL-4 (Peprotech, Rocky
Hill, NJ) at 1000 U/ml or IFN-
(kindly provided by Immunex Corp.,
Seattle, WA) at 20 or 100 U/ml as indicated. LPS
(Escherichia coli 0111:B4 LPS; Difco, Detroit MI) at
40 µg/ml served as positive control. Culture supernatants were
harvested after 6 days and assayed for Ig levels.
Isotype-specific Ig ELISA assays
Isotype specific ELISA assays were designed for the measurement
of total IgM, IgG1, IgG2a, and IgE from culture supernatants. For each
ELISA, 50 µl of culture supernatant was assayed and quantified based
on a standard curve. These ELISA utilized a biotinylated detection Ab
followed by alkaline phosphatase streptavidin (Zymed, San Francisco,
CA), and subsequent reaction with phosphatase substrate (Sigma Chemical
Co., St. Louis, MO). Capture and detection Abs for the various
isotype-specific ELISA were as follows: IgM, goat anti-mouse
µ-chain-specific Ab (capture) and monoclonal rat anti-mouse IgM
b-76 (detection); IgG1, goat anti-mouse
1 Ab (capture and
detection); IgG2a, goat anti-mouse
2a Ab (capture and
detection); IgE, monoclonal rat anti-mouse
-chain B1E3
(capture); and monoclonal rat anti-mouse
-chain EM95
(detection). All goat Ab preparations were obtained from Southern
Biotechnology Associates (Birmingham, AL). Affinity-purified
anti-TNP IgM, IgG1, IgG2a, and IgE mAbs were used as standards.
| Results |
|---|
|
|
|---|
BALB/c mice immunized on a single occasion by i.m. injection of 1
µg of HBsAg without adjuvant attained only low titers of Abs against
HBsAg (anti-HBs) by 12 wk (mean endpoint dilution ELISA titer of
total IgG about 400). Titers of anti-HBs were nearly seven times
higher when the standard adjuvant for humans, aluminum hydroxide
(Al2O3, commonly known as alum), was added
at the same ratio (0.5 mg/ml) as used in the commercial hepatitis B
vaccines (e.g., Engerix-B, SmithKline Beecham; Recombivax-HB, Merck).
In contrast, anti-HBs titers were 20 times higher when HBsAg was
mixed with the immune activating CpG ODN 1826 and 180 times higher with
this ODN and alum together (Fig. 1
). The
enhancing effects of ODN 1826 were surprisingly potent, as anti-HBs
titers were not significantly different between groups receiving 10-,
100-, or 500-µg doses, nor between groups receiving these doses of
ODN mixed with alum. In other experiments we found that doses of 1 µg
or below had reduced effect (not shown). Anti-HBs titers in animals
receiving ODN without CpG motifs (#1982 and 1983), alone or with alum,
were not significantly different from those in the respective control
groups (HBsAg alone or HBsAg plus alum) (Fig. 2
). Treatment with CpG DNA was well
tolerated by all mice, which exhibited no apparent ruffling of fur,
diarrhea, or other signs of toxicity, even with the 500-µg
dose.
|
|
Immunization with HBsAg alone gave a mixed Th1/Th2 response, but
with more anti-HBs Abs of the IgG2a (Th1) than IgG1 (Th2) isotype
(Fig. 3
). When alum was added as
adjuvant, the response became predominantly Th2 with almost all
anti-HBs Abs being of the IgG1 isotype. In contrast, in mice
injected with HBsAg with CpG ODN (1826), the majority of Abs were
IgG2a, indicating a very strong Th1-type response. Remarkably, even
when combined with alum, the CpG ODN induced significantly more IgG2a
than IgG1, indicating that the effects of CpG ODN dominate over those
of alum with respect to T-help. Control ODN without CpG motifs (1982
and 1983) did not affect the isotype profile (Fig. 3
).
|
|
Administration of CpG ODN with Ag or with Ag and alum resulted in
the production of increased levels of Ab. This effect can be attributed
to a number of CpG-mediated activities including the stimulation of
monocytic/dendritic cells, the induction of proinflammatory cytokines,
and the activation of B cell proliferation and differentiation (5).
Collectively, these activities may create an environment highly
conducive to Ag presentation and may trigger the expression of
costimulatory molecules on Ag-presenting cells, which is required for
the induction of T cell differentiation. To test this assumption, the
expression of selected surface molecules was monitored on B cells after
either in vitro or in vivo exposure to CpG ODN. In the first set of
experiments, T cell-depleted spleen cells (containing predominantly B
cells and a minor population of non-B, non-T cells) were cultured with
ODN for 48 h and tested for expression of MHC class II, B7.2, and
Ly-6C. As shown in Figure 5
, B cells
treated with CpG ODN demonstrated a marked up-regulation of MHC class
II and B7.2, key molecules involved in both the induction of Th cells,
and Th cell-B cell cognate interactions. Ly-6C is also up-regulated on
B cells, an indicator of IFN-
or -
production in the culture
(T. J. Waldschmidt, unpublished observations). The IFN is likely
produced by the small number of NK or monocytic cells present in the
culture and is seen in all three groups. Of interest, at high doses the
non-CpG ODN also induced increases in MHC class II and B7.2, although
the level of expression was lower than that observed with the CpG
ODN.
|
and -
. As in the in
vitro experiments, the non-CpG ODN exhibited some biologic activity
although its effects were generally less potent. Collectively, these
data indicate that CpG ODN up-regulate costimulatory molecules on
Ag-presenting cells and further enhance the priming environment by
inducing the expression of proinflammatory cytokines.
|
From the perspective of the B cell, CpG ODN may promote in vivo
Ag-specific IgG production either directly, by facilitating isotype
switching of Ag-selected B cells, or indirectly, by inducing a strong
Th cell response. Activation of the switch recombination program in
naive B cells is known to require a strong differentiation signal and a
specific cytokine that directs which heavy chain locus will be
accessible (IFN-
promotes selection of IgG2a; IL-4 promotes the
selection of IgE and IgG1) (16). To evaluate the ability of CpG ODN to
induce B cell isotype switching, we tested two CpG ODN, 1668 and 1826,
which activate B cell differentiation and IFN-
secretion from NK
cells, as well as a control non-CpG ODN (1745), which has little
effect (8, 10, 17).
Resting B cells were purified by Percoll sedimentation and then
cultured with LPS (as positive control), CpG ODN, or control non-CpG
ODN. To mimic the Th1-like cytokine milieu induced in vivo by the CpG
ODN, recombinant IFN-
was added to the cultures. After 6 days,
culture supernatants were assayed for the presence of downstream
isotypes. Both LPS and CpG ODN induced high levels of IgM secretion,
but in the absence of IFN-
there was minimal secretion of IgG2a
(Table I
). Upon addition of IFN-
however, both LPS and CpG ODN promoted a marked increase in IgG2a
secretion, strongly suggesting the induction of isotype switching. Of
interest, the non-CpG ODN allowed for a modest level of IgM and IgG2a
secretion, consistent with the low level of biologic activity observed
in the other studies (Figs. 5
, 6
).
|
|
| Discussion |
|---|
|
|
|---|
Our studies demonstrate that the in vivo immune-enhancing effect of CpG DNA is associated with the induction of costimulatory molecule expression including class II MHC and B7.2. The induction of class II MHC, a marker for lymphocyte activation and Ly-6C, a marker for the presence of IFNs, persisted for at least 6 days following injection of CpG ODN. Since previous studies have shown that the cytokine induction by CpG DNA lasts for less than 24 h (6, 18), this sustained expression demonstrates that the cytokine effect outlasts the elevated cytokine levels. These data suggest that CpG DNA may improve the efficiency with which local Ag-presenting cells present coinjected Ags to T cells and induce T helper cell activity. Indeed, in support of this hypothesis, we have found that the effect of CpG DNA depends on coadministration with the Ag and is substantially reduced if the Ag and ODN are injected in separate sites (G. Weiner et al., H. L. Davis et al., unpublished data). A consistent but less dramatic stimulatory effect of the control ODN on costimulatory molecule expression was also noted. We consistently observed that phosphorothioate backbone ODN without a CpG caused a dose-dependent, non-sequence-specific B cell proliferation and monocyte/macrophage activation, which, while weaker than that seen with phosphorothioate CpG ODN, was more substantial at higher ODN concentrations (not shown). These results are in agreement with the data of Monteith et al., who showed that all phosphorothioate backbone ODN can induce B cell proliferation and splenomegaly in vivo, indicating an inherent immune stimulatory effect of the phosphorothioate backbone (19).
In addition to its ability to enhance Ag presentation, and thereby
provide T cell help, our previous studies have shown that CpG ODN
directly stimulate murine B cells to proliferate and secrete IgM (3).
The possibility thus arises that together with appropriate cytokine
signals, CpG ODN may directly promote switch recombination at the level
of the individual B cell. It is clear from numerous studies that two
signals are required to induce the switch recombination program in
naive B cells (16). In addition to a specific cytokine that directs
which heavy chain locus will be accessible, B cells require a strong
differentiation signal. Murine cytokines known to direct
isotype-specific switching include IL-4, which promotes switching to
IgG1 and IgE (20, 21, 22, 23), and IFN-
, which induces switching to IgG2a
(24). In the mouse, LPS or reagents that engage CD40 have been
demonstrated to supply the necessary differentiation signals for switch
recombination. Based on these findings, we tested whether CpG ODN could
also induce isotype switching in combination with either IL-4 or
IFN-
. Our studies confirmed the ability of CpG ODN to promote
isotype switching in either the Th1 or Th2 direction, depending on the
cytokine environment. Unlike LPS, CpG DNA induces a high level of
IFN-
secretion from NK cells, which explains the predominance of
IgG2a isotypes observed in the in vivo studies.
Strong cell-mediated immunity, including CTL activity, is essential for protection against many diseases and is therefore desirable with almost all vaccines. Although not essential for protective immunity against HBV, CTL may be important for avoiding or overcoming the chronic carrier state. Indeed, many previously infected individuals, even years after clinical and serologic recovery, have traces of HBV in their blood and have HBV-specific CTL that express activation markers indicative of recent contact with Ag (25). These results suggest that sterilizing immunity may not occur after HBV infection and that chronic activation of CTL is responsible for keeping the virus under control. There are currently more than 250 million chronic HBV carriers in the world, many of whom will eventually suffer from cirrhosis or hepatocellular carcinoma (26). Repeated doses of an HBsAg subunit vaccine (with alum) reduced viral replication in 50% of vaccinated chronic carriers (27). Addition of CpG ODN would presumably improve these results through its strong Th1 bias and induction of CTL. This might be far more effective than the currently used IFN therapy, which cures only 10 to 20% of treated individuals (28) and would also be much less expensive, an important factor since the highest incidence of HBV chronicity is in less developed areas of the world. Anti-viral drugs (e.g., lamivudine) are also expensive and, although they can reduce the circulating virus to undetectable levels, there is usually a return to pretreatment levels if the drug is stopped.
An important disadvantage of alum is the induction of a Th2- rather than a Th1-type immune response. In the case of recombinant HBsAg, the use of alum as an adjuvant appears to interfere with cell-mediated immunity and blocks activation of CD8+ CTL (29). In contrast, our studies show that CpG ODN induces strong Th1-type immune responses to HBsAg and can even overcome the Th2 bias of alum for both Ab isotype and CTL response when the two agents are used together. Thus it is possible to induce strong humoral responses, owing to synergistic action of the alum and CpG ODN, while still permitting CTL.
The Th1 effect of CpG DNA may also be relevant to asthma, an immune-mediated inflammatory disease characterized by Th2 immune responses to innocuous, inhaled environmental Ags. The much higher prevalence of asthma in developed nations has been linked to the high hygiene level and rapid treatment of childhood infections (30). We hypothesize that early exposure to bacterial DNA (and its Th1-immunostimulatory CpG motifs) would push the immune system away from Th2- and toward a Th1-type response to environmental Ags. This may account for the lower incidence of asthma in less developed countries, where there is a much higher frequency of childhood upper respiratory infections. Addition of CpG ODN to all pediatric vaccines could re-establish a Th1-type response to environmental Ags. Indeed, we have recently found that CpG ODN are effective at preventing and treating asthma in a mouse model.4
Phosphorothioate-modified ODN can be easily produced on a large scale under Good Manufacturing Practices conditions at a cost of approximately $200/g. In antisense studies, ODN have been found to be safe when administered at doses above 100 mg/kg, which is several orders of magnitude over the dose of 10 µg used herein (0.36 mg/kg). It is noteworthy that human clinical trials have reached continuous daily doses of up to 4 mg/kg without apparent drug-related toxicity (31, 32). Moreover, in other studies we and others have demonstrated that human cells also show immune activation in response to CpG DNA (10, 33). Together, these factors suggest that CpG ODN could be safe, effective, and economical replacements or supplements for alum in human and animal vaccine formulations.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Heather L. Davis, Loeb Research Institute, Ottawa Civic Hospital, 725 Parkdale Avenue, Ottawa, ON, Canada K1Y 4E9. E-mail address: ![]()
3 Abbreviations used in this paper: ODN, oligodeoxynucleotides; alum, aluminum hydroxide (Al2O3); HBsAG, hepatitis B surface Ag; HBV, hepatitis B virus; MFI, mean fluorescence intensity. ![]()
4 J. N. Kline, T. R. Businga, T. J. Waldschmidt, J. V. Weinstock, and A. M. Krieg. 1997. Modulation of the asthmatic response by CpG oligodeoxynucleotides. Submitted for publication. ![]()
Received for publication June 13, 1997. Accepted for publication October 1, 1997.
| References |
|---|
|
|
|---|
production by stimulation of interleukin-12 and tumor necrosis factor-
. Cell. Immunol. 167:72.[Medline]
production by NK cells and increases sensitivity to endotoxin. J. Immunol. 156:4570.[Abstract]
production is dependent on macrophage secretion of IL-12. Clin. Immunol. Immunopath. 84:185.[Medline]
promotes IL-6 and Ig-M secretion in response to CpG motifs in bacterial DNA and ODN. J. Immunol. 156:558.[Abstract]
transcripts in B lymphoid cells. J. Exp. Med. 168:2385.
. Proc. Natl. Acad. Sci. USA 86:2829.
. Int. Immunol. 5:885.This article has been cited by other articles:
![]() |
J. Kovacs-Nolan, J. W. Mapletoft, Z. Lawman, L. A. Babiuk, and S. van Drunen Littel-van den Hurk Formulation of bovine respiratory syncytial virus fusion protein with CpG oligodeoxynucleotide, cationic host defence peptide and polyphosphazene enhances humoral and cellular responses and induces a protective type 1 immune response in mice J. Gen. Virol., August 1, 2009; 90(8): 1892 - 1905. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Suzuki, Y. Suzuki, I. Narita, M. Aizawa, M. Kihara, T. Yamanaka, T. Kanou, H. Tsukaguchi, J. Novak, S. Horikoshi, et al. Toll-Like Receptor 9 Affects Severity of IgA Nephropathy J. Am. Soc. Nephrol., December 1, 2008; 19(12): 2384 - 2395. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sun, X. Song, and S. Hu Ginsenoside Rg1 and Aluminum Hydroxide Synergistically Promote Immune Responses to Ovalbumin in BALB/c Mice Clin. Vaccine Immunol., February 1, 2008; 15(2): 303 - 307. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Mapletoft, M. Oumouna, J. Kovacs-Nolan, L. Latimer, G. Mutwiri, L. A. Babiuk, and S. van Drunen Littel-van den Hurk Intranasal immunization of mice with a formalin-inactivated bovine respiratory syncytial virus vaccine co-formulated with CpG oligodeoxynucleotides and polyphosphazenes results in enhanced protection J. Gen. Virol., January 1, 2008; 89(1): 250 - 260. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Merlo, C. Calcaterra, S. Menard, and A. Balsari Cross-talk between Toll-like receptors 5 and 9 on activation of human immune responses J. Leukoc. Biol., September 1, 2007; 82(3): 509 - 518. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Krieg Antiinfective Applications of Toll-like Receptor 9 Agonists Proceedings of the ATS, July 1, 2007; 4(3): 289 - 294. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Spinner, R. B. Kascsak, G. LaFauci, H. C. Meeker, X. Ye, M. J. Flory, J. I. Kim, G. B. Schuller-Levis, W. R. Levis, T. Wisniewski, et al. CpG oligodeoxynucleotide-enhanced humoral immune response and production of antibodies to prion protein PrPSc in mice immunized with 139A scrapie-associated fibrils J. Leukoc. Biol., June 1, 2007; 81(6): 1374 - 1385. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Bae, Y.-J. Park, J.-B. Park, Y. S. Choi, M. S. Kim, and J.-I. Sin Therapeutic Synergy of Human Papillomavirus E7 Subunit Vaccines plus Cisplatin in an Animal Tumor Model: Causal Involvement of Increased Sensitivity of Cisplatin-Treated Tumors to CTL-Mediated Killing in Therapeutic Synergy Clin. Cancer Res., January 1, 2007; 13(1): 341 - 349. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Liang, J. V. van den Hurk, L. A. Babiuk, and S. van Drunen Littel-van den Hurk Priming with DNA encoding E2 and boosting with E2 protein formulated with CpG oligodeoxynucleotides induces strong immune responses and protection from Bovine viral diarrhea virus in cattle. J. Gen. Virol., October 1, 2006; 87(Pt 10): 2971 - 2982. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. Sester, K. Brion, A. Trieu, H. S. Goodridge, T. L. Roberts, J. Dunn, D. A. Hume, K. J. Stacey, and M. J. Sweet CpG DNA Activates Survival in Murine Macrophages through TLR9 and the Phosphatidylinositol 3-Kinase-Akt Pathway J. Immunol., October 1, 2006; 177(7): 4473 - 4480. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Giuliani, J. Adu-Bobie, M. Comanducci, B. Arico, S. Savino, L. Santini, B. Brunelli, S. Bambini, A. Biolchi, B. Capecchi, et al. Inaugural Article: A universal vaccine for serogroup B meningococcus PNAS, July 18, 2006; 103(29): 10834 - 10839. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wu, W. Hou, S. Sun, E. Bi, Y. Wang, M. Shi, J. Zang, C. Dong, and B. Sun Novel Function of IFN-{gamma}: Negative Regulation of Dendritic Cell Migration and T Cell Priming J. Immunol., July 15, 2006; 177(2): 934 - 943. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-P. Woo, T. Doan, K. A. Herd, H.-J. Netter, and R. W. Tindle Hepatitis B surface antigen vector delivers protective cytotoxic T-lymphocyte responses to disease-relevant foreign epitopes. J. Virol., April 1, 2006; 80(8): 3975 - 3984. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yu, H. Huang, J. Xiang, L. A. Babiuk, and S. van Drunen Littel-van den Hurk Dendritic cells pulsed with hepatitis C virus NS3 protein induce immune responses and protection from infection with recombinant vaccinia virus expressing NS3 J. Gen. Virol., January 1, 2006; 87(1): 1 - 10. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. P. A. Ivory, K. Keller, and K. Chadee CpG-Oligodeoxynucleotide Is a Potent Adjuvant with an Entamoeba histolytica Gal-Inhibitable Lectin Vaccine against Amoebic Liver Abscess in Gerbils Infect. Immun., January 1, 2006; 74(1): 528 - 536. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Wettstein, N. D. Borson, J. G. Park, K. T. McNallan, and A. M. Reed Cysteine-Tailed Class I-Binding Peptides Bind to CpG Adjuvant and Enhance Primary CTL Responses J. Immunol., September 15, 2005; 175(6): 3681 - 3689. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Radhakrishnan, E. Celis, and L. R. Pease B7-DC cross-linking restores antigen uptake and augments antigen-presenting cell function by matured dendritic cells PNAS, August 9, 2005; 102(32): 11438 - 11443. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Matsumoto, M. Matsumoto, K. Umemori, Y. Ozeki, M. Furugen, T. Tatsuo, Y. Hirayama, S. Yamamoto, T. Yamada, and K. Kobayashi DNA Augments Antigenicity of Mycobacterial DNA-Binding Protein 1 and Confers Protection against Mycobacterium tuberculosis Infection in Mice J. Immunol., July 1, 2005; 175(1): 441 - 449. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Oumouna, J. W. Mapletoft, B. C. Karvonen, L. A. Babiuk, and S. van Drunen Littel-van den Hurk Formulation with CpG Oligodeoxynucleotides Prevents Induction of Pulmonary Immunopathology following Priming with Formalin-Inactivated or Commercial Killed Bovine Respiratory Syncytial Virus Vaccine J. Virol., February 15, 2005; 79(4): 2024 - 2032. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Xie, I. Gursel, B. E. Ivins, M. Singh, D. T. O'Hagan, J. B. Ulmer, and D. M. Klinman CpG Oligodeoxynucleotides Adsorbed onto Polylactide-Co-Glycolide Microparticles Improve the Immunogenicity and Protective Activity of the Licensed Anthrax Vaccine Infect. Immun., February 1, 2005; 73(2): 828 - 833. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Cox and D. M. Magee Coccidioidomycosis: Host Response and Vaccine Development Clin. Microbiol. Rev., October 1, 2004; 17(4): 804 - 839. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yu, L. A. Babiuk, and S. van Drunen Littel-van den Hurk Priming with CpG-enriched plasmid and boosting with protein formulated with CpG oligodeoxynucleotides and Quil A induces strong cellular and humoral immune responses to hepatitis C virus NS3 J. Gen. Virol., June 1, 2004; 85(6): 1533 - 1543. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Jiao, R. Y.-H. Wang, Q. Qiu, H. J. Alter, and J. W.-K. Shih Enhanced hepatitis C virus NS3 specific Th1 immune responses induced by co-delivery of protein antigen and CpG with cationic liposomes J. Gen. Virol., June 1, 2004; 85(6): 1545 - 1553. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-J. Anders, B. Banas, and D. Schlondorff Signaling Danger: Toll-Like Receptors and their Potential Roles in Kidney Disease J. Am. Soc. Nephrol., April 1, 2004; 15(4): 854 - 867. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lee, R. Thangavel, V. M. Sharma, J. M. Litersky, K. Bhaskar, S. M. Fang, L. H. Do, A. Andreadis, G. Van Hoesen, and H. Ksiezak-Reding Phosphorylation of Tau by Fyn: Implications for Alzheimer's Disease J. Neurosci., March 3, 2004; 24(9): 2304 - 2312. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kumar, T. R. Jones, M. S. Oakley, H. Zheng, S. P. Kuppusamy, A. Taye, A. M. Krieg, A. W. Stowers, D. C. Kaslow, and S. L. Hoffman CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine Infect. Immun., February 1, 2004; 72(2): 949 - 957. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Storni, C. Ruedl, K. Schwarz, R. A. Schwendener, W. A. Renner, and M. F. Bachmann Nonmethylated CG Motifs Packaged into Virus-Like Particles Induce Protective Cytotoxic T Cell Responses in the Absence of Systemic Side Effects J. Immunol., February 1, 2004; 172(3): 1777 - 1785. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Lefeber, B. Benaissa-Trouw, J. F. G. Vliegenthart, J. P. Kamerling, W. T. M. Jansen, K. Kraaijeveld, and H. Snippe Th1-Directing Adjuvants Increase the Immunogenicity of Oligosaccharide-Protein Conjugate Vaccines Related to Streptococcus pneumoniae Type 3 Infect. Immun., December 1, 2003; 71(12): 6915 - 6920. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Shao, S. Lei, S. L. Sun, J. Xiang, H. J. Kaplan, and D. Sun CpG-Containing Oligodeoxynucleotide 1826 Converts the Weak Uveitogenic Rat Interphotoreceptor Retinoid-Binding Protein Peptide 1181-1191 into a Strong Uveitogen J. Immunol., November 1, 2003; 171(9): 4780 - 4785. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Loirat, M. Mancini-Bourgine, J.-P. Abastado, and M.-L. Michel HBsAg/HLA-A2 transgenic mice: a model for T cell tolerance to hepatitis B surface antigen in chronic hepatitis B virus infection Int. Immunol., October 1, 2003; 15(10): 1125 - 1136. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Elias, J. Flo, R. A. Lopez, J. Zorzopulos, A. Montaner, and J. M. Rodriguez Strong Cytosine-Guanosine-Independent Immunostimulation in Humans and Other Primates by Synthetic Oligodeoxynucleotides with PyNTTTTGT Motifs J. Immunol., October 1, 2003; 171(7): 3697 - 3704. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Su, M.-F. Tam, D. Jankovic, and M. M. Stevenson Vaccination with Novel Immunostimulatory Adjuvants against Blood-Stage Malaria in Mice Infect. Immun., September 1, 2003; 71(9): 5178 - 5187. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kuchtey, M. Pennini, R. K. Pai, and C. V. Harding CpG DNA Induces a Class II Transactivator-Independent Increase in Class II MHC by Stabilizing Class II MHC mRNA in B Lymphocytes J. Immunol., September 1, 2003; 171(5): 2320 - 2325. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tritel, A. M. Stoddard, B. J. Flynn, P. A. Darrah, C.-y. Wu, U. Wille, J. A. Shah, Y. Huang, L. Xu, M. R. Betts, et al. Prime-Boost Vaccination with HIV-1 Gag Protein and Cytosine Phosphate Guanosine Oligodeoxynucleotide, Followed by Adenovirus, Induces Sustained and Robust Humoral and Cellular Immune Responses J. Immunol., September 1, 2003; 171(5): 2538 - 2547. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Davila, R. Kennedy, and E. Celis Generation of Antitumor Immunity by Cytotoxic T Lymphocyte Epitope Peptide Vaccination, CpG-oligodeoxynucleotide Adjuvant, and CTLA-4 Blockade Cancer Res., June 15, 2003; 63(12): 3281 - 3288. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-M. Kang and R. W. Compans Enhancement of Mucosal Immunization with Virus-Like Particles of Simian Immunodeficiency Virus J. Virol., March 15, 2003; 77(6): 3615 - 3623. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-Y. Kim, H.-J. Myoung, J.-H. Kim, I.-S. Moon, T.-G. Kim, W.-S. Ahn, and J.-I. Sin Both E7 and CpG-Oligodeoxynucleotide Are Required for Protective Immunity against Challenge with Human Papillomavirus 16 (E6/E7) Immortalized Tumor Cells: Involvement of CD4+ and CD8+ T Cells in Protection Cancer Res., December 15, 2002; 62(24): 7234 - 7240. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. La Rosa, Z. Wang, J. C. Brewer, S. F. Lacey, M. C. Villacres, R. Sharan, R. Krishnan, M. Crooks, S. Markel, R. Maas, et al. Preclinical development of an adjuvant-free peptide vaccine with activity against CMV pp65 in HLA transgenic mice Blood, November 15, 2002; 100(10): 3681 - 3689. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. He, A. Mitchell, T. Morcol, and S. J. D. Bell Calcium Phosphate Nanoparticles Induce Mucosal Immunity and Protection against Herpes Simplex Virus Type 2 Clin. Vaccine Immunol., September 1, 2002; 9(5): 1021 - 1024. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Jung, A.-K. Yi, X. Zhang, J. Choe, L. Li, and Y. S. Choi Distinct Response of Human B Cell Subpopulations in Recognition of an Innate Immune Signal, CpG DNA J. Immunol., September 1, 2002; 169(5): 2368 - 2373. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. P. Ioannou, P. Griebel, R. Hecker, L. A. Babiuk, and S. van Drunen Littel-van den Hurk The Immunogenicity and Protective Efficacy of Bovine Herpesvirus 1 Glycoprotein D plus Emulsigen Are Increased by Formulation with CpG Oligodeoxynucleotides J. Virol., August 12, 2002; 76(18): 9002 - 9010. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Sfondrini, D. Besusso, M. T. Zoia, M. Rodolfo, A. M. Invernizzi, M. Taniguchi, T. Nakayama, M. P. Colombo, S. Menard, and A. Balsari Absence of the CD1 Molecule Up-Regulates Antitumor Activity Induced by CpG Oligodeoxynucleotides in Mice J. Immunol., July 1, 2002; 169(1): 151 - 158. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zheng, D. M. Klinman, M. Gierynska, and B. T. Rouse DNA containing CpG motifs induces angiogenesis PNAS, June 25, 2002; 99(13): 8944 - 8949. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J. Cho, T. Hayashi, S. K. Datta, K. Takabayashi, J. H. Van Uden, A. Horner, M. Corr, and E. Raz IFN-{alpha}{beta} Promote Priming of Antigen-Specific CD8+ and CD4+ T Lymphocytes by Immunostimulatory DNA-Based Vaccines J. Immunol., May 15, 2002; 168(10): 4907 - 4913. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Andreae, F. Piras, N. Burdin, and F. Triebel Maturation and Activation of Dendritic Cells Induced by Lymphocyte Activation Gene-3 (CD223) J. Immunol., April 15, 2002; 168(8): 3874 - 3880. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Verthelyi, R. T. Kenney, R. A. Seder, A. A. Gam, B. Friedag, and D. M. Klinman CpG Oligodeoxynucleotides as Vaccine Adjuvants in Primates J. Immunol., February 15, 2002; 168(4): 1659 - 1663. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Near, A. W. Stowers, D. Jankovic, and D. C. Kaslow Improved Immunogenicity and Efficacy of the Recombinant 19-Kilodalton Merozoite Surface Protein 1 by the Addition of Oligodeoxynucleotide and Aluminum Hydroxide Gel in a Murine Malaria Vaccine Model Infect. Immun., February 1, 2002; 70(2): 692 - 701. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Miconnet, S. Koenig, D. Speiser, A. Krieg, P. Guillaume, J.-C. Cerottini, and P. Romero CpG Are Efficient Adjuvants for Specific CTL Induction Against Tumor Antigen-Derived Peptide J. Immunol., February 1, 2002; 168(3): 1212 - 1218. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Renz and U. Herz The bidirectional capacity of bacterial antigens to modulate allergy and asthma Eur. Respir. J., January 1, 2002; 19(1): 158 - 171. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. P. Juffermans, J. C. Leemans, S. Florquin, A. Verbon, A. H. Kolk, P. Speelman, S. J. H. van Deventer, and T. van der Poll CpG Oligodeoxynucleotides Enhance Host Defense during Murine Tuberculosis Infect. Immun., January 1, 2002; 70(1): 147 - 152. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. K. Ballas, A. M. Krieg, T. Warren, W. Rasmussen, H. L. Davis, M. Waldschmidt, and G. J. Weiner Divergent Therapeutic and Immunologic Effects of Oligodeoxynucleotides with Distinct CpG Motifs J. Immunol., November 1, 2001; 167(9): 4878 - 4886. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Gursel, M. Gursel, K. J. Ishii, and D. M. Klinman Sterically Stabilized Cationic Liposomes Improve the Uptake and Immunostimulatory Activity of CpG Oligonucleotides J. Immunol., September 15, 2001; 167(6): 3324 - 3328. [Abstract] [Full Text] [PDF] |
||||
![]() |
F.-G. Zhu and D. S. Pisetsky Role of the Heat Shock Protein 90 in Immune Response Stimulation by Bacterial DNA and Synthetic Oligonucleotides Infect. Immun., September 1, 2001; 69(9): 5546 - 5552. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. H. Baek, S. J. Ha, and Y. C. Sung A Novel Function of Phosphorothioate Oligodeoxynucleotides as Chemoattractants for Primary Macrophages J. Immunol., September 1, 2001; 167(5): 2847 - 2854. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chen, J. Zhang, S. A. Moore, Z. K. Ballas, J. P. Portanova, A. M. Krieg, and D. J. Berg CpG DNA induces cyclooxygenase-2 expression and prostaglandin production Int. Immunol., August 1, 2001; 13(8): 1013 - 1020. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Horner, S. K. Datta, K. Takabayashi, I. M. Belyakov, T. Hayashi, N. Cinman, M.-D. Nguyen, J. H. Van Uden, J. A. Berzofsky, D. D. Richman, et al. Immunostimulatory DNA-Based Vaccines Elicit Multifaceted Immune Responses Against HIV at Systemic and Mucosal Sites J. Immunol., August 1, 2001; 167(3): 1584 - 1591. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Malanchere-Bres, P. J. Payette, M. Mancini, P. Tiollais, H. L. Davis, and M.-L. Michel CpG Oligodeoxynucleotides with Hepatitis B Surface Antigen (HBsAg) for Vaccination in HBsAg-Transgenic Mice J. Virol., July 15, 2001; 75(14): 6482 - 6491. [Abstract] [Full Text] |
||||
![]() |
H. Jyonouchi, S. Sun, T. Winship, and M. J. Kuchan Dietary Ribonucleotides Modulate Type 1 and Type 2 T-Helper Cell Responses against Ovalbumin in Young BALB/cJ Mice J. Nutr., April 1, 2001; 131(4): 1165 - 1170. [Abstract] [Full Text] |
||||
![]() |
R. A. Gramzinski, D. L. Doolan, M. Sedegah, H. L. Davis, A. M. Krieg, and S. L. Hoffman Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice Infect. Immun., March 1, 2001; 69(3): 1643 - 1649. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. S. Gallichan, R. N. Woolstencroft, T. Guarasci, M. J. McCluskie, H. L. Davis, and K. L. Rosenthal Intranasal Immunization with CpG Oligodeoxynucleotides as an Adjuvant Dramatically Increases IgA and Protection Against Herpes Simplex Virus-2 in the Genital Tract J. Immunol., March 1, 2001; 166(5): 3451 - 3457. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Jahrsdörfer, G. Hartmann, E. Racila, W. Jackson, L. Mühlenhoff, G. Meinhardt, S. Endres, B. K. Link, A. M. Krieg, and G. J. Weiner CpG DNA increases primary malignant B cell expression of costimulatory molecules and target antigens J. Leukoc. Biol., January 1, 2001; 69(1): 81 - 88. [Abstract] [Full Text] |
||||
![]() |
D. Askew, R. S. Chu, A. M. Krieg, and C. V. Harding CpG DNA Induces Maturation of Dendritic Cells with Distinct Effects on Nascent and Recycling MHC-II Antigen-Processing Mechanisms J. Immunol., December 15, 2000; 165(12): 6889 - 6895. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Warren, S. K. Bhatia, A. M. Acosta, C. E. Dahle, T. L. Ratliff, A. M. Krieg, and G. J. Weiner APC Stimulated by CpG Oligodeoxynucleotide Enhance Activation of MHC Class I-Restricted T Cells J. Immunol., December 1, 2000; 165(11): 6244 - 6251. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Leutenegger, F. S. Boretti, C. N. Mislin, J. N. Flynn, M. Schroff, A. Habel, C. Junghans, S. A. Koenig-Merediz, B. Sigrist, A. Aubert, et al. Immunization of Cats against Feline Immunodeficiency Virus (FIV) Infection by Using Minimalistic Immunogenic Defined Gene Expression Vector Vaccines Expressing FIV gp140 Alone or with Feline Interleukin-12 (IL-12), IL-16, or a CpG Motif J. Virol., November 15, 2000; 74(22): 10447 - 10457. [Abstract] [Full Text] |
||||
![]() |
D. P. Sester, S. Naik, S. J. Beasley, D. A. Hume, and K. J. Stacey Phosphorothioate Backbone Modification Modulates Macrophage Activation by CpG DNA J. Immunol., October 15, 2000; 165(8): 4165 - 4173. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Weiner The immunobiology and clinical potential of immunostimulatory CpG oligodeoxynucleotides J. Leukoc. Biol., October 1, 2000; 68(4): 455 - 463. [Abstract] [Full Text] |
||||
![]() |
S. W. Lee, M. K. Song, K. H. Baek, Y. Park, J. K. Kim, C. H. Lee, H.-K. Cheong, C. Cheong, and Y. C. Sung Effects of a Hexameric Deoxyriboguanosine Run Conjugation into CpG Oligodeoxynucleotides on Their Immunostimulatory Potentials J. Immunol., October 1, 2000; 165(7): 3631 - 3639. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Olszewska, C. D. Partidos, and M. W. Steward Antipeptide Antibody Responses following Intranasal Immunization: Effectiveness of Mucosal Adjuvants Infect. Immun., September 1, 2000; 68(9): 4923 - 4929. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Scharton-Kersten, J.-m. Yu, R. Vassell, D. O'Hagan, C. R. Alving, and G. M. Glenn Transcutaneous Immunization with Bacterial ADP-Ribosylating Exotoxins, Subunits, and Unrelated Adjuvants Infect. Immun., September 1, 2000; 68(9): 5306 - 5313. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Johnson, M. A. Conway, J. Daly, C. Nicolson, J. Robertson, and K. H. G. Mills Plasmid DNA encoding influenza virus haemagglutinin induces Th1 cells and protection against respiratory infection despite its limited ability to generate antibody responses J. Gen. Virol., July 1, 2000; 81(7): 1737 - 1745. [Abstract] [Full Text] |
||||
![]() |
E. Davila and E. Celis Repeated Administration of Cytosine-Phosphorothiolated Guanine-Containing Oligonucleotides Together with Peptide/Protein Immunization Results in Enhanced CTL Responses with Anti-Tumor Activity J. Immunol., July 1, 2000; 165(1): 539 - 547. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ban, L. Dupre, E. Hermann, W. Rohn, C. Vendeville, B. Quatannens, P. Ricciardi-Castagnoli, A. Capron, and G. Riveau CpG motifs induce Langerhans cell migration in vivo Int. Immunol., June 1, 2000; 12(6): 737 - 745. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. F. Carpentier, J. Xie, K. Mokhtari, and J.-Y. Delattre Successful Treatment of Intracranial Gliomas in Rat by Oligodeoxynucleotides Containing CpG Motifs Clin. Cancer Res., June 1, 2000; 6(6): 2469 - 2473. [Abstract] [Full Text] |
||||
![]() |
J. He, S. Gurunathan, A. Iwasaki, B. Ash-Shaheed, and B. L. Kelsall Primary Role for GI Protein Signaling in the Regulation of Interleukin 12 Production and the Induction of T Helper Cell Type 1 Responses J. Exp. Med., May 1, 2000; 191(9): 1605 - 1610. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Schirmbeck, J. Wild, D. Stober, H. E. Blum, F. V. Chisari, M. Geissler, and J. Reimann Ongoing Murine T1 or T2 Immune Responses to the Hepatitis B Surface Antigen Are Excluded from the Liver that Expresses Transgene-Encoded Hepatitis B Surface Antigen J. Immunol., April 15, 2000; 164(8): 4235 - 4243. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Chu, T. McCool, N. S. Greenspan, J. R. Schreiber, and C. V. Harding CpG Oligodeoxynucleotides Act as Adjuvants for Pneumococcal Polysaccharide-Protein Conjugate Vaccines and Enhance Antipolysaccharide Immunoglobulin G2a (IgG2a) and IgG3 Antibodies Infect. Immun., March 1, 2000; 68(3): 1450 - 1456. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Vabulas, H. Pircher, G. B. Lipford, H. Hacker, and H. Wagner CpG-DNA Activates In Vivo T Cell Epitope Presenting Dendritic Cells to Trigger Protective Antiviral Cytotoxic T Cell Responses J. Immunol., March 1, 2000; 164(5): 2372 - 2378. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Hartmann, R. D. Weeratna, Z. K. Ballas, P. Payette, S. Blackwell, I. Suparto, W. L. Rasmussen, M. Waldschmidt, D. Sajuthi, R. H. Purcell, et al. Delineation of a CpG Phosphorothioate Oligodeoxynucleotide for Activating Primate Immune Responses In Vitro and In Vivo J. Immunol., February 1, 2000; 164(3): 1617 - 1624. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Hartmann and A. M. Krieg Mechanism and Function of a Newly Identified CpG DNA Motif in Human Primary B Cells J. Immunol., January 15, 2000; 164(2): 944 - 953. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Chiaramonte, M. Hesse, A. W. Cheever, and T. A. Wynn CpG Oligonucleotides Can Prophylactically Immunize Against Th2-Mediated Schistosome Egg-Induced Pathology by an IL-12-Independent Mechanism J. Immunol., January 15, 2000; 164(2): 973 - 985. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-Y. Huang, A. M. Krieg, N. Eller, and D. E. Scott Induction and Regulation of Th1-Inducing Cytokines by Bacterial DNA, Lipopolysaccharide, and Heat-Inactivated Bacteria Infect. Immun., December 1, 1999; 67(12): 6257 - 6263. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-K. Yi, D. W. Peckham, R. F. Ashman, and A. M. Krieg CpG DNA rescues B cells from apoptosis by activating NF{kappa}B and preventing mitochondrial membrane potential disruption via a chloroquine-sensitive pathway Int. Immunol., December 1, 1999; 11(12): 2015 - 2024. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. F. Carpentier, L. Chen, F. Maltonti, and J.-Y. Delattre Oligodeoxynucleotides Containing CpG Motifs Can Induce Rejection of a Neuroblastoma in Mice Cancer Res., November 1, 1999; 59(21): 5429 - 5432. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lobell, R. Weissert, S. Eltayeb, C. Svanholm, T. Olsson, and H. Wigzell Presence of CpG DNA and the Local Cytokine Milieu Determine the Efficacy of Suppressive DNA Vaccination in Experimental Autoimmune Encephalomyelitis J. Immunol., November 1, 1999; 163(9): 4754 - 4762. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Parks, J. L. Bramson, Y. Wan, C. L. Addison, and F. L. Graham Effects of Stuffer DNA on Transgene Expression from Helper-Dependent Adenovirus Vectors J. Virol., October 1, 1999; 73(10): 8027 - 8034. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Iho, T. Yamamoto, T. Takahashi, and S. Yamamoto Oligodeoxynucleotides Containing Palindrome Sequences with Internal 5'-CpG-3' Act Directly on Human NK and Activated T Cells to Induce IFN-{gamma} Production In Vitro J. Immunol., October 1, 1999; 163(7): 3642 - 3652. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wild, M. J. Grusby, R. Schirmbeck, and J. Reimann Priming MHC-I-Restricted Cytotoxic T Lymphocyte Responses to Exogenous Hepatitis B Surface Antigen Is CD4+ T Cell Dependent J. Immunol., August 15, 1999; 163(4): 1880 - 1887. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Calarota, A.-C. Leandersson, G. Bratt, J. Hinkula, D. M. Klinman, K. J. Weinhold, E. Sandstrom, and B. Wahren Immune Responses in Asymptomatic HIV-1-Infected Patients After HIV-DNA Immunization Followed by Highly Active Antiretroviral Treatment J. Immunol., August 15, 1999; 163(4): 2330 - 2338. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Hartmann, G. J. Weiner, and A. M. Krieg CpG DNA: A potent signal for growth, activation, and maturation of human dendritic cells PNAS, August 3, 1999; 96(16): 9305 - 9310. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Stacey and J. M. Blackwell Immunostimulatory DNA as an Adjuvant in Vaccination against Leishmania major Infect. Immun., August 1, 1999; 67(8): 3719 - 3726. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Rodrigues, M. Ribeirao, V. Pereira-Chioccola, L. Renia, and F. Costa Predominance of CD4 Th1 and CD8 Tc1 Cells Revealed by Characterization of the Cellular Immune Response Generated by Immunization with a DNA Vaccine Containing a Trypanosoma cruzi Gene Infect. Immun., August 1, 1999; 67(8): 3855 - 3863. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Chu, D. Askew, E. H. Noss, A. Tobian, A. M. Krieg, and C. V. Harding CpG Oligodeoxynucleotides Down-Regulate Macrophage Class II MHC Antigen Processing J. Immunol., August 1, 1999; 163(3): 1188 - 1194. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Schirmbeck, K. Melber, and J. Reimann Adjuvants that enhance priming of cytotoxic T cells to a Kb-restricted epitope processed from exogenous but not endogenous hepatitis B surface antigen Int. Immunol., July 1, 1999; 11(7): 1093 - 1102. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Schwartz, C. L. Wohlford-Lenane, T. J. Quinn, and A. M. Krieg Bacterial DNA or Oligonucleotides Containing Unmethylated CpG Motifs Can Minimize Lipopolysaccharide-Induced Inflammation in the Lower Respiratory Tract Through an IL-12-Dependent Pathway J. Immunol., July 1, 1999; 163(1): 224 - 231. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bachmaier, N. Neu, L. M. de la Maza, S. Pal, A. Hessel, and J. M. Penninger Chlamydia Infections and Heart Disease Linked Through Antigenic Mimicry Science, February 26, 1999; 283(5406): 1335 - 1339. [Abstract] [Full Text] |
||||
![]() |
J. Kovarik, P. Bozzotti, L. Love-Homan, M. Pihlgren, H. L. Davis, P.-H. Lambert, A. M. Krieg, and C.-A. Siegrist CpG Oligodeoxynucleotides Can Circumvent the Th2 Polarization of Neonatal Responses to Vaccines But May Fail to Fully Redirect Th2 Responses Established by Neonatal Priming J. Immunol., February 1, 1999; 162(3): 1611 - 1617. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. B. Millan, R. Weeratna, A. M. Krieg, C.-A. Siegrist, and H. L. Davis CpG DNA can induce strong Th1 humoral and cell-mediated immune responses against hepatitis B surface antigen in young mice PNAS, December 22, 1998; 95(26): 15553 - 15558. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sun, X. Zhang, D. F. Tough, and J. Sprent Type I Interferon-mediated Stimulation of T Cells by CpG DNA J. Exp. Med., December 21, 1998; 188(12): 2335 - 2342. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-M. Liu, S. E. Newbrough, S. K. Bhatia, C. E. Dahle, A. M. Krieg, and G. J. Weiner Immunostimulatory CpG Oligodeoxynucleotides Enhance the Immune Response to Vaccine Strategies Involving Granulocyte-Macrophage Colony-Stimulating Factor Blood, November 15, 1998; 92(10): 3730 - 3736. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |