The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kamesaki, H.
Right arrow Articles by Kiyono, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kamesaki, H.
Right arrow Articles by Kiyono, T.
The Journal of Immunology, 1998, 160: 770-777.
Copyright © 1998 by The American Association of Immunologists

TGF-ß1 Induces the Cyclin-Dependent Kinase Inhibitor p27Kip1 mRNA and Protein in Murine B Cells

Hiroshi Kamesaki*, Kimiko Nishizawa*, Ginette Y. Michaud{ddagger}, Jeffrey Cossman{ddagger} and Tohru Kiyono{dagger}

Laboratories of * Experimental Radiology and {dagger} Viral Oncology, Aichi Cancer Center Research Institute, Chikusa-ku, Nagoya, Aichi, Japan; and {ddagger} Department of Pathology, Georgetown University, Washington, DC 20007


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TGF-ß1 inhibits the cell cycle progression of many types of cells by arresting them in the G1 phase. This cell cycle arrest has been attributed to the regulatory effects of TGF-ß1 on both the levels and the activities of the G1 cyclins and their kinase partners. The activities of these kinases are negatively regulated by a number of proteins, such as p15INK4b, p21WAF1/Cip1, and p27Kip1, that physically associate with cyclins, cyclin-dependent kinases (Cdk), or cyclin-Cdk complexes. In epithelial cell lines, TGF-ß1 was previously shown to inhibit cell cycle progression through down-regulation of Cdk4 and/or up-regulation of p15INK4b and/or p21WAF1/Cip1. However, TGF-ß1 had little or no effect on the p27Kip1 mRNA and protein levels. In this report, we show that, in contrast to observations in epithelial cell lines, TGF-ß1 increased the p27Kip1 mRNA and protein levels in the murine B cell lines CH31 and WEHI231. This TGF-ß1-mediated induction of p27Kip1 also resulted in an increased association of p27Kip1 with Cdk2 and a decreased Cdk2 kinase activity. In contrast to epithelial cells, however, TGF-ß1 had little or no effect on the Cdk4 and p21WAF1/Cip1 protein levels in these B cells. Finally, although several studies suggested a direct role of p53 in TGF-ß1-mediated cell cycle arrest in epithelial cells, TGF-ß1 inhibited cell cycle progression in CH31 even in the absence of wild-type p53. Taken together, these results suggest that TGF-ß1 induces G1 arrest in B cells primarily through a p53-independent up-regulation of p27Kip1 protein.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Transforming growth factor ß1 is a multifunctional hormone. It inhibits progression through G1 in many cell types, including epithelial, lymphoid, and endothelial cells (1, 2, 3). Progression of cells through the G1 phase of the cell cycle is dependent on the sequential formation, activation, and subsequent inactivation of the G1 cyclin-cyclin dependent kinase (Cdk)2 complexes. These complexes consist primarily of cyclin D-Cdk4, cyclin D-Cdk6 and cyclin E-Cdk2 (4, 5, 6).

The TGF-ß1-induced G1 cell cycle arrest in epithelial cells has been at least partially attributed to the regulatory effects of this hormone on both the levels and activities of G1 cyclins and Cdks (7, 8). TGF-ß1 inhibits the expression of Cdk4, thus preventing activation of the cyclin D-Cdk4 complex in G1. This occurs in the absence of a direct effect by TGF-ß1 on cyclin D expression (7). In contrast to this, TGF-ß1 blocks activation of the cyclin E-Cdk2 complex without affecting the expression levels of either Cdk2 or cyclin E. This suggests that TGF-ß1 has a role in mediating the induction of inhibitors of cyclin E-Cdk2 complex (8).

Recently, a family of Cdk inhibitors has been shown to play an essential role in blocking cell cycle progression. Cdk inhibitors, such as p27Kip1, p15INK4b, and p21WAF1/Cip1, are known to physically associate with their target cyclin-Cdk complexes to inhibit their activities (9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19). The Cdk inhibitor p27Kip1 is highly conserved and broadly expressed in mammalian tissues (18). It is a heat-stable protein with a region of sequence similarity to p21WAF1/Cip1, the Cdk inhibitor in which transcription is stimulated by p53 (18, 19).

Proliferating Mv1Lu mink lung epithelial cells and human keratinocytes contain high levels of p27Kip1 distributed in complexes with Cdk2, Cdk4, and Cdk6 (20). TGF-ß1 is known to havelittle or no effect on p27Kip1 mRNA or protein levels in these two epithelial cell types. However, TGF-ß1 elevates the expression of the Cdk4/Cdk6-specific inhibitor p15INK4b and consequently induces the transfer of p27Kip1 from Cdk4 and/or Cdk6 to Cdk2 (20). In keratinocytes and some other cell types, TGF-ß1 increases p21WAF1/Cip1 that binds to Cdk2 and inhibits its kinase activity (21, 22, 23).

On the basis of these observations, TGF-ß1 is now considered to induce G1 arrest in epithelial cells mainly by down-regulation of Cdk4 and/or up-regulation of p15INK4b and/or p21WAF1/Cip1. TGF-ß1 also induces cell cycle arrest in B cells. However, little is known about its effects on Cdks or Cdk inhibitors in these cells.

The nuclear protein p53 is now firmly established as a key negative regulator of cell proliferation (24). Recently, much emphasis has been placed on the role of p53 in arresting cells at the G1/S interface in response to DNA damage (25). However, it is probable that wild-type p53 also has a role in other cellular growth-inhibitory signaling pathways. The correlation of p53 mutation with loss of TGF-ß1 responsiveness in many epithelial cell lines suggests that TGF-ß1 may be the trigger for one such signaling pathway (26). More direct support for this hypothesis has come from results by Mogi et al. (27) and Ewen et al. (28) who reported that the sensitivity of their epithelial cells to TGF-ß1 was reduced by the inhibition of endogenous wild-type p53. To our knowledge, nothing is known about the role of p53 in TGF-ß1-mediated cell cycle arrest in B cells.

In this report, we show that TGF-ß1 induces p27Kip1 mRNA and protein in the TGF-ß1-sensitive B cell lines CH31 and WEHI231 (29). Moreover, TGF-ß1 has little or no effect on Cdk4 or p21WAF1/Cip1protein levels in these same cells. Both of these findings are in sharp contrast to observations in epithelial cell lines. Finally, the induction of p27Kip1 appears to be p53 independent, since CH31 cells exclusively expressed mutant p53. Taken together, our findings suggest that TGF-ß1 controls cell cycle progression in B cells through mechanisms different from epithelial cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture

CH31, A20, HaCaT, and Saos-2 cells were generous gifts of Dr. Geoffrey Haughton (University of North Carolina at Chapel Hill, NC), Dr. Takashi Nishimura (Tokai University School of Medicine, Isehard, Japan), Dr. Norbert E. Fusenig (German Cancer Research Center, Heidelberg, Germany), and Dr. Mitsuo V. Kato (The Institute of Physical and Chemical Research, Tsukuba, Japan), respectively (30, 31, 32, 33). WEHI231 cells were obtained from the American Type Culture Collection (Rockville, MD). These cell lines were maintained as described in detail elsewhere (31, 32, 33, 34). TGF-ß1 was purchased from Boehringer Mannheim (Mannheim, Germany).

Growth inhibition assay

Growth inhibition was examined by [3H]thymidine uptake as previously described (34). Cells were cultured in triplicate at 1 x 104/100 µl in 96-well flat-bottom microtiter plates in the presence of 2 ng/ml TGF-ß1. At the specified time, the cell cultures were pulsed with 0.5 µCi/well [3H]thymidine for 1 h before harvesting onto glass fiber filters. [3H]thymidine incorporation into the DNA was measured with a scintillation counter. The results are expressed as the percentage of untreated cell growth (i.e., no TGF- ß1).

Northern blot

Whole-cell RNA was extracted from tissue culture cells by the method of Chomczynski and Sacchi (35). Fifteen micrograms of total RNA from each source was electrophoretically separated on a 1% formaldehyde/agarose gel and transferred to a nylon membrane. Membranes were hybridized and washed as previously described (36).

Immunoblotting

For the determination of p53 protein levels, cell extracts were prepared as described previously (37). For the determination of p15INK4b, p21WAF1/Cip1, and p27Kip1 protein levels, cells were lysed in Nonidet P-40 buffer (1.0% Nonidet P-40, 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 2 mM EDTA, 50 µg/ml PMSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin). Cell lysates (60 µg) were resolved by 12.5% SDS-PAGE (10% in the case of p53) and transferred to nitrocellulose membranes. mAbs to Cdk2, Cdk4, and p27Kip1 (Transduction Laboratories, Lexington, KY) and polyclonal Abs to p15INK4b and p21WAF1/Cip1 (Santa Cruz Biotechnology, Santa Cruz, CA) were used as primary Abs to detect these proteins. Incubation of the blots with primary Abs was followed by incubation with horseradish peroxidase-conjugated anti-mouse or anti-rabbit Abs (Amersham, Buckinghamshire, U.K.). Bands were visualized by chemiluminescence (ECL; Amersham).

Immunoprecipitation

For immunoprecipitation followed by immunoblotting, cells were washed once with cold PBS and lysed for 30 min on ice in 50 mM Tris-HCl (pH 8.0), 200 mM NaCl, 0.5% Nonidet P-40 containing 50 µg/ml PMSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin, 1 mM DTT, 20 mM NaF, 20 mM ß-glycerophosphate, and 0.1 mM sodium orthovanadate. Lysates were centrifuged for 15 min at 12,000 x g, and the affinity-purified rabbit anti-Cdk2 antisera (Upstate Biotechnology, Lake Placid, NY) was added and incubated overnight at 4°C. Immune complexes were collected on protein A-Sepharose beads (Pharmacia, Uppsala, Sweden), washed three times in 20 mM Tris-Hcl (pH 8.0) containing 250 mM NaCl, 1 mM EDTA, 0.5% Nonidet P-40, and then twice in the same buffer containing 100 mM NaCl. The anti-Cdk2 immunoprecipitates were electrophoretically separated in a 12.5% SDS-polyacrylamide gel and transferred to nitrocellulose. After blocking, the filter was incubated with mAbs against Cdk2 or p27Kip1 (Transduction Laboratories), then incubated with a horseradish peroxidase-conjugated secondary Ab specific for mouse IgG (Amersham).

Biosynthetic labeling

Cells were preincubated in the presence or absence of 2 ng/ml TGF-ß1. After 12 h, the cells were washed twice and then resuspended in RPMI 1640 lacking methionine, and supplemented with 10% dialyzed FCS. TGF-ß1 (2 ng/ml) was added to the wash as was resuspension medium for cells preincubated with TGF-ß1. Approximately 5 x 106 cells were pulsed for 60 min with 400 µCi of [35S]methionine in 2 ml of RPMI 1640 lacking methionine, and supplemented with 10% dialyzed FCS. Equal amounts of TCA-precipitable radioactivity were incubated with 10 µl of rabbit antisera against p27Kip1 (MBL) using procedures similar to those described above except that the immune complexes were washed eight times with the lysis buffer. The washed immunoprecipitates were fractioned on a reducing SDS gel, and the amount of p27Kip1 was determined by fluorography.

Histone H1 kinase assays

Cdk2-associated kinase activity was assayed in anti-Cdk2 immune complexes. Cell lysates were prepared as described for immunoprecipitation. Total protein used for each experiment was normalized using the Bradford assay (Bio-Rad Laboratories, Hercules, CA). After washing the immune complexes, the beads were washed again with kinase buffer (50 mM Tris-HCl,pH 7.5, 10 mM MgCl2, and 1 mM DTT). To the washed beads, kinase buffer, 5 µg of histone H1 (Boehringer Mannheim Biochemicals), 1 µM ATP, and 10 µCi of [{gamma}-32P]ATP (6000 Ci/mmol) were added to a final volume of 50 µl. The reaction was incubated at 30°C for 30 min and stopped by the addition of SDS sample buffer. After boiling, samples were electrophoresed through a 10% SDS polyacrylamide gel. The dried gel was exposed to x-ray film. The film was used to determine radioactivity levels in these samples, employing Bio-Imaging Analyzer model BAS-2000 (Fuji Photo Film, Tokyo, Japan). Background levels of kinase activity were determined on samples isolated by immunoprecipitation with normal rabbit serum.

Cloning p53

Forward (TGTCAAGCTTCTCCGAAGACTGGATG) and reverse (GGGAATCGATGCAGAGGCAGTCAGTCT) primers were designed to include the entire coding sequence of mouse p53 and to introduce HindIII and ClaI sites. Whole-cell RNA from CH31 cells was reverse transcribed using random hexamers, and p53 cDNA was amplified by PCR using these primers. A product of the anticipated size was obtained and cloned into the HindIII-ClaI site of Bluescript SK (Stratagene; La Jolla, CA). Three independent reverse transcriptase-PCR reactions were performed to obtain 24 clones of p53 cDNA. dsDNA was sequenced using a Sequencing PRO kit (Toyobo, Tokyo, Japan).

Luciferase reporter assays

Saos-2 cells were plated into 100-mm tissue culture dishes at a density of 5 x 105 cells per dish and grown for 24 h. Cells were cotransfected with 2 µg of the luciferase reporter plasmid pCAST2Bluc (38) and 1 µg of the wild-type p53 expression construct, 1 µg of the CH31 mutant p53 expression construct, or 1 µg of the parental expression vector; 7 µg of a ß-galactosidase reporter construct was included to normalize luciferase activity to transfection efficiency. Transfections were performed by the standard calcium phosphate-DNA coprecipitation method with glycerol shock (39). Luciferase activity was assayed 36 h after transfection.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TGF-ß1 induces p27Kip1mRNA in murine B cell lines

To investigate whether TGF-ß1 affects the steady state level of p27Kip1 mRNA in B cells, we studied the effect of TGF-ß1 on p27Kip1 mRNA in CH31, a murine B cell line that can be growth arrested in G1 by TGF-ß1 (29). CH31 cells were treated with TGF-ß1 for various time periods, and Northern blot analysis was performed. As shown in Figure 1Go, the steady state level of the major p27Kip1 mRNA (~2.8 kb) in CH31 cells approximately doubled after 6 h of treatment with TGF-ß1 and remained at that level for up to 12 h. Northern blot analysis also showed a a threefold and sixfold increase of the minor p27Kip1 mRNA (~6.0 kb) levels in CH31 cells at 6 h and 12 h, respectively. In contrast to its effect on CH31 cells, TGF-ß1 caused little or no increase of p27Kip1 mRNA levels in HaCaT epithelial cells (9).



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 1. Induction of p27Kip1 mRNA by TGF-ß1. Time course of p27Kip1 mRNA induction by TGF-ß1. RNA was isolated from CH31 or HaCaT cells treated with 2 ng/ml TGF-ß1 for various time periods. Each lane contains 15 µg of total RNA from CH31 or HaCaT cells. Northern blots probed with a 32P-labeled p27Kip1 cDNA fragment showed the expression of a major p27Kip1 mRNA (~2.8 kb) and a minor p27Kip1 mRNA (~6.0 kb) in CH31 cells. The same filter was stripped and rehybridized with a rat glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) cDNA probe as a control for the amount of applied RNA. Each sample measurement was calculated as a ratio of the average area of the p27Kip1 mRNA and the control GAPDH mRNA. The ratios for the major p27Kip1 mRNA corresponding to 0 h, 6 h, and 12 h were 0.2, 0.4, and 0.5, respectively. The ratios for the minor p27Kip1 mRNA corresponding to 0 h, 6 h, and 12 h were 0.04, 0.13, and 0.26, respectively. Northern blots using total RNA from HaCaT epithelial cells also revealed the expression of p27Kip1 mRNA (~2.5 kb). The same filter was stripped and then rehybridized with human ribosomal RNA probe to confirm that equivalent amounts of RNA were loaded. Each sample measurement was calculated as a ratio of the average area of the p27Kip1 mRNA and the ribosomal RNA (18S). The ratios for the p27Kip1 mRNA corresponding to 0 h and 10 h were 0.21 and 0.22, respectively.

 
Actinomycin D (10 µg/ml) was added to CH31 cells to compare the turnover of p27Kip1 mRNA in the presence or absence of TGF-ß1. The major p27Kip1 mRNA had a similar t1/2 of ~1 h either in the presence or absence of TGF-ß1 (data not shown). Therefore, the turnover of major p27Kip1 mRNA was TGF-ß1 independent, suggesting that its induction is attributable to an increased transcription rate. (The amount of minor p27Kip1 was too small to permit evaluation of its half-life.) This result prompted us to perform run-off experiments to examine newly initiated transcription of the p27Kip1 gene. However, new p27Kip1 transcripts have not been detected either in the presence or absence of TGF-ß1 in run-off experiments.

TGF-ß1 up-regulates p27Kip1 protein levels in murine B cell lines

We next examined whether the observed induction of the p27Kip1 mRNA leads to an increase in the p27Kip1 protein level. Immunoblot analysis revealed an approximately threefold increase of p27Kip1 protein in CH31 cells treated with TGF-ß1 for 12 h (Fig. 2GoA). This TGF-ß1-mediated induction of p27Kip1 protein is not a unique phenomenon, since we also observed an approximately threefold increase of p27Kip1 protein in WEHI231, another murine B cell line, after a 12-h TGF-ß1 treatment (data not shown). In contrast to these observations in B cells, TGF-ß1 only marginally increased the p27Kip1 protein levels in HaCaT epithelial cells, consistent with previous observations (20) (Fig. 2GoA). The time course of p27Kip1 protein induction, upon TGF-ß1 treatment, paralleled an inhibition of CH31 DNA synthesis as assayed by [3H]thymidine incorporation (Fig. 2GoB).



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 2. Induction of p27Kip1 protein by TGF-ß1. A, Effect of TGF-ß1 on the level of p27Kip1 protein. Immunoblot analysis was performed on whole-cell lysates prepared from CH31 or HaCaT cells incubated with 2 ng/ml TGF-ß1 for various time periods. Each lane contains 60 µg of protein from CH31 or HaCaT cells. Lane C contains 60 µg of protein from NIH3T3 cells as a positive control. B, Time course of p27Kip1 protein induction vs DNA synthesis upon TGF-ß1 treatment. Immunoblot analysis was performed on whole-cell lysates prepared from CH31 cells incubated with 2 ng/ml TGF-ß1 for various time periods. [3H]Thymidine incorporation was measured on similarly treated CH31 cells; incorporation is relative to CH31 cells not treated with TGF-ß1. Results are shown by means of triplicates.

 
Cycloheximide (10 µg/ml) was added to CH31 cells to compare the rates of p27Kip1 protein degradation in the presence or absence of TGF-ß1. The preaccumulated p27Kip1 protein (shown at 12 h) had a similar t1/2 < 1 h either in the presence or absence of TGF-ß1 (Fig. 3GoA). Thus, the turnover of p27Kip1 protein appeared to be TGF-ß1 independent.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 3. Translational control of p27Kip1. A, The effect of TGF-ß1 on the decay of p27Kip1. CH31 cells were preincubated in the presence (TGF-ß1) or absence (Control) of TGF-ß1 for 12 h. Cycloheximide (10 µg/ml) was then added to these preincubated cells; collected cells were extracted at 0, 1, 2, and 3 h, and the decay of p27Kip1 was determined by immunoblotting. When the film was scanned by densitometry, the relative intensities of the bands corresponding to 0, 1, 2, and 3 h in the absence of TGF-ß1 were 24.4, 8.4, 4.0, and 1.7, respectively, and those corresponding to 0, 1, 2, and 3 h in the presence of TGF-ß1 were 57.6, 37.8, 17.1, and 6.4, respectively. Therefore, p27Kip1 had a similar t1/2 < 1 h, either in the presence or absence of TGF-ß1, when its decay was assessed by plotting its levels during the last 2 h of the incubations to exclude the time required for the inhibition of protein synthesis. B, The effect of TGF-ß1 on the rate of p27Kip1 synthesis. Biosynthetic labeling was performed as described in Materials and Methods. Equal amounts of TCA-insoluble radioactivity were incubated with rabbit antisera to p27Kip1. The collected immunoprecipitates were fractionated on reducing SDS-polyacrylamide gels and analyzed by fluorography.

 
The rate of p27Kip1 protein synthesis was evaluated by immunoprecipitating p27Kip1 protein from extracts of cells that were incubated with or without TGF-ß1 and pulse labeled with [35S]methionine. As shown in Figure 3GoB, TGF-ß1 treatment resulted in a threefold increase in the synthesis of p27Kip1 protein. Since this increase in the synthesis rate of p27Kip1 protein is greater than the increase in the steady state levels of major p27Kip1 mRNA, translational control might also contribute to the TGF-ß1-dependent up-regulation of p27Kip1 protein.

TGF-ß1 increases the amount of p27Kip1 associated with Cdk2

To test whether the TGF-ß1-induced increase in p27Kip1 leads to association with its Cdk targets (17, 18, 19), protein extracts from TGF-ß1 treated and untreated CH31 cells were immunoprecipitated with anti-Cdk2 antisera, and then p27Kip1 protein was quantitated by immunoblot, using anti-p27Kip1 mAbs. As shown in Figure 4Go, TGF-ß1 treatment resulted in an increased association of p27Kip1 with Cdk2.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 4. The effect of TGF-ß1 on the amount of p27Kip1 protein associated with Cdk2 protein. A, The effect of TGF-ß1 on Cdk2 levels in CH31 cells. Immunoblot analysis of Cdk2 was performed on whole cell lysates prepared from CH31 cells incubated with 2 ng/ml TGF-ß1 for various time periods. Each lane contains 60 µg of protein from: Jurkat cells (lane C; a positive control provided by Transduction Laboratories); untreated CH31 cells (0 hr); CH31 cells treated with TGF-ß1 for 6 h (6 hr); and CH31 cells treated with TGF-ß1 for 12 h (12 hr). B, The effect of TGF-ß1 on the amount of Cdk2 immunoprecipitated with antisera to Cdk2. CH31 cells were incubated for 12 h in the absence or presence of 2 ng/ml TGF-ß1. Immunoblot analysis was performed on immunoprecipitations with antisera to Cdk2 in TGF-ß1-untreated and -treated CH31 cells. C, The effect of TGF-ß1 on the amount of p27Kip1 associated with Cdk2. CH31 cells were cultured for 12 h in the absence or presence of 2 ng/ml TGF-ß1. Immunoblot analysis of p27Kip1 was performed on immunoprecipitations with antisera to Cdk2 in TGF-ß1-untreated and -treated CH31 cells.

 
TGF-ß1 inhibits Cdk2 kinase activity

Since p27Kip1 has been previously shown to inhibit the kinase activity of cyclin E-Cdk2 complexes, we analyzed the activity of Cdk2 upon TGF-ß1 treatment (17, 18, 19). Cdk2 was immunoprecipitated from both TGF-ß1-treated and -untreated CH31 cells, and the activity of Cdk2 was assayed by measuring its ability to phosphorylate an exogenous substrate, histone H1. As shown in Figure 5Go, TGF-ß1 treatment resulted in a marked decrease in Cdk2 kinase activity. This observed decrease in Cdk2 kinase activity upon TGF-ß1 treatment is consistent with p27Kip1-Cdk2 association, since Cdk2 protein levels remained almost constant after TGF-ß1 treatment (Fig. 4Go).



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 5. Histone H1 kinase activity of Cdk2 immunoprecipiations in TGF-ß1-untreated and -treated CH31 cells. Cell lysates were prepared from CH31 cells incubated for 18 or 24 h in the absence or presence of 2 ng/ml TGF-ß1. Histone H1 kinase assays were performed as described in Materials and Methods.

 
TGF-ß1 has little or no effect on Cdk4 protein levels in murine B cells

We next examined whether TGF-ß1 induces cell cycle arrest through other mechanisms previously described for epithelial cells. Ewen et al. (7) have suggested that TGF-ß1 inhibits cell cycle progression through posttranscriptional down-regulation of Cdk4 in Mv1Lu mink lung epithelial cells. Thus, we studied Cdk4 protein levels in CH31 and WEHI231 cells after TGF-ß1 treatment. As shown in Figure 6Go, TGF-ß1 had litttle or no effect on Cdk4 protein levels in these B cells. In contrast to these findings, however, TGF-ß1 reduced Cdk4 protein levels in HaCaT epithelial cells, consistent with previous observations (20).



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 6. The effect of TGF-ß1 on Cdk4 protein levels. Immunoblot analysis of Cdk4 was performed on whole-cell lysates prepared from CH31 or HaCaT cells incubated with 2 ng/ml TGF-ß1 for various time periods. Each lane contains 60 µg of protein from CH31 or HaCaT cells. Lane C contains 60 µg of protein from WEHI231 cells as a positive control. TGF-ß1 had little effect on Cdk4 protein levels in CH31 cells, since densitometry showed that the relative intensities of the bands corresponding to 0, 6, and 12 h were 1.5, 1.7, and 1.6, respectively. TGF-ß1 also had little effect on Cdk4 protein levels in WEHI231 cells (data not shown). In contrast, TGF-ß1 reduced Cdk4 protein levels in HaCaT epithelial cells after 24 h. When the film was scanned by densitometry, the relative intensities of the bands corresponding to 0 and 24 h were 4.8 and 0.6, respectively.

 
TGF-ß1 has little or no effect on p15INK4b or p21WAF1/Cip1protein levels in murine B cells

Recent studies have suggested that TGF-ß1 induces cell cycle arrest in epithelial cells through transcriptional up-regulation of p15INK4b and p21WAF1/Cip1 (20, 21, 22, 23). We therefore proceeded to determine p15INK4b and p21WAF1/Cip1 mRNA and protein levels in CH31 and WEHI231 cells after incubation with TGF-ß1. Addition of TGF-ß1 resulted in a fourfold increase in the steady state level of p15INK4b mRNA in treated as compared with untreated CH31 cells (Fig. 7GoA). TGF-ß1 also induced p15INK4b mRNA in HaCaT epithelial cells as previously described (9). However, even after TGF-ß1 treatment, we failed to detect p15INK4b protein in CH31 or WEHI231 cells by immunoblot analysis, probably due to its presence at low levels (Fig. 7GoB). Thus, we could not determine the effect of TGF-ß1 on p15INK4b protein levels in these B cells. By immunoprecipitation, following biosynthetic labeling, Hannon et al. previously showed that TGF-ß1 increases p15INK4b protein associated with Cdk4 and Cdk6 in HaCaT cells (9). However, immunoblotting also failed to detect p15INK4b protein in HaCaT cells even after TGF-ß1 treatment (Fig. 7GoB).



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 7. The effect of TGF-ß1 on p15INK4b and p21WAF1/Cip1. A, TGF-ß1-mediated induction of p15INK4b mRNA. RNA was isolated from CH31 or HaCaT cells treated with 2 ng/ml TGF-ß1 for various time periods. Each lane contains 15 µg of total RNA from CH31 or HaCaT cells. The filters were hybridized with a mouse or human p15INK4b cDNA probe, then stripped and rehybridized with a rat glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) cDNA probe or a human ribosomal RNA probe as a control for the amount of applied RNA. B, The effect of TGF-ß1 on p15INK4b protein levels. Immunoblot analysis of p15INK4b was performed on whole-cell lysates prepared from CH31, WEHI231, or HaCaT cells incubated with 2 ng/ml TGF-ß1 for various time periods. Even after TGF-ß1 treatment, p15INK4b protein remained undetectable in CH31 or HaCaT cells. Similar results were demonstrated with WEHI231 cells (data not shown). Each lane contains 60 µg of protein from CH31 or HaCaT cells. Lane C contains 60 µg of protein from NIH3T3 cells treated with TGF-ß1 as a positive control. C, The effect of TGF-ß1 on the expression of p21WAF1/Cip1 mRNA. RNA was isolated from CH31, WEHI231, or HaCaT cells treated with 2 ng/ml TGF-ß1 for various time periods. Even after TGF-ß1 treatment, p21WAF1/Cip1 mRNA remained barely detectable in CH31 cells. Similar results were seen with WEHI231 cells (data not shown). In contrast, TGF-ß1 treatment led to a ninefold increase in p21WAF1/Cip1 mRNA in HaCaT cells. Each lane contains 15 µg of total RNA from CH31, or HaCaT cells. Lane C contains 15 µg of total RNA from 32D cells as a positive control. The filters were hybridized with a mouse or human p21WAF1/Cip1 cDNA probe, then stripped and rehybridized with a rat glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) cDNA probe or a ribosomal RNA probe, as a control for the amount of applied RNA. D, The effect of TGF-ß1 on p21WAF1/Cip1 protein levels. Immunoblot analysis of p21WAF1/Cip1 was performed on whole-cell lysates prepared from CH31, WEHI231, or HaCaT cells incubated with 2 ng/ml TGF-ß1 for various time periods. Even after TGF-ß1 treatment, p21WAF1/Cip1 protein remained undetectable in CH31 cells. Similar results were observed in TGF-ß1-treated WEHI231 cells (data not shown). In contrast, TGF-ß1 exposure led to a ninefold increase in p21WAF1/Cip1 protein in HaCaT cells. Each lane contains 60 µg of protein from CH31 or HaCaT cells. Lane C contains 60 µg of protein from 32D cells as a positive control. E, Induction ofp21WAF1/Cip1 mRNA by diethylmaleate or PMA. RNA was isolated from CH31 cells treated with various reagents. Each lane contains 15 µg of total RNA from 32D cells (a positive control), Control untreated CH31 cells, x-ray CH31 cells harvested 4 h after treatment with 20 Gy of ionizing radiation, CH31 cells treated with 1 mM diethylmaleate for 3 h (DEM), and CH31 cells treated with 50 ng/ml PMA for 6 h (TPA). The filter was hybridized with a p21WAF1/Cip1 cDNA probe, then stripped and rehybridized with a rat GAPDH cDNA probe, as a control for the amount of applied RNA.

 
TGF-ß1 treatment had little or no effect on p21WAF1/Cip1 mRNA and protein levels in CH31 or WEHI231 cells, while resulting in a ninefold increase in p21WAF1/Cip1 mRNA and protein levels in HaCaT cells, as previously reported (22) (Fig. 7Go, C and D). This lack of response of these B cells to TGF-ß1 is not a nonspecific effect, since other p53-independent inducers of p21WAF1/Cip1, such as diethylmaleate (40) or PMA (41), activated the p21WAF1/Cip1 gene (Fig. 7GoE). Taken together, these results indicate that TGF-ß1-mediated inhibition of the cell cycle does not occur through the induction of p21WAF1/Cip1 proteins in B cells.

TGF-ß1 induces p27Kip1through a p53-independent mechanism

Numerous studies have suggested that loss of response to TGF-ß1 is correlated with loss of function of p53 in various types of epithelial cells (26). More directly, several studies have demonstrated abrogation of the TGF-ß1 response in epithelial cells by inhibition of endogenous wild-type p53, indicating a direct role of p53 in TGF-ß1-mediated cell cycle arrest (27, 28, 42). To our knowledge, the role of p53 in TGF-ß1-induced cell cycle arrest remains unknown in B cells. Since our results indicated that TGF-ß1 inhibits cell cycle progression in B cells through mechanisms different from those of epithelial cells, we wanted to determine the role of p53 in TGF-ß1-mediated cell cycle arrest in B cells. To study the endogenous p53 mRNA status, we first obtained 1300-base-pair cDNA fragments, including the entire p53 coding region, from CH31 and WEHI231 cells. As shown in Figure 8GoA, direct sequencing of the CH31 p53 cDNA fragments demonstrated a single missense mutation at codon 279 (Arg -> His). (Our preliminary study revealed that WEHI231 expresses both wild-type and mutant p53; therefore, no further investigations were performed regarding the p53 status of WEHI231 cells.) We confirmed that CH31 exclusively expresses this mutated p53 mRNA by cloning the p53 cDNA fragments and sequencing 24 clones. All clones showed the identical missense mutation, indicating the exclusive expression of this mutant mRNA in CH31 cells.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 8. Analysis of p53 status in CH31 cells. A, Detection of p53 mutation in CH31 cells. A mis-sense mutation (*) at codon 279 (Arg -> His) was detected by direct sequencing of reverse transcriptase-PCR products from CH31 mRNA (lane L). The normal sequence is on the right (lane R). All of the 24 cDNA clones derived from CH31 cells also showed the identical mis-sense mutation (data not shown). B, The effect of TGF-ß1 on p53 protein levels in CH31 cells. Immunoblot analysis was performed on whole-cell lysates prepared from CH31 cells incubated with TGF-ß1 for various periods of time. Each lane contains 80 µg of protein from {Psi}2 cells (lane C) expressing an exogenous full-length p53 mutant (a positive control), untreated CH31 cells (0 hr), CH31 cells treated with TGF-ß1 for 6 h (6 hr), and CH31 cells treated with TGF-ß1 for 12 h (12 hr). C, Functional analysis of mutant p53 derived from CH31 cells. The transactivation activity of the mutant p53 derived from CH31 cells was determined by cotransfecting 2 µg of pCAST2Bluc, 7 µg of a ß-galactosidase reporter construct, and 1 µg of the p53 expression constructs into Saos-2 and measuring luciferase activity. Luciferase activity was normalized to the ß-galactosidase activity, and the level of wild-type p53 transactivation was set at 100%. Results are shown from two independent experiments, each with two independent transfections (error bars, range).

 
We examined the endogenous p53 protein status in CH31 cells by performing immunoblot analysis using the anti-p53 mAb. Consistent with the presence of the mutant p53 protein, CH31 expressed high levels of p53 protein either in the presence or absence of TGF-ß1 (Fig. 8GoB).

The amino acid residue mutated in the CH31 p53 protein may play an important functional role. This is suggested by the fact that this residue is highly conserved among species (43). We investigated the functional consequences of the CH31 p53 mutation by inserting the CH31 p53 cDNA into the expression vector pRc-CMV (Invitrogen, Carlsbad, CA). Its function was studied by cotransfection with the luciferase reporter plasmid pCAST2Bluc containing two copies of the p53-binding sequence (38). Transfections were performed in the human osteosarcoma cell line Saos-2, which, because of a lack of endogenous p53, provides a "clean" background for this type of study. As shown in Figure 8GoC, the transcriptional activation produced by the CH31-derived mutant p53 protein was only 6.7% of that observed in wild-type p53. This result prompted us to examine whether x-ray irradiation would still induce p21WAF1/Cip1 mRNA in CH31 cells, since x-ray irradiation stimulates the transcription of the p21WAF1/Cip1 gene in a p53-dependent manner (11, 44). Consistent with the result of the luciferase reporter assay, x-ray irradiation had little or no effect on p21WAF1/Cip1 mRNA steady state levels in CH31 cells (Fig. 7GoE). We also studied the effect of x-ray irradiation on the mRNA levels of other p53-responsive genes such as GADD45 or bax (25, 45). X-ray irradiation also showed little or no effect on GADD45 or bax mRNA levels in CH31 cells (data not shown). Taken together, these results suggest that mutant p53 proteins expressed in CH31 cells are incapable of transcriptionally activating the p27Kip1 promotor. Furthermore, these findings support that TGF-ß1 induces cell cycle arrest in B cells through up-regulation of p27Kip1 mRNA in a p53-independent manner.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have presented herein a new mechanism through which TGF-ß1 may act to inhibit the activities of the G1 cyclin-Cdk complexes in B cells. Our results demonstrate that TGF-ß1 causes a rapid and significant induction of a cyclin-Cdk inhibitor, p27Kip1, probably through transcriptional and translational regulation. The induction of p27Kip1 leads to an increased association with its G1 target, Cdk2. It has been previously reported that p27Kip1 protein can bind to and inhibit the kinase activity of cyclin E-Cdk2 complexes. Thus, the observed increase in p27Kip1 protein levels and the association of the protein with Cdk2 upon TGF-ß1 treatment may be sufficient to inhibit the activities of cyclin E-Cdk2 complexes. In support of this, a decrease in the kinase activity of Cdk2 was observed upon TGF-ß1 treatment. Our results also demonstrate that the induction of p27Kip1 protein by TGF-ß1 is concurrent with an inhibition of cell entry into S phase. Taken together, these results suggest that the induction of p27Kip1 protein may play a causative role in TGF-ß1-mediated inhibition of cell growth. Consistent with this possibility, A20 B cell lymphoma cells expressing no detectable p27Kip1 protein were extremely resistant to the growth-inhibitory effect of 20-h TGF-ß1 treatment. The 50% growth-inhibitory concentration had not been reached at a TGF-ß1 level of 10 ng/ml, while CH31 cells were inhibited 50% at a concentration of 0.7 ng/ml (our unpublished data).

Previous work has suggested that TGF-ß1 induces cell cycle arrest through a number of mechanisms (7, 20, 21, 22, 23). In epithelial cell lines, TGF-ß1-mediated arrest appears to involve translational down-regulation of Cdk4 (7). Moreover, recent studies have suggested that TGF-ß1 inhibits Cdk activities in epithelial cell lines through transcriptional up-regulation of p15INK4b and/or p21WAF1/Cip1 (20, 21, 22, 23). However, TGF-ß1 has little or no effect on p27Kip1 mRNA and protein levels in these epithelial cell lines.

In contrast to these observations in epithelial cell lines, we have shown here the TGF-ß1-mediated induction of p27Kip1 mRNA and protein in B cells. Moreover, TGF-ß1 neither down-regulated Cdk4 nor up-regulated p21WAF1/Cip1 in these cells. The results presented underline the cell type-dependent variations in the effect of TGF-ß1 on cell cycle regulators.

Several studies have shown abrogation of TGF-ß1 responsiveness by the inhibition of endogenous wild-type p53, suggesting a direct role of p53 in TGF-ß1-induced cell cycle arrest in epithelial cells (27, 42). Recently, Ewen et al. (28) proposed p53-dependent down-regulation of Cdk4 as a mechanism by which p53 mediates the growth-inhibitory effects of TGF-ß1 in epithelial cells. However, the exact role of p53 in the TGF-ß1 signaling pathway is still controversial and remains to be determined.

Given the inhibition by TGF-ß1 of cell cycle progression in B cells through mechanisms different from epithelial cells, we wished to evaluate the significance of p53 in TGF-ß1-mediated cell cycle arrest in these cells. We studied the p53 status in CH31 and WEHI231 cells and found the exclusive expression of mutant p53 mRNA and protein in CH31 cells. This mutant p53 protein showed only a weak transactivation activity in the luciferase reporter assay. Consistent with this result, there was little or no activation of p53-responsive genes such as p21WAF1/Kip1, GADD45, or baxin the irradiated CH31 cells. Based on these observations, we conclude that TGF-ß1 induces cell cycle arrest through up-regulation of p27Kip1in a p53-independent manner. However, it is still possible that TGF-ß1 inhibits cell cycle progression through p53-dependent down-regulation of Cdk4 in B cells expressing wild-type p53.


    Acknowledgments
 
We thank Dr. Robert B. Dickson for critical reading of this manuscript and comments. We thank Drs. Geoffrey Haughton, Takashi Nishimura, and Mitsuo V. Kato for providing us CH31, A20, and Saos-2 cell lines, respectively. HaCaT cells were kindly provided by Drs. Norbert E. Fusenig and Mitsuyasu Kato. Mouse baxand chinese hamster GADD45 cDNAs were generous gifts from Drs. Stanley J. Korsmeyer and Albert J. Fornace, Jr., respectively. Mouse p27Kip1 cDNA was kindly provided by Drs. Tony Hunter and Katsuyuki Tamai (MBL, Japan). Human and mouse p15INK4B cDNAs were generous gifts from Drs. David Beach and Charles J. Sherr, respectively. Both human and mouse p21WAF1/Cip1 cDNAs were kindly provided by Dr. Bert Vogelstein.


    Footnotes
 
1 Address correspondence and reprint requests to Dr. Hiroshi Kamesaki, Laboratory of Experimental Radiology, Aichi Cancer Center Research Institute, Chikusa-ku, Nagoya, Aichi 464, Japan. Back

2 Abbreviation used in this paper: Cdk, cyclin-dependent kinase. Back

Received for publication April 28, 1997. Accepted for publication October 7, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Moses, H., E. Y. Yang, J. A. Pietenpol. 1990. TGF-ß stimulation and inhibition of cell proliferation: new mechanistic insights. Cell 63:245.[Medline]
  2. Massague, J. A.. 1990. The transforming growth factor-ß family. Annu. Rev. Cell Biol. 6:597.
  3. Sporn, M. B., A. B. Roberts. 1992. Transforming growth factor-ß: recent progress and new challenges. J. Cell Biol. 119:1017.[Free Full Text]
  4. Sherr, C. J.. 1993. Mammalian G1 cyclins. Cell 73:1059.[Medline]
  5. Hunter, T.. 1993. Braking the cycle. Cell 75:839.[Medline]
  6. Meyerson, M., E. Harlow. 1994. Identification of G1 kinase activity for cdk6, a novel cyclin D partner. Mol. Cell. Biol. 14:2077.[Abstract/Free Full Text]
  7. Ewen, M. E., H. K. Sluss, L. L. Whitehouse, D. M. Livingston. 1993. TGF-ß inhibition of cdk4 synthesis is linked to cell cycle arrest. Cell 74:1009.[Medline]
  8. Koff, A., M. Ohtsuki, K. Polyak, J. M. Roberts, J. Massague. 1993. Negative regulation of G1 in mammalian cells: inhibition of cyclin E-dependent kinase by TGF-ß. Science 260:536.[Abstract/Free Full Text]
  9. Hannon, G. J., D. Beach. 1994. p15INK4B is a potential effector of TGF-ß-induced cell cycle arrest. Nature 371:257.[Medline]
  10. Quelle, D. E., R. A. Ashmun, G. J. Hannon, P. A. Rehberger, D. Trono, K. H. Richter, C. Walker, D. Beach, C. J. Sherr, M. Serrano. 1995. Cloning and characterization of murine p16INK4a and p15INK4b genes. Oncogene 11:635.[Medline]
  11. Dulic, V., W. K. Kaufmann, S. J. Wilson, T. D. Tlsty, E. Lees, J. W. Harper, S. J. Elledge, S. I. Reed. 1994. p53-dependent inhibition of cyclin-dependent kinase activities in human fibroblasts during radiation-induced G1 arrest. Cell 76:1013.[Medline]
  12. El-Deiry, W. S., T. Tokino, V. E. Velculescu, D. B. Levy, R. Parsons, J. M. Trent, D. Lin, W. E. Mercer, K. W. Kinzler, B. Vogelstein. 1993. WAF1, a potential mediator of p53 tumor suppression. Cell 75:817.[Medline]
  13. Harper, J. W., G. R. Adami, N. Wei, K. Keyomarsi, S. J. Elledge. 1993. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 75:805.[Medline]
  14. Xiong, Y., G. J. Hannon, H. Zhang, D. Casso, R. Kobayashi, D. Beach. 1993. p21 is a universal inhibitor of cyclin kinases. Nature 366:701.[Medline]
  15. Xiong, Y., H. Zhang, D. Beach. 1993. Subunit rearrangement of the cyclin-dependent kinases is associated with cellular transformation. Genes Dev. 7:1572.[Abstract/Free Full Text]
  16. Zhang, H., G. J. Hannon, D. Beach. 1994. p21-containing cyclin kinases exist in both active and inactive states. Genes Dev. 8:1750.[Abstract/Free Full Text]
  17. Polyak, K., J. Kato, M. J. Solomon, C. J. Sherr, J. Massague, J. M. Roberts, A. Koff. 1994. p27Kip1, a cyclin-Cdk inhibitor, links transforming growth factor-ß and contact inhibition to cell cycle arrest. Genes Dev. 8:9.[Abstract/Free Full Text]
  18. Polyak, K., M-H. Lee, H. Erdjument-Bromage, A. Koff, J. M. Roberts, P. Tempst, J. Massague. 1994. Cloning of p27Kip1, a cyclin-dependent kinase inhibitor and a potential mediator of extracellular antimitogenic signals. Cell 78:59.[Medline]
  19. Toyoshima, H., T. Hunter. 1994. p27, a novel inhibitor of G1 cyclin-Cdk protein kinase activity, is related to p21. Cell 78:67.[Medline]
  20. Reynisdottir, I., K. Polyak, A. Iavarone, J. Massague. 1995. Kip/Cip and Ink4 Cdk inhibitors cooperate to induce cell cycle arrest in response to TGF-ß. Genes Dev. 9:1831.[Abstract/Free Full Text]
  21. Elbendary, A., A. Berchuck, P. Davis, L. Havrilesky, Jr R. C. Bast, J. D. Iglehart, J. R. Marks. 1994. Transforming growth factor ß1 can induce CIP1/WAF1 expression independent of the p53 pathway in ovarian cancer cells. Cell Growth Differ. 3:291.[Abstract]
  22. Datto, M. B., Y. Li, J. F. Panus, D. J. Howe, Y. Xiong, X-F. Wang. 1995. Transforming growth factor ß induces the cyclin-dependent kinase inhibitor p21 through a p53-independent mechanism. Proc. Natl. Acad. Sci. USA 92:5545.[Abstract/Free Full Text]
  23. Li, C-Y., L. Suardet, J. B. Little. 1995. Potential role of WAF1/Cip1/p21 as a mediator of TGF-ß cytoinhibitory effect. J. Biol. Chem. 270:4971.[Abstract/Free Full Text]
  24. Lane, D. P., S. Benchimol. 1990. p53: oncogene or anti-oncogene. Genes Dev. 4:1.[Free Full Text]
  25. Kastan, M. B., Q. Zhan, W. S. El-Deiry, F. Carrier, T. Jacks, W. V. Walsh, B. S. Plunkett, B. Vogelstein, Jr A. J. Fornace. 1992. A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia. Cell 71:587.[Medline]
  26. Reiss, M., V. F. Vellucci, Z-L. Zhou. 1993. Mutant p53 tumor suppressor gene causes resistance to transforming growth factor ß1 in murine keratinocytes. Cancer Res. 53:899.[Abstract/Free Full Text]
  27. Mogi, Y., J. Kato, M. Horimoto, R. Takimoto, T. Murakami, A. Hirayama, Y. Kohgo, N. Watanabe, Y. Niitsu. 1994. Close correlation between the dephosphorylation of p53 and growth suppression by transforming growth factor-ß1 in nasopharyngeal carcinoma cells transduced with adenovirus early region genes. Jpn. J. Cancer Res. 85:459.[Medline]
  28. Ewen, M. E., C. J. Oliver, H. K. Sluss, S. J. Miller, D. S. Peeper. 1995. p53-dependent repression of CDK4 translation in TGF-ß-induced G1 cell-cycle arrest. Genes Dev. 9:204.[Abstract/Free Full Text]
  29. Warner, G. L., J. W. Ludlow, D. A. Nelson, A. Gaur, D. W. Scott. 1992. Anti-immunoglobulin treatment of murine B-cell lymphomas induces active transforming growth factor ß, but pRB hypophosphorylation is transforming growth factor ß independent. Cell Growth Differ. 3:175.[Abstract]
  30. Pennel, C. A., L. W. Arnold, P. M. Lutz, N. J. LoCascio, P. B. Willoughby, G. Haughton. 1985. Cross-reactive idiotypes and common antigen binding specificities expressed by a series of murine B-cell lymphomas: etiological implications. Proc. Natl. Acad. Sci. USA 82:3799.[Abstract/Free Full Text]
  31. Diegel, M. L., B. M. Rankin, J. B. Bolen, P. M. Dubois, P. A. Kiener. 1994. Cross-linking of Fc{gamma} receptor to surface immunoglobulin on B cells provides an inhibitory signal that closes the plasma membrane calcium channel. J. Biol. Chem. 269:11409.[Abstract/Free Full Text]
  32. Boukamp, P., R. T. Petrussevska, D. Breitkreutz, J. Hornung, A. Markham, N. E. Fusenig. 1988. Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. J. Cell Biol. 106:761.[Abstract/Free Full Text]
  33. Sato, H., T. Tsukada, M. Nagayoshi, Y. Ikawa, S. Aizawa, M. V. Kato. 1995. Repression of p53-dependent sequence-specific transactivation by MEF2c. Biochem. Biophys. Res. Commun. 214:468.[Medline]
  34. Kamesaki, H., J. A. Zwiebel, J. C. Reed, J. Cossman. 1994. Role of bcl-2 and IL-5 in the regulation of anti-IgM-induced growth arrest and apoptosis in immature B cell lines. J. Immunol. 152:3294.[Abstract]
  35. Chomczynski, P., N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156.[Medline]
  36. Ohno, H., S. Fukuhara, Y. Arita, S. Doi, R. Takahashi, H. Fujii, T. Honjo, T. Sugiyama, H. Uchino. 1988. Establishment of a peripheral T-cell lymphoma cell line showing amplication of the c-myc oncogene. Cancer Res. 48:4959.[Abstract/Free Full Text]
  37. Maltzman, W., M. Oren, A. J. Levine. 1981. The structural relationships between 54,000-molecular-weight cellular tumor antigens detected in viral- and nonviral-transformed cells. Virology 112:145.[Medline]
  38. Kiyono, T., A. Hiraiwa, S. Ishii, T. Takahashi, M. Ishibashi. 1994. Inhibition of p53-mediated transactivation by E6 of type 1, but not type 5, 8, or 47, human papillomavirus of cutaneous origin. J. Virol. 68:4656.[Abstract/Free Full Text]
  39. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, K. Struhl. 1994. Transfection of DNA into eukaryotic cells: calcium phosphate transfection. Current Protocols in Molecular Biology 911. Greene Publishing Associates and Wiley-Interscience, New York.
  40. Russo, T., N. Zambrano, F. Esposito, R. Ammendola, F. Cimino, M. Fiscella, J. Jackman, P. M. O’Connor, C. W. Anderson, E. Appella. 1995. A p53-independent pathway for activation of WAF1/CIP1 expression following oxidative stress. J. Biol. Chem. 270:29386.[Abstract/Free Full Text]
  41. Zeng, Y.-X., W. S. El-Deiry. 1996. Regulation of p21WAF1/CIP1 expression by p53-independent pathways. Oncogene 12:1557.[Medline]
  42. Kulkarni, P. S., K. Sundqvist, C. Betsholtz, P. Hoglund, K. G. Wiman, B. Zhivotovsky, F. Bertolero, Y. Liu., R. C. Grafstrom. 1995. Characterization of human buccal epithelial cells transfected with the simian virus 40 T-antigen gene. Carcinogenesis 16:2515.[Abstract/Free Full Text]
  43. Soussi, T., C. Caron de Fromentel, P. May. 1990. Structural aspects of p53 protein in relation to gene evolution. Oncogene 5:945.[Medline]
  44. El-Deiry, W. S., J. W. Harper, P. M. O’Connor, V. E. Velculescu, C. E. Canman, J. Jackman, J. A. Pietenpol, M. Burrell, D. E. Hill, Y. Wang, K. G. Wiman, W. E. Mercer, M. B. Kastan, K. W. Kohn, S. J. Elledge, K. W. Kinzler, B. Vogelstein. 1994. WAF1/CIP1 is induced in p53-mediated G1 arrest and apoptosis. Cancer Res. 54:1169.[Abstract/Free Full Text]
  45. Zhan, Q., S. Fan, I. Bae, C. Guillouf, D. A. Liebermann, P. M. O’Connor, Jr A. J. Fornace. 1994. Induction of bax by genotoxic stress in human cells correlates with normal p53 status and apoptosis. Oncogene 9:3743.[Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
L. C. Spender and G. J. Inman
TGF-{beta} Induces Growth Arrest in Burkitt Lymphoma Cells via Transcriptional Repression of E2F-1
J. Biol. Chem., January 16, 2009; 284(3): 1435 - 1442.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
Y. Song, C. Zhao, L. Dong, M. Fu, L. Xue, Z. Huang, T. Tong, Z. Zhou, A. Chen, Z. Yang, et al.
Overexpression of cyclin B1 in human esophageal squamous cell carcinoma cells induces tumor cell invasive growth and metastasis
Carcinogenesis, February 1, 2008; 29(2): 307 - 315.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
X. Chang, Y. Fan, S. Karyala, S. Schwemberger, C. R. Tomlinson, M. A. Sartor, and A. Puga
Ligand-Independent Regulation of Transforming Growth Factor {beta}1 Expression and Cell Cycle Progression by the Aryl Hydrocarbon Receptor
Mol. Cell. Biol., September 1, 2007; 27(17): 6127 - 6139.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Klein, W. Ju, J. Heyer, B. Wittek, T. Haneke, P. Knaus, R. Kucherlapati, E. P. Bottinger, L. Nitschke, and B. Kneitz
B Cell-Specific Deficiency for Smad2 In Vivo Leads to Defects in TGF-beta-Directed IgA Switching and Changes in B Cell Fate
J. Immunol., February 15, 2006; 176(4): 2389 - 2396.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. A. Siegenthaler and M. W. Miller
Transforming Growth Factor {beta}1 Promotes Cell Cycle Exit through the Cyclin-Dependent Kinase Inhibitor p21 in the Developing Cerebral Cortex
J. Neurosci., September 21, 2005; 25(38): 8627 - 8636.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. Chandramohan, S. Jeay, S. Pianetti, and G. E. Sonenshein
Reciprocal Control of Forkhead box O 3a and c-Myc via the Phosphatidylinositol 3-Kinase Pathway Coordinately Regulates p27Kip1 Levels
J. Immunol., May 1, 2004; 172(9): 5522 - 5527.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. H. Nelson, T. P. Martyak, L. J. Thompson, J. J. Moon, and T. Wang
Uncoupling of Promitogenic and Antiapoptotic Functions of IL-2 by Smad-Dependent TGF-{beta} Signaling
J. Immunol., June 1, 2003; 170(11): 5563 - 5570.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. A. Dao, J. Hwa, and J. A. Nolta
Molecular mechanism of transforming growth factor beta -mediated cell-cycle modulation in primary human CD34+ progenitors
Blood, January 15, 2002; 99(2): 499 - 506.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Husson, E. G. Carideo, D. Neuberg, J. Schultze, O. Munoz, P. W. Marks, J. W. Donovan, A. C. Chillemi, P. O'Connell, and A. S. Freedman
Gene expression profiling of follicular lymphoma and normal germinal center B cells using cDNA arrays
Blood, January 1, 2002; 99(1): 282 - 289.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
L. Zhang, K. Graziano, T. Pham, C. D. Logsdon, and D. M. Simeone
Adenovirus-mediated gene transfer of dominant-negative Smad4 blocks TGF-{beta} signaling in pancreatic acinar cells
Am J Physiol Gastrointest Liver Physiol, June 1, 2001; 280(6): G1247 - G1253.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. J. Appleman, A. Berezovskaya, I. Grass, and V. A. Boussiotis
CD28 Costimulation Mediates T Cell Expansion Via IL-2-Independent and IL-2-Dependent Regulation of Cell Cycle Progression
J. Immunol., January 1, 2000; 164(1): 144 - 151.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Pan, C. J. Hetherington, and D.-E. Zhang
CCAAT/Enhancer-binding Protein Activates the CD14 Promoter and Mediates Transforming Growth Factor beta Signaling in Monocyte Development
J. Biol. Chem., August 13, 1999; 274(33): 23242 - 23248.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Taniguchi, H. Endo, N. Chikatsu, K. Uchimaru, S. Asano, T. Fujita, T. Nakahata, and T. Motokura
Expression of p21Cip1/Waf1/Sdi1 and p27Kip1 Cyclin-Dependent Kinase Inhibitors During Human Hematopoiesis
Blood, June 15, 1999; 93(12): 4167 - 4178.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Sudarshan, J. Galon, Y.-j. Zhou, and J. J. O'Shea
TGF-{beta} Does Not Inhibit IL-12- and IL-2-Induced Activation of Janus Kinases and STATs
J. Immunol., March 1, 1999; 162(5): 2974 - 2981.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kamesaki, H.
Right arrow Articles by Kiyono, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kamesaki, H.
Right arrow Articles by Kiyono, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS