| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Laboratories of
*
Experimental Radiology and
Viral Oncology, Aichi Cancer Center Research Institute, Chikusa-ku, Nagoya, Aichi, Japan; and
Department of Pathology, Georgetown University, Washington, DC 20007
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The TGF-ß1-induced G1 cell cycle arrest in epithelial cells has been at least partially attributed to the regulatory effects of this hormone on both the levels and activities of G1 cyclins and Cdks (7, 8). TGF-ß1 inhibits the expression of Cdk4, thus preventing activation of the cyclin D-Cdk4 complex in G1. This occurs in the absence of a direct effect by TGF-ß1 on cyclin D expression (7). In contrast to this, TGF-ß1 blocks activation of the cyclin E-Cdk2 complex without affecting the expression levels of either Cdk2 or cyclin E. This suggests that TGF-ß1 has a role in mediating the induction of inhibitors of cyclin E-Cdk2 complex (8).
Recently, a family of Cdk inhibitors has been shown to play an essential role in blocking cell cycle progression. Cdk inhibitors, such as p27Kip1, p15INK4b, and p21WAF1/Cip1, are known to physically associate with their target cyclin-Cdk complexes to inhibit their activities (9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19). The Cdk inhibitor p27Kip1 is highly conserved and broadly expressed in mammalian tissues (18). It is a heat-stable protein with a region of sequence similarity to p21WAF1/Cip1, the Cdk inhibitor in which transcription is stimulated by p53 (18, 19).
Proliferating Mv1Lu mink lung epithelial cells and human keratinocytes contain high levels of p27Kip1 distributed in complexes with Cdk2, Cdk4, and Cdk6 (20). TGF-ß1 is known to havelittle or no effect on p27Kip1 mRNA or protein levels in these two epithelial cell types. However, TGF-ß1 elevates the expression of the Cdk4/Cdk6-specific inhibitor p15INK4b and consequently induces the transfer of p27Kip1 from Cdk4 and/or Cdk6 to Cdk2 (20). In keratinocytes and some other cell types, TGF-ß1 increases p21WAF1/Cip1 that binds to Cdk2 and inhibits its kinase activity (21, 22, 23).
On the basis of these observations, TGF-ß1 is now considered to induce G1 arrest in epithelial cells mainly by down-regulation of Cdk4 and/or up-regulation of p15INK4b and/or p21WAF1/Cip1. TGF-ß1 also induces cell cycle arrest in B cells. However, little is known about its effects on Cdks or Cdk inhibitors in these cells.
The nuclear protein p53 is now firmly established as a key negative regulator of cell proliferation (24). Recently, much emphasis has been placed on the role of p53 in arresting cells at the G1/S interface in response to DNA damage (25). However, it is probable that wild-type p53 also has a role in other cellular growth-inhibitory signaling pathways. The correlation of p53 mutation with loss of TGF-ß1 responsiveness in many epithelial cell lines suggests that TGF-ß1 may be the trigger for one such signaling pathway (26). More direct support for this hypothesis has come from results by Mogi et al. (27) and Ewen et al. (28) who reported that the sensitivity of their epithelial cells to TGF-ß1 was reduced by the inhibition of endogenous wild-type p53. To our knowledge, nothing is known about the role of p53 in TGF-ß1-mediated cell cycle arrest in B cells.
In this report, we show that TGF-ß1 induces p27Kip1 mRNA and protein in the TGF-ß1-sensitive B cell lines CH31 and WEHI231 (29). Moreover, TGF-ß1 has little or no effect on Cdk4 or p21WAF1/Cip1protein levels in these same cells. Both of these findings are in sharp contrast to observations in epithelial cell lines. Finally, the induction of p27Kip1 appears to be p53 independent, since CH31 cells exclusively expressed mutant p53. Taken together, our findings suggest that TGF-ß1 controls cell cycle progression in B cells through mechanisms different from epithelial cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CH31, A20, HaCaT, and Saos-2 cells were generous gifts of Dr. Geoffrey Haughton (University of North Carolina at Chapel Hill, NC), Dr. Takashi Nishimura (Tokai University School of Medicine, Isehard, Japan), Dr. Norbert E. Fusenig (German Cancer Research Center, Heidelberg, Germany), and Dr. Mitsuo V. Kato (The Institute of Physical and Chemical Research, Tsukuba, Japan), respectively (30, 31, 32, 33). WEHI231 cells were obtained from the American Type Culture Collection (Rockville, MD). These cell lines were maintained as described in detail elsewhere (31, 32, 33, 34). TGF-ß1 was purchased from Boehringer Mannheim (Mannheim, Germany).
Growth inhibition assay
Growth inhibition was examined by [3H]thymidine uptake as previously described (34). Cells were cultured in triplicate at 1 x 104/100 µl in 96-well flat-bottom microtiter plates in the presence of 2 ng/ml TGF-ß1. At the specified time, the cell cultures were pulsed with 0.5 µCi/well [3H]thymidine for 1 h before harvesting onto glass fiber filters. [3H]thymidine incorporation into the DNA was measured with a scintillation counter. The results are expressed as the percentage of untreated cell growth (i.e., no TGF- ß1).
Northern blot
Whole-cell RNA was extracted from tissue culture cells by the method of Chomczynski and Sacchi (35). Fifteen micrograms of total RNA from each source was electrophoretically separated on a 1% formaldehyde/agarose gel and transferred to a nylon membrane. Membranes were hybridized and washed as previously described (36).
Immunoblotting
For the determination of p53 protein levels, cell extracts were prepared as described previously (37). For the determination of p15INK4b, p21WAF1/Cip1, and p27Kip1 protein levels, cells were lysed in Nonidet P-40 buffer (1.0% Nonidet P-40, 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 2 mM EDTA, 50 µg/ml PMSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin). Cell lysates (60 µg) were resolved by 12.5% SDS-PAGE (10% in the case of p53) and transferred to nitrocellulose membranes. mAbs to Cdk2, Cdk4, and p27Kip1 (Transduction Laboratories, Lexington, KY) and polyclonal Abs to p15INK4b and p21WAF1/Cip1 (Santa Cruz Biotechnology, Santa Cruz, CA) were used as primary Abs to detect these proteins. Incubation of the blots with primary Abs was followed by incubation with horseradish peroxidase-conjugated anti-mouse or anti-rabbit Abs (Amersham, Buckinghamshire, U.K.). Bands were visualized by chemiluminescence (ECL; Amersham).
Immunoprecipitation
For immunoprecipitation followed by immunoblotting, cells were washed once with cold PBS and lysed for 30 min on ice in 50 mM Tris-HCl (pH 8.0), 200 mM NaCl, 0.5% Nonidet P-40 containing 50 µg/ml PMSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin, 1 mM DTT, 20 mM NaF, 20 mM ß-glycerophosphate, and 0.1 mM sodium orthovanadate. Lysates were centrifuged for 15 min at 12,000 x g, and the affinity-purified rabbit anti-Cdk2 antisera (Upstate Biotechnology, Lake Placid, NY) was added and incubated overnight at 4°C. Immune complexes were collected on protein A-Sepharose beads (Pharmacia, Uppsala, Sweden), washed three times in 20 mM Tris-Hcl (pH 8.0) containing 250 mM NaCl, 1 mM EDTA, 0.5% Nonidet P-40, and then twice in the same buffer containing 100 mM NaCl. The anti-Cdk2 immunoprecipitates were electrophoretically separated in a 12.5% SDS-polyacrylamide gel and transferred to nitrocellulose. After blocking, the filter was incubated with mAbs against Cdk2 or p27Kip1 (Transduction Laboratories), then incubated with a horseradish peroxidase-conjugated secondary Ab specific for mouse IgG (Amersham).
Biosynthetic labeling
Cells were preincubated in the presence or absence of 2 ng/ml TGF-ß1. After 12 h, the cells were washed twice and then resuspended in RPMI 1640 lacking methionine, and supplemented with 10% dialyzed FCS. TGF-ß1 (2 ng/ml) was added to the wash as was resuspension medium for cells preincubated with TGF-ß1. Approximately 5 x 106 cells were pulsed for 60 min with 400 µCi of [35S]methionine in 2 ml of RPMI 1640 lacking methionine, and supplemented with 10% dialyzed FCS. Equal amounts of TCA-precipitable radioactivity were incubated with 10 µl of rabbit antisera against p27Kip1 (MBL) using procedures similar to those described above except that the immune complexes were washed eight times with the lysis buffer. The washed immunoprecipitates were fractioned on a reducing SDS gel, and the amount of p27Kip1 was determined by fluorography.
Histone H1 kinase assays
Cdk2-associated kinase activity was assayed in anti-Cdk2
immune complexes. Cell lysates were prepared as described for
immunoprecipitation. Total protein used for each experiment was
normalized using the Bradford assay (Bio-Rad Laboratories, Hercules,
CA). After washing the immune complexes, the beads were washed again
with kinase buffer (50 mM Tris-HCl,pH 7.5, 10 mM
MgCl2, and 1 mM DTT). To the washed beads, kinase
buffer, 5 µg of histone H1 (Boehringer Mannheim Biochemicals), 1 µM
ATP, and 10 µCi of [
-32P]ATP (6000 Ci/mmol) were
added to a final volume of 50 µl. The reaction was incubated at
30°C for 30 min and stopped by the addition of SDS sample buffer.
After boiling, samples were electrophoresed through a 10% SDS
polyacrylamide gel. The dried gel was exposed to x-ray film. The film
was used to determine radioactivity levels in these samples, employing
Bio-Imaging Analyzer model BAS-2000 (Fuji Photo Film, Tokyo, Japan).
Background levels of kinase activity were determined on samples
isolated by immunoprecipitation with normal rabbit serum.
Cloning p53
Forward (TGTCAAGCTTCTCCGAAGACTGGATG) and reverse (GGGAATCGATGCAGAGGCAGTCAGTCT) primers were designed to include the entire coding sequence of mouse p53 and to introduce HindIII and ClaI sites. Whole-cell RNA from CH31 cells was reverse transcribed using random hexamers, and p53 cDNA was amplified by PCR using these primers. A product of the anticipated size was obtained and cloned into the HindIII-ClaI site of Bluescript SK (Stratagene; La Jolla, CA). Three independent reverse transcriptase-PCR reactions were performed to obtain 24 clones of p53 cDNA. dsDNA was sequenced using a Sequencing PRO kit (Toyobo, Tokyo, Japan).
Luciferase reporter assays
Saos-2 cells were plated into 100-mm tissue culture dishes at a density of 5 x 105 cells per dish and grown for 24 h. Cells were cotransfected with 2 µg of the luciferase reporter plasmid pCAST2Bluc (38) and 1 µg of the wild-type p53 expression construct, 1 µg of the CH31 mutant p53 expression construct, or 1 µg of the parental expression vector; 7 µg of a ß-galactosidase reporter construct was included to normalize luciferase activity to transfection efficiency. Transfections were performed by the standard calcium phosphate-DNA coprecipitation method with glycerol shock (39). Luciferase activity was assayed 36 h after transfection.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To investigate whether TGF-ß1 affects the
steady state level of p27Kip1 mRNA in B cells,
we studied the effect of TGF-ß1 on
p27Kip1 mRNA in CH31, a murine B cell line that
can be growth arrested in G1 by TGF-ß1 (29).
CH31 cells were treated with TGF-ß1 for various time
periods, and Northern blot analysis was performed. As shown in Figure 1
, the steady state level of the major
p27Kip1 mRNA (
2.8 kb) in CH31 cells
approximately doubled after 6 h of treatment with
TGF-ß1 and remained at that level for up to 12 h.
Northern blot analysis also showed a a threefold and sixfold increase
of the minor p27Kip1 mRNA (6.0 kb) levels in
CH31 cells at 6 h and 12 h, respectively. In contrast to its
effect on CH31 cells, TGF-ß1 caused little or no increase
of p27Kip1 mRNA levels in HaCaT epithelial
cells (9).
|
1 h either in the presence or absence
of TGF-ß1 (data not shown). Therefore, the turnover of
major p27Kip1 mRNA was TGF-ß1
independent, suggesting that its induction is attributable to an
increased transcription rate. (The amount of minor
p27Kip1 was too small to permit evaluation of
its half-life.) This result prompted us to perform run-off experiments
to examine newly initiated transcription of the
p27Kip1 gene. However, new
p27Kip1 transcripts have not been detected
either in the presence or absence of TGF-ß1 in run-off
experiments. TGF-ß1 up-regulates p27Kip1 protein levels in murine B cell lines
We next examined whether the observed induction of the
p27Kip1 mRNA leads to an increase in the
p27Kip1 protein level. Immunoblot analysis
revealed an approximately threefold increase of
p27Kip1 protein in CH31 cells treated with
TGF-ß1 for 12 h (Fig. 2A). This
TGF-ß1-mediated induction of
p27Kip1 protein is not a unique phenomenon,
since we also observed an approximately threefold increase of
p27Kip1 protein in WEHI231, another murine B
cell line, after a 12-h TGF-ß1 treatment (data not
shown). In contrast to these observations in B cells,
TGF-ß1 only marginally increased the
p27Kip1 protein levels in HaCaT epithelial
cells, consistent with previous observations (20) (Fig. 2A). The time course of
p27Kip1 protein induction, upon
TGF-ß1 treatment, paralleled an inhibition of CH31 DNA
synthesis as assayed by [3H]thymidine incorporation (Fig. 2B).
|
A). Thus, the turnover
of p27Kip1 protein appeared to be
TGF-ß1 independent.
|
B,
TGF-ß1 treatment resulted in a threefold increase in the
synthesis of p27Kip1 protein. Since this
increase in the synthesis rate of p27Kip1
protein is greater than the increase in the steady state levels of
major p27Kip1 mRNA, translational control might
also contribute to the TGF-ß1-dependent up-regulation of
p27Kip1 protein. TGF-ß1 increases the amount of p27Kip1 associated with Cdk2
To test whether the TGF-ß1-induced increase in
p27Kip1 leads to association with its Cdk
targets (17, 18, 19), protein extracts from TGF-ß1 treated
and untreated CH31 cells were immunoprecipitated with anti-Cdk2
antisera, and then p27Kip1 protein was
quantitated by immunoblot, using
anti-p27Kip1 mAbs. As shown in Figure 4, TGF-ß1 treatment
resulted in an increased association of p27Kip1
with Cdk2.
|
Since p27Kip1 has been previously shown to
inhibit the kinase activity of cyclin E-Cdk2 complexes, we analyzed the
activity of Cdk2 upon TGF-ß1 treatment (17, 18, 19). Cdk2 was
immunoprecipitated from both TGF-ß1-treated and
-untreated CH31 cells, and the activity of Cdk2 was assayed by
measuring its ability to phosphorylate an exogenous substrate, histone
H1. As shown in Figure 5,
TGF-ß1 treatment resulted in a marked decrease in Cdk2
kinase activity. This observed decrease in Cdk2 kinase activity upon
TGF-ß1 treatment is consistent with
p27Kip1-Cdk2 association, since Cdk2 protein
levels remained almost constant after TGF-ß1 treatment
(Fig. 4).
|
We next examined whether TGF-ß1 induces cell
cycle arrest through other mechanisms previously described for
epithelial cells. Ewen et al. (7) have suggested that
TGF-ß1 inhibits cell cycle progression through
posttranscriptional down-regulation of Cdk4 in Mv1Lu mink lung
epithelial cells. Thus, we studied Cdk4 protein levels in CH31 and
WEHI231 cells after TGF-ß1 treatment. As shown in Figure 6, TGF-ß1 had litttle or no
effect on Cdk4 protein levels in these B cells. In contrast to these
findings, however, TGF-ß1 reduced Cdk4 protein levels in
HaCaT epithelial cells, consistent with previous observations
(20).
|
Recent studies have suggested that TGF-ß1
induces cell cycle arrest in epithelial cells through transcriptional
up-regulation of p15INK4b and
p21WAF1/Cip1 (20, 21, 22, 23). We therefore proceeded to
determine p15INK4b and
p21WAF1/Cip1 mRNA and protein levels in CH31 and
WEHI231 cells after incubation with TGF-ß1. Addition of
TGF-ß1 resulted in a fourfold increase in the steady
state level of p15INK4b mRNA in treated as
compared with untreated CH31 cells (Fig. 7A).
TGF-ß1 also induced p15INK4b mRNA
in HaCaT epithelial cells as previously described (9). However, even
after TGF-ß1 treatment, we failed to detect
p15INK4b protein in CH31 or WEHI231 cells by
immunoblot analysis, probably due to its presence at low levels (Fig. 7B). Thus, we could not determine the effect of
TGF-ß1 on p15INK4b protein levels
in these B cells. By immunoprecipitation, following biosynthetic
labeling, Hannon et al. previously showed that TGF-ß1
increases p15INK4b protein associated with Cdk4
and Cdk6 in HaCaT cells (9). However, immunoblotting also failed to
detect p15INK4b protein in HaCaT cells even
after TGF-ß1 treatment (Fig. 7B).
|
, C and
D). This lack of response of these B cells to
TGF-ß1 is not a nonspecific effect, since other
p53-independent inducers of p21WAF1/Cip1, such
as diethylmaleate (40) or PMA (41), activated the
p21WAF1/Cip1 gene (Fig. 7E).
Taken together, these results indicate that
TGF-ß1-mediated inhibition of the cell cycle does not
occur through the induction of p21WAF1/Cip1
proteins in B cells. TGF-ß1 induces p27Kip1through a p53-independent mechanism
Numerous studies have suggested that loss of response to
TGF-ß1 is correlated with loss of function of p53 in
various types of epithelial cells (26). More directly, several studies
have demonstrated abrogation of the TGF-ß1 response in
epithelial cells by inhibition of endogenous wild-type p53, indicating
a direct role of p53 in TGF-ß1-mediated cell cycle arrest
(27, 28, 42). To our knowledge, the role of p53 in
TGF-ß1-induced cell cycle arrest remains unknown in B
cells. Since our results indicated that TGF-ß1 inhibits
cell cycle progression in B cells through mechanisms different from
those of epithelial cells, we wanted to determine the role of p53 in
TGF-ß1-mediated cell cycle arrest in B cells. To study
the endogenous p53 mRNA status, we first obtained 1300-base-pair cDNA
fragments, including the entire p53 coding region, from CH31 and
WEHI231 cells. As shown in Figure 8A, direct sequencing of the
CH31 p53 cDNA fragments demonstrated a single missense mutation at
codon 279 (Arg 
His). (Our preliminary study revealed that WEHI231
expresses both wild-type and mutant p53; therefore, no further
investigations were performed regarding the p53 status of WEHI231
cells.) We confirmed that CH31 exclusively expresses this mutated p53
mRNA by cloning the p53 cDNA fragments and sequencing 24 clones. All
clones showed the identical missense mutation, indicating the exclusive
expression of this mutant mRNA in CH31 cells.
|
B).
The amino acid residue mutated in the CH31 p53 protein may play an
important functional role. This is suggested by the fact that this
residue is highly conserved among species (43). We investigated the
functional consequences of the CH31 p53 mutation by inserting the CH31
p53 cDNA into the expression vector pRc-CMV (Invitrogen, Carlsbad, CA).
Its function was studied by cotransfection with the luciferase reporter
plasmid pCAST2Bluc containing two copies of the p53-binding sequence
(38). Transfections were performed in the human osteosarcoma cell line
Saos-2, which, because of a lack of endogenous p53, provides a
"clean" background for this type of study. As shown in Figure 8C, the transcriptional activation produced by the
CH31-derived mutant p53 protein was only 6.7% of that observed in
wild-type p53. This result prompted us to examine whether x-ray
irradiation would still induce p21WAF1/Cip1 mRNA
in CH31 cells, since x-ray irradiation stimulates the transcription of
the p21WAF1/Cip1 gene in a p53-dependent manner
(11, 44). Consistent with the result of the luciferase reporter
assay, x-ray irradiation had little or no effect on
p21WAF1/Cip1 mRNA steady state levels in
CH31 cells (Fig. 7E). We also studied the effect of
x-ray irradiation on the mRNA levels of other p53-responsive genes such
as GADD45 or bax (25, 45). X-ray irradiation also
showed little or no effect on GADD45 or bax mRNA
levels in CH31 cells (data not shown). Taken together, these results
suggest that mutant p53 proteins expressed in CH31 cells are incapable
of transcriptionally activating the p27Kip1
promotor. Furthermore, these findings support that TGF-ß1
induces cell cycle arrest in B cells through up-regulation of
p27Kip1 mRNA in a p53-independent manner.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Previous work has suggested that TGF-ß1 induces cell cycle arrest through a number of mechanisms (7, 20, 21, 22, 23). In epithelial cell lines, TGF-ß1-mediated arrest appears to involve translational down-regulation of Cdk4 (7). Moreover, recent studies have suggested that TGF-ß1 inhibits Cdk activities in epithelial cell lines through transcriptional up-regulation of p15INK4b and/or p21WAF1/Cip1 (20, 21, 22, 23). However, TGF-ß1 has little or no effect on p27Kip1 mRNA and protein levels in these epithelial cell lines.
In contrast to these observations in epithelial cell lines, we have shown here the TGF-ß1-mediated induction of p27Kip1 mRNA and protein in B cells. Moreover, TGF-ß1 neither down-regulated Cdk4 nor up-regulated p21WAF1/Cip1 in these cells. The results presented underline the cell type-dependent variations in the effect of TGF-ß1 on cell cycle regulators.
Several studies have shown abrogation of TGF-ß1 responsiveness by the inhibition of endogenous wild-type p53, suggesting a direct role of p53 in TGF-ß1-induced cell cycle arrest in epithelial cells (27, 42). Recently, Ewen et al. (28) proposed p53-dependent down-regulation of Cdk4 as a mechanism by which p53 mediates the growth-inhibitory effects of TGF-ß1 in epithelial cells. However, the exact role of p53 in the TGF-ß1 signaling pathway is still controversial and remains to be determined.
Given the inhibition by TGF-ß1 of cell cycle progression in B cells through mechanisms different from epithelial cells, we wished to evaluate the significance of p53 in TGF-ß1-mediated cell cycle arrest in these cells. We studied the p53 status in CH31 and WEHI231 cells and found the exclusive expression of mutant p53 mRNA and protein in CH31 cells. This mutant p53 protein showed only a weak transactivation activity in the luciferase reporter assay. Consistent with this result, there was little or no activation of p53-responsive genes such as p21WAF1/Kip1, GADD45, or baxin the irradiated CH31 cells. Based on these observations, we conclude that TGF-ß1 induces cell cycle arrest through up-regulation of p27Kip1in a p53-independent manner. However, it is still possible that TGF-ß1 inhibits cell cycle progression through p53-dependent down-regulation of Cdk4 in B cells expressing wild-type p53.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Abbreviation used in this paper: Cdk, cyclin-dependent kinase.
Received for publication April 28, 1997. Accepted for publication October 7, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
receptor to surface immunoglobulin on B cells provides an inhibitory signal that closes the plasma membrane calcium channel. J. Biol. Chem. 269:11409.This article has been cited by other articles:
|
|
 |
|
  S. Tsai, S. T. Hollenbeck, E. J. Ryer, R. Edlin, D. Yamanouchi, R. Kundi, C. Wang, B. Liu, and K. C. Kent TGF-{beta} through Smad3 signaling stimulates vascular smooth muscle cell proliferation and neointimal formation Am J Physiol Heart Circ Physiol, August 1, 2009; 297(2): H540 - H549. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. C. Spender and G. J. Inman TGF-{beta} Induces Growth Arrest in Burkitt Lymphoma Cells via Transcriptional Repression of E2F-1 J. Biol. Chem., January 16, 2009; 284(3): 1435 - 1442. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Song, C. Zhao, L. Dong, M. Fu, L. Xue, Z. Huang, T. Tong, Z. Zhou, A. Chen, Z. Yang, et al. Overexpression of cyclin B1 in human esophageal squamous cell carcinoma cells induces tumor cell invasive growth and metastasis Carcinogenesis, February 1, 2008; 29(2): 307 - 315. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Chang, Y. Fan, S. Karyala, S. Schwemberger, C. R. Tomlinson, M. A. Sartor, and A. Puga Ligand-Independent Regulation of Transforming Growth Factor {beta}1 Expression and Cell Cycle Progression by the Aryl Hydrocarbon Receptor Mol. Cell. Biol., September 1, 2007; 27(17): 6127 - 6139. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Klein, W. Ju, J. Heyer, B. Wittek, T. Haneke, P. Knaus, R. Kucherlapati, E. P. Bottinger, L. Nitschke, and B. Kneitz B Cell-Specific Deficiency for Smad2 In Vivo Leads to Defects in TGF-beta-Directed IgA Switching and Changes in B Cell Fate J. Immunol., February 15, 2006; 176(4): 2389 - 2396. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Siegenthaler and M. W. Miller Transforming Growth Factor {beta}1 Promotes Cell Cycle Exit through the Cyclin-Dependent Kinase Inhibitor p21 in the Developing Cerebral Cortex J. Neurosci., September 21, 2005; 25(38): 8627 - 8636. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Chandramohan, S. Jeay, S. Pianetti, and G. E. Sonenshein Reciprocal Control of Forkhead box O 3a and c-Myc via the Phosphatidylinositol 3-Kinase Pathway Coordinately Regulates p27Kip1 Levels J. Immunol., May 1, 2004; 172(9): 5522 - 5527. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. H. Nelson, T. P. Martyak, L. J. Thompson, J. J. Moon, and T. Wang Uncoupling of Promitogenic and Antiapoptotic Functions of IL-2 by Smad-Dependent TGF-{beta} Signaling J. Immunol., June 1, 2003; 170(11): 5563 - 5570. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Dao, J. Hwa, and J. A. Nolta Molecular mechanism of transforming growth factor beta -mediated cell-cycle modulation in primary human CD34+ progenitors Blood, January 15, 2002; 99(2): 499 - 506. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Husson, E. G. Carideo, D. Neuberg, J. Schultze, O. Munoz, P. W. Marks, J. W. Donovan, A. C. Chillemi, P. O'Connell, and A. S. Freedman Gene expression profiling of follicular lymphoma and normal germinal center B cells using cDNA arrays Blood, January 1, 2002; 99(1): 282 - 289. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Zhang, K. Graziano, T. Pham, C. D. Logsdon, and D. M. Simeone Adenovirus-mediated gene transfer of dominant-negative Smad4 blocks TGF-{beta} signaling in pancreatic acinar cells Am J Physiol Gastrointest Liver Physiol, June 1, 2001; 280(6): G1247 - G1253. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. J. Appleman, A. Berezovskaya, I. Grass, and V. A. Boussiotis CD28 Costimulation Mediates T Cell Expansion Via IL-2-Independent and IL-2-Dependent Regulation of Cell Cycle Progression J. Immunol., January 1, 2000; 164(1): 144 - 151. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Pan, C. J. Hetherington, and D.-E. Zhang CCAAT/Enhancer-binding Protein Activates the CD14 Promoter and Mediates Transforming Growth Factor beta Signaling in Monocyte Development J. Biol. Chem., August 13, 1999; 274(33): 23242 - 23248. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Taniguchi, H. Endo, N. Chikatsu, K. Uchimaru, S. Asano, T. Fujita, T. Nakahata, and T. Motokura Expression of p21Cip1/Waf1/Sdi1 and p27Kip1 Cyclin-Dependent Kinase Inhibitors During Human Hematopoiesis Blood, June 15, 1999; 93(12): 4167 - 4178. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Sudarshan, J. Galon, Y.-j. Zhou, and J. J. O'Shea TGF-{beta} Does Not Inhibit IL-12- and IL-2-Induced Activation of Janus Kinases and STATs J. Immunol., March 1, 1999; 162(5): 2974 - 2981. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
2 cells (lane
C) expressing an exogenous full-length p53 mutant (a
positive control), untreated CH31 cells (0
hr), CH31 cells treated with TGF-ß1 for
6 h (6 hr), and CH31 cells treated with
TGF-ß1 for 12 h (12 hr).
C, Functional analysis of mutant p53 derived from CH31
cells. The transactivation activity of the mutant p53 derived from CH31
cells was determined by cotransfecting 2 µg of pCAST2Bluc, 7 µg of
a ß-galactosidase reporter construct, and 1 µg of the p53
expression constructs into Saos-2 and measuring luciferase activity.
Luciferase activity was normalized to the ß-galactosidase activity,
and the level of wild-type p53 transactivation was set at 100%.
Results are shown from two independent experiments, each with two
independent transfections (error bars, range).