The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guéguen, M.
Right arrow Articles by Van den Eynde, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guéguen, M.
Right arrow Articles by Van den Eynde, B. J.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
Medline Plus Health Information
*Bladder Cancer
The Journal of Immunology, 1998, 160: 6188-6194.
Copyright © 1998 by The American Association of Immunologists

An Antigen Recognized by Autologous CTLs on a Human Bladder Carcinoma1

Maryse Guéguen2,*, Jean-Jacques Patard*, Béatrice Gaugler*, Francis Brasseur*, Jean-Christophe Renauld*, Paul J. Van Cangh{dagger}, Thierry Boon* and Benoît J. Van den Eynde3,*

* Ludwig Institute for Cancer Research, Brussels Branch and Cellular Genetics Unit, Université Catholique de Louvain, Brussels, Belgium; and {dagger} Department of Urology, Cliniques Universitaires Saint Luc, Université Catholique de Louvain, Brussels, Belgium


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
By stimulating blood lymphocytes with autologous bladder carcinoma cells that had been transfected with B7-1, we obtained a panel of CTL clones which lyse specifically the bladder tumor cells in an MHC class I-restricted fashion. Based on inhibition with anti-HLA Abs and the recognition of allogeneic tumor cells, we could distribute our clones in three groups that recognized three distinct Ags. We characterized one of these Ags by screening a cDNA library prepared with the RNA from this bladder tumor line. This new tumor Ag is a peptide presented by HLA-B4403 molecules. It is produced by a point mutation in a gene that is recorded in databases under the name KIAA0205, is ubiquitously expressed, and whose function is unknown. We also found this mutation in the tumor sample that was originally resected from this patient, but the mutation was not found in the 100 or more independent tumors of various histologic types that were tested. This report is the first to describe the isolation of CTL clones directed against human bladder cancer and the molecular characterization of a bladder tumor Ag.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The identification of human tumor Ags that are recognized by CTLs has an important bearing upon the basic understanding of the immunologic response to tumors and the design of highly specific vaccines. Human melanomas and renal cell carcinomas (RCCs)4 express Ags that are recognized by CTLs, and a number of these Ags have been characterized at the molecular level. They usually consist of peptides that are presented by MHC class I molecules.

So far, four groups of human tumor Ags have been defined. The first group consists of tumor-specific Ags, such as those encoded by genes MAGE-1 (1, 2, 3), MAGE-3 (4, 5, 6), BAGE (7), GAGE (8), and RAGE (9). These genes are expressed in a variety of tumors but not in most normal tissues, in which they are expressed only in cells belonging to immune-privileged organs, such as the germ cells in the testis and some placenta cells, which appear to be devoid of MHC molecules. The second group is composed of differentiation Ags, such as tyrosinase (10, 11), Melan-A/MART-1 (12, 13), gp100 (14, 15), tyrosinase-related protein 1 (16), and tyrosinase-related protein 2 (17). These Ags are expressed in normal melanocytes and most melanomas. The third group comprises Ags encoded by mutated genes, such as MUM-1 (18), cyclin-dependent kinase 4 (19), ß-catenin (20), and HLA-A2 (21). These genes are expressed ubiquitously, and the Ag results from a tumor-specific mutation in the coding region. Finally, the fourth group consists of Ags such as HER2-neu that are present in normal tissues but are expressed in tumors at substantially higher levels (22).

In addition to melanoma and RCC, bladder tumors appear to be sensitive to immunologic control, as suggested by the remarkable results of the intravesical instillation of Bacillus of Calmette-Guérin (BCG) in superficial bladder carcinomas (23). The exact mechanism of the antitumor effect of BCG is unclear, but BCG locally induces a dramatic inflammatory reaction that may generate optimal conditions for the activation of tumor-specific T cells. Although lytic activities have been detected in populations of lymphocytes infiltrating bladder cancers, CTLs specifically directed against such tumors have not been characterized (24, 25).

We derived a cell line from a surgical specimen of transitional cell carcinoma of the bladder, and we used it to stimulate autologous blood lymphocytes. We observed lytic activity that was specifically directed against the autologous tumor cell line, but only after stimulation with autologous tumor cells transfected with the B7-1 cDNA. We cloned these T lymphocytes by limiting dilution and obtained a panel of tumor-specific CTL clones that recognized three different Ags. We report here the molecular characterization of one of these Ags.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines

The bladder carcinoma cell line LB831-BLC was derived from the primary invasive bladder tumor (pT3, g3) of a 65-yr-old Caucasian patient, LB831 (HLA-A2403, -A3, -B4403, -B4901, -Cw0401, and -Cw07). The caryotype of the cell line performed at passage 7 showed that the number of chromosomes varied from 56 to 144, confirming that the LB831 cell line was a tumor line. LB905-BLC is a bladder carcinoma cell line derived from an HLA-Cw07 patient. BB64-RCC is a RCC cell line and MZ2-MEL is a melanoma cell line; both were derived from HLA-B4403 patients. The tumor cells were cultured in Iscove’s medium (Life Technologies, Gaithersburg, MD) containing 10% human serum or 10% FCS (Life Technologies) in an 8% CO2 incubator. The lymphoblastoid cell line LB831-EBV was derived from the PBLs of patient LB831 with 1 µg/ml of cyclosporin A (Sandoz, Basel, Switzerland) and 20% (v/v) of supernatant of EBV-transformed B95-8 cells using standard techniques. This cell line was grown in RPMI 1640 medium (Life Technologies) containing 10% FCS in a 5% CO2 incubator. LG2-EBV cells were grown in Iscove’s medium containing 10% FCS in an 8% CO2 incubator. PBL-PHA cells were prepared by stimulating PBLs with 0.1% (v/v) PHA (Difco, Detroit, MI) and 100 U/ml of IL-2 (Eurocetus, Amsterdam, The Netherlands) and cultured in an 8% CO2 incubator in Iscove’s medium containing 10% human serum. The class I-negative human B cell line, C1R (26), transfected with an HLA-B4403 cDNA (27, 28) was provided by K. Fleischhauer (Istituto Scientifico H.S. Rafaele, Milan, Italy) and grown in RPMI 1640 medium supplemented with 10% FCS in a 5% CO2 incubator. All media were supplemented with L-arginine (116 µg/ml), L-asparagine (36 µg/ml), L-glutamine (216 µg/ml), streptomycin (0.1 mg/ml), and penicillin (200 U/ml).

Antitumor CTL clones

The blood mononuclear cells of patient LB831 were isolated by Lymphoprep (Nycomed, Oslo, Norway) density-gradient centrifugation and stored at -80°C. An autologous mixed lymphocyte tumor cell culture (MLTC) was performed as described previously (29) or using irradiated B7-1-transfected LB831-BLC cells as stimulators and CD8+ T lymphocytes as responders. CD8+ T lymphocytes were sorted with magnetic beads that had been covalently coupled to anti-CD8 Abs (magnetic-activated cell sorter, Miltenyi Biotec, Bergisch-Gladbach, Germany). Irradiated non-CD8+ cells were added to the mixed culture during the first stimulation. Stimulator cells were treated with IFN-{gamma} for 48 h before the stimulation. On day 21, lymphocytes from the culture were cloned by limiting dilution in Iscove’s medium supplemented with IL-2 (50 U/ml). The long-term culture of CTL clones was conducted as described previously (29).

Cytotoxicity assay

The lytic activity of CTLs was tested in a chromium release assay as described previously (30). Briefly, 1000 chromium-labeled cells in 100 µl were incubated in 96-well microplates with an equal volume of CTLs at different E:T ratios. Chromium release was measured after 4 h of incubation. For the peptide assay, labeled LG2-EBV cells were incubated for 30 min at 37°C with various concentrations of peptides. CTLs were subsequently added, and chromium release was measured as described above. For the competition assay, the C1R-B4403 cells were labeled in the presence of the human-specific class I HLA mAb W6/32 (anti-HLA class I (31)) at a 1/40 dilution of the hybridoma cell culture media. Cells were incubated for 30 min at room temperature with various concentrations of competitor peptides in X-vivo 10 medium (Whittaker Bioproducts, Walkersville, MD) followed by incubation under the same conditions with the tyrosinase peptide SEIWRDIDF. Cells were then washed and processed for the chromium assay with CTL 22/31 (32) as described above. Chromium release was measured after 2 h.

CTL stimulation assay

A total of 3000 CTLs were added to microwells containing stimulator cells in 100 µl of Iscove’s medium supplemented with 10% human serum and 50 U/ml of IL-2. The supernatant was collected after 18 h, and its TNF content was determined by testing the cytotoxic effect on WEHI-164 clone 13 cells (33) in a 3-(4,5-dimethylthiazol-2-yl-)-2,5-diphenyl tetrazolium bromide colorimetric assay (34). Inhibition with W6/32, B1–23–2 (anti-HLA-B and -C), B9.4.1 (anti-CD8), 13B8.2 (anti-CD4, donated by D. Olive, Institut National de la Santé et de la Recherche Médicale U119, Marseille, France), GAPA-3 (anti-HLA-A3), and C7709A2.6 (anti-HLA-A24) mAbs was performed by adding a 1/30 dilution of ascites to the test.

Construction of the cDNA library

Total RNA (tRNA) was extracted from LB831-BLC cells using the guanidine isothiocyanate procedure (35). Poly(-A)+ RNA that had been enriched by an oligo(dT) cellulose column was converted to cDNA with the Superscript Choice System (Life Technologies) using an oligo(dT) primer containing an NotI site at its 5' end. The cDNA was ligated to HindIII adaptors (Stratagene, La Jolla, CA), phosphorylated, digested with NotI, and inserted into the HindIII and NotI sites of the expression vector pCEP4 (Invitrogen, San Diego, CA). Recombinant plasmids were electroporated into Escherichia coli Top10F' and selected with ampicillin (100 µg/ml). The library was divided into pools of 100 cDNA clones. Each pool of bacteria was amplified, and plasmid DNA was extracted using the QIAprep 8 plasmid kit (Qiagen, Hilden, Germany).

Cloning of the HLA cDNA from LB831-BLC

tRNA was extracted as described above from the LB831 tumor sample. Reverse transcription was performed on 2 µg of tRNA in a 20 µl reaction volume containing 4 µl of 5x reverse transcriptase buffer (Life Technologies), 1 µl of 10 mM deoxynucleoside triphosphate, 2 µl of a 20 µM solution of oligo(dT)15 primer, 20 U of RNasin (Promega, Madison, WI), 2 µl of 0.1 M DTT, and 200 U of Moloney murine leukemia virus reverse transcriptase (Life Technologies). The reaction was incubated at 42°C for 60 min. One-tenth of the cDNA product was subsequently supplemented with 10 µl of 10x polymerase buffer, 4 µl of 2.5 mM deoxynucleoside triphosphate, 2.5 µl of 20 µM primer solutions, 2.5 U of Pfu DNA polymerase (Stratagene), and water to a final volume of 100 µl. PCR amplification was performed using the forward primer 5'-ACTGGGCGGATCCGGACTCAGAATCTCCCCAGACGCCGAG and the reverse primer 5'-ACTGCCCGAATTCTCTCAGTCCCTCACAAGGCAGCTGTC that hybridize to the 5' and 3' untranslated regions of all HLA class I genes, respectively, and that contain a BamHI site (forward primer) or an EcoRI site (backward primer) (36). An initial denaturation step that was performed at 94°C for 4 min was followed by 35 cycles of amplification (1 min at 94°C, 5 s at 62°C, and 3 min at 75°C) and by a final elongation step at 75°C for 10 min. The PCR products were digested with EcoRI and BamHI, inserted into pcDNA3, and fully sequenced to verify their identity.

PCR assay for sequencing of the mutation

tRNA was extracted from LB831-EBV cells as described previously. Reverse transcription was performed on RNA from LB831-BLC and LB831-EBV cells as described above. PCR amplification was performed with DNA polymerase Dynazyme (Finnzymes Oy, Helsinki, Finland), the sense primer MGU1 (5'-GCTCAGATGATGTGGTTGAT located at position 591–610 of KIAA0205), and the antisense primer MGU10 (5'-ACTGTTGGTTTCCTGTATCC located at position 1044–1063 of KIAA0205). The PCR conditions were 5 min at 94°C followed by 35 cycles consisting of 1 min at 94°C, 1 min at 57°C, and 1 min at 72°C and by a final elongation step at 72°C for 15 min. The PCR products were subsequently purified on a Sepharose CL6B column and sequenced with the primer MGU3 (5'-TTGAATGCACTTGTAGCACA located at position 891–910 of KIAA0205). The PCR products were cloned into the pCR3.1 vector using the Bidirectional Eukaryotic TA Cloning Kit (Invitrogen), and individual clones were sequenced with the primer MGU3. The RNA integrity of LB831-EBV cells was checked by reverse transcription and amplification of the ß-actin mRNA.

PCR assay for expression of the KIAA0205 gene in normal tissues

Both tRNA extraction and RT-PCR amplification were performed on normal human tissues as described above. An additional step of DNA digestion was performed after the RNA extraction to eliminate any contaminating genomic DNA. The PCR reaction was performed with the sense primer MGU2 (5'-AATTACAGGAGCAGAGATCG located at position 735–754 of KIAA0205) and the antisense primer MGU10. The PCR products were then analyzed on a 1.5% agarose gel.

PCR assay for expression of the mutation in tumors

tRNA extraction and RT-PCR amplification were performed as described above. The PCR reaction was performed for 35 cycles with the sense primer MGU1 and the antisense primer MGU11 (5'-CTCCTACGGTGACCTTGACA located at position 1356–1375 of KIAA0205). The annealing temperature was 59°C. The reaction was then divided into two aliquots, one of which was digested with SspI. The PCR products were subsequently analyzed on a 1.5% agarose gel. The nonmutated PCR product is 784 base pairs (bp). The presence of the mutation at position 1023 creates an SspI site around that position (the mutated and normal sequences located at position 1023–1028 are AATATT and GATATT, respectively), and two fragments of 432 bp and 352 bp are then generated after digestion with SspI. RNA integrity was checked by reverse transcription and amplification of the ß-actin mRNA.

Transfection of 293 cells expressing EBV nuclear Ag (EBNA)-1 (293-EBNA)

Transient transfection was performed with the lipofectamine reagent (Life Technologies). Briefly, 5 x 104 293-EBNA cells in a flat-bottom 96-well dish were transfected with 100 ng of plasmid DNA from a pool of the cDNA library or with 100 ng of plasmid containing P-035-1 cDNA, 60 ng of plasmid pcDNA3 containing the HLA-B4403, and 2.5 µl of lipofectamine. Transfected cells were tested in a CTL stimulation assay after 24 h.

DNA sequence analysis

DNA sequencing was performed by the dideoxy chain termination method (Thermo Sequenase cycle sequencing kit, Amersham, Cleveland, OH) using specific oligonucleotides as primers. The computer search for sequence homology was performed with the database located at blast@ncbi.nlm.nih.gov (National Library of Medicine, National Institutes of Health, Bethesda, MD).

Stable transfection of tumor cell lines

The bladder carcinoma cell line LB831-BLC was transfected by the calcium phosphate precipitation method as described previously (37). A total of 1 x 106 cells were transfected with 20 µg of plasmid pEF-BOSpuro-PL3 containing the cDNA B7-1. Briefly, B7-1 was amplified using the sense primer 5'-GGGTCCAAATTGTTGGCTTTCACT and the antisense primer 5'-GAAGAATGCCTCATGATCCCCA in a PCR reaction with cDNA from cell line LB23-EBV as a template. The PCR conditions were similar to those described previously, except that the annealing temperature was 55°C, and the extension was performed for 3 min. The B7-1 insert was then cloned into plasmid pEF-BOSpuro-PL3, which was derived from pEF-BOS (38) by the insertion of a puromycin resistance gene and a polylinker. Puromycin-resistant LB831-BLC cells were selected in 0.8 µg/ml puromycin (Sigma, St. Louis, MO) and then cloned by limiting dilution. RCC BB64-RCC was transfected by the calcium phosphate precipitation method with plasmid pEF-BOSpuro-PL3 containing the P-035-1 insert and selected in puromycin as described above.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CTL clones recognizing LB831-BLC

To derive CTLs directed against bladder tumor cells, we first adapted to culture tumor cells from a surgical sample of invasive bladder carcinoma. We then stimulated autologous blood lymphocytes with irradiated cells from this tumor line, called LB831-BLC, in the presence of IL-2. After three weekly stimulations, the T cell culture exerted a weak lytic activity against K562 NK target cells but no specific activity against autologous tumor cells (data not shown).

To increase the stimulatory capacity of LB831-BLC cells, we transfected them with the cDNA of the B7-1 costimulatory molecule. We cloned the transfected population by limiting dilution and selected a single cell clone, LB831-BLC-B7-1, based on its high surface expression of B7-1. We stimulated autologous CD8+ blood mononuclear cells with irradiated LB831-BLC-B7-1 cells in the presence of IL-2 and autologous irradiated feeder cells. After three weekly restimulations with freshly irradiated LB831-BLC-B7-1 cells and IL-2, the culture showed weak yet reproducible lytic activity on the autologous tumor cells. This lytic activity was specific, since the same level of lysis was reached in the presence of an excess of unlabeled K562 NK target cells (data not shown). This finding indicated that cytotoxic T cells specifically directed against LB831-BLC human tumor cells were present in the MLTC.

To analyze more precisely the cytotoxic response and further characterize the Ags recognized by the T cells, we cloned the bulk MLTC by limiting dilution. We obtained a panel of CD8+ T cell clones, including clones 360b/40, 360b/41, and 360b/52, which lysed autologous LB831-BLC tumor cells but not K562 or autologous EBV-transformed B cells (Fig. 1Go). A heterologous bladder tumor line, LB905-BLC, was also lysed by CTL 360b/52 but was not lysed by the two other clones.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 1. Specific lysis of tumor cell lines by CTL clones 360b/40, 360b/41, and 360b/52. The autologous tumor cell line LB831-BLC (•), the autologous EBV-transformed lymphoblastoid line LB831-EBV ({square}), the NK cell-sensitive line K562 ({circ}), and the heterologous bladder tumor line LB905-BLC ({blacksquare}) were used as target cells. Chromium release was measured after 4 h.

 
To define the MHC restriction of the CTL clones, we studied the inhibitory effect of mAbs on their stimulation (Fig. 2Go). All clones specifically produced TNF when stimulated with LB831-BLC tumor cells. This production of TNF was completely blocked in the presence of the anti-HLA class I mAb W6/32. Anti-CD8 but not anti-CD4 Abs also inhibited the release of TNF. The CTL clone 360b/40 was blocked by an Ab directed against HLA-B or -C molecules (Fig. 2Go). This observation indicates that this CTL recognizes an Ag, LB831-A, which is presented by HLA molecule B4403, HLA-B4901, HLA-Cw04, or HLA-Cw07. CTL clone 360b/41 was not inhibited by the anti-B or -C Ab, indicating that it is restricted by one of the two HLA-A molecules of patient LB831. A mAb against HLA-A3, but not a mAb against HLA-A24, blocked the production of TNF by CTL 360b/41, indicating that this CTL recognizes a second Ag, LB831-B, which is presented by HLA-A3. TNF secretion by the third CTL clone, 360b/52, was blocked by the anti-B or -C Ab. In agreement with the lysis data, we found that this clone produced TNF when stimulated with heterologous LB905-BLC tumor cells. This production was also inhibited by the Ab against HLA-B or -C molecules. Because CTL 360b/52, as opposed to CTL 360b/40, recognizes LB905-BLC, it defines an Ag different from LB831-A, which we called LB831-C. Since HLA-Cw07 is the only B or C molecule that is common to both LB831-BLC and LB905-BLC, this molecule is probably the restricting molecule for CTL 360b/52. Unfortunately, this CTL clone could not be maintained in a long-term culture, thereby preventing further analysis of Ag LB831-C.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 2. HLA restriction of CTL clones 360b/40, 360b/41, and 360b/52. LB831-BLC, LB905-BLC or MZ2-MEL tumor cells either alone or in the presence of mAbs of the indicated specificity were used to stimulate CTL 360b/40, 360b/41, and 360b/52. After 18 h of coculture, the production of TNF by CTLs was measured by testing the toxicity of the supernatants for TNF-sensitive cells WEHI-164.13. In the bottom panel, TNF secreted by CTL 360b/40, 360b/41, and 360b/52 in response to the negative control melanoma cells MZ2-MEL were 11, 6, and 3 pg/ml, respectively.

 
Identification of a cDNA coding for Ag LB831-A recognized by CTL 360b/40

To identify the Ag recognized by CTL 360b/40, we prepared a directional cDNA library with poly(A)+ RNA from the LB831-BLC tumor cell line. We cloned the library into plasmid pCEP4 downstream from the CMV promoter. The plasmid also contains the EBV origin of replication and the sequence-encoding EBNA-1, which transactivates the EBV replication origin allowing high copy episomal replication of the plasmid when transfected into mammalian cells. We divided the cDNA library into 582 pools of 100 recombinant clones and prepared DNA from each pool. As described above, CTL 360b/40 appeared to be restricted by HLA-B4403, -B4901, -Cw04, or -Cw07. Therefore, we used PCR amplification to clone the cDNAs coding for each of these molecules. We transiently transfected human 293-EBNA with DNA from each cDNA pool and from the HLA-B4403 cDNA. We added CTLs after 24 h and measured the production of TNF in the supernatant. One cDNA pool was able to induce the production of TNF by CTL 360b/40. We then subcloned the bacteria corresponding to this pool and similarly transfected DNA from individual colonies. One cDNA, P-035-1, was able to induce TNF secretion by CTLs when transfected with the HLA-B4403 cDNA (Fig. 3GoA). P-035-1 cDNA did not stimulate CTL 360b/40 when transfected without B4403 cDNA, suggesting that Ag LB831-A consists of a peptide encoded by P-035-1 and presented by HLA-B4403. Overexpression of the transiently transfected cDNA was not required for CTL recognition, as an HLA-B4403+ RCC line stably transfected with P-035-1 cDNA was lysed by CTL 360b/40 (Fig. 3GoB).



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 3. Identification of a cDNA clone encoding the Ag recognized by CTL 360b/40. A, Stimulation of CTL 360b/40 by 293-EBNA cells transfected with cDNA P-035-1. 293-EBNA cells were transiently transfected with the indicated cDNA, which had been cloned in either pcDNA3 (HLA-B4403) or pCEP4 (P-035-1). After 18 h of coculture with transfected cells, production of the TNF by CTL 360b/40 was measured by testing the toxicity of the supernatants for TNF-sensitive cells WEHI-164.13. B, Lysis by CTL 360b/40 of BB64-RCC cells transfected with cDNA P-035-1. BB64-RCC is an HLA-B4403 RCC line. It was stably transfected with the P-035-1 cDNA cloned in pEF-BOSpuro-PL3. Chromium release was measured after 4 h.

 
Sequence and expression of the P-035-1 cDNA

P-035-1 cDNA is 1378 bp long, and its sequence is almost identical to a cDNA sequence reported in GenBank under the name KIAA0205 (GenBank accession number D86960). This cDNA has been isolated from an acute myeloblastoid leukemia line called KG-1. Nothing is known about the expression profile of this gene in normal tissues. It is 6253 bp long and contains an open reading frame of 1110 nucleotides from position 228 to 1337 (Fig. 4Go). Our cDNA is identical to the region of KIAA0205 located between positions 426 and 1766, except in position 1023, in which G is replaced by A. In addition, the last 37 nucleotides of our cDNA are not found in KIAA0205. The region of KIAA0205 that is downstream from position 1766 might correspond to unspliced intron sequences, even though it does not start with a donor splice site. Alternatively, the region might correspond to an unrelated sequence accidentally linked to the first sequence during the construction of the cDNA library.



View larger version (10K):
[in this window]
[in a new window]
 
FIGURE 4. Homology between P-035-1 and KIAA0205 cDNAs. The indicated nucleotide positions refer to the KIAA0205 sequence. The P-035-1 and KIAA0205 sequences are identical except at position 1023 and at the end of the 3' noncoding region. The shaded area represents the open reading frame of the KIAA0205 cDNA, and the hatched box represents the 37 nucleotide-long segment unrelated to the KIAA0205 cDNA. The sequence of this segment, TGCCAAGCCACTGGATCTTACATTAAACATCATACTC, is not related to other known sequences.

 
We tested the expression of the KIAA0205 gene by RT-PCR in normal tissues. DNase-treated RNA from a number of normal human tissues were amplified by RT-PCR with primers located at position 735–754 and 1044–1063 of the KIAA0205 cDNA. A 328-bp PCR product was observed for each of the normal tissues tested, demonstrating that the KIAA0205 gene is expressed ubiquitously (Fig. 5Go).



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 5. Ubiquitous expression of the KIAA0205 gene. tRNA isolated from the normal human tissues indicated was reverse-transcribed. The cDNAs were then amplified with the primers MGU2 and MGU11. The PCR products were run on a 1.5% agarose gel and stained with ethidium bromide. Water and cDNA from the tumor line LB831-BLC were used as a negative and positive control, respectively.

 
A point mutation in the KIAA0205 gene expressed by bladder cancer cells

The nucleotide substitution found in P-035-1 at position 1023 of the KIAA0205 sequence changes one amino acid at position 266 of the putative protein of 370 residues. This sequence difference could result either from allelic polymorphism, since the two sequences come from different individuals, or from a tumor-specific mutation in P-035-1. To test the latter possibility, we cloned the equivalent cDNA from autologous normal LB831-EBV cells. We amplified a 472-bp fragment encompassing position 1023 by PCR using either tumoral cDNA from LB831-BLC or normal cDNA from LB831-EBV as a template and then sequenced the PCR products (Fig. 6Go). Position 1023 of the normal sequence read G as in KIAA0205, demonstrating that the nucleotide substitution resulted from a tumor-specific mutation. Position 1023 of the tumoral sequence read both A and G, as in P-035-1 and KIAA0205, respectively, indicating that only one of the two alleles of the gene was mutated in the tumor cells.



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 6. A point mutation leads to an amino acid exchange in the coding region of the KIAA0205 gene expressed by LB831-BLC. A, Autoradiography showing the sequence ladder around nucleotide 1023 of the KIAA0205 cDNA from LB831-EBV cells and LB831-BLC tumor cells. tRNA was isolated from LB831-EBV and LB831-BLC cells and reverse-transcribed. The cDNAs were then amplified by PCR using the primers MGU1 and MGU10. The PCR products were directly sequenced by the dideoxy chain termination method using the primer MGU3. The critical position 1023, which is mutated in one of the KIAA0205 alleles from LB831-BLC, is indicated by an arrow. B, Alignment of the partial nucleotide sequence and the deduced protein sequence of KIAA0205 (top) and P-035-1 (bottom). The G to A transition at position 1023 of KIAA0205 leads to an aspartic acid to asparagine exchange at residue 266.

 
We then wanted to exclude the possibility that the mutation had occurred during in vitro culture of the tumor cells. Therefore, we prepared RNA from the original tumor sample of patient LB831, which had been frozen just after surgery. To detect the presence of the mutation in the RNA sample, we took advantage of the fact that the mutation observed in P-035-1 creates an SspI restriction site that is absent in the wild-type sequence. After reverse transcription, we amplified a 784-bp product by PCR and digested it with SspI. As shown in Figure 7Go, we observed two bands of the expected sizes after SspI digestion of the PCR products derived from both the original tumor and the cultured cell line, indicating that the mutation had occurred in vivo. This finding was further confirmed when we sequenced the PCR product: 5 of 20 clones obtained after ligation of the PCR product from the original tumor in a plasmid vector harbored the mutated gene. We then looked for the mutation in a series of other tumor samples by PCR amplification followed by SspI digestion. We did not find the mutation in any of the 60 bladder carcinoma samples, 26 melanoma samples, 12 RCC samples, and 55 other tumor samples tested. Therefore, this mutation appears to be unique to LB831-BLC.



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 7. Detection of the point mutation in the original tumor sample of patient LB831 by SspI digestion. tRNA that had been isolated from cultured LB831-BLC cells, from the original LB831-BLC tumor sample, from the EBV-transformed B cells, and from the PBLs of patient LB831 was reverse-transcribed. The cDNAs were then amplified by PCR using the primers MGU1 and MGU11. The PCR products were either not digested (-) or were digested (+) with restriction enzyme SspI, analyzed on a 1.5% agarose gel, and stained with ethidium bromide. Water was included as negative control.

 
Identification of the antigenic peptide

To determine whether the mutation is responsible for the recognition of LB831-BLC cells by CTL 360b/40, we tested synthetic peptides encoded by the mutated region for CTL recognition. The mutation changes residue 266 of the KIAA0205 protein from aspartic acid to asparagine. The consensus motif for binding to HLA-B4403 is a glutamic acid at position 2 and a hydrophobic residue at position 9 or 10 (39). Since residue 263 of KIAA0205 is a glutamic acid and residue 270 is a tryptophan, peptide 262–270 most likely binds to HLA-B4403. We then synthesized the normal (AEPIDIQTW) and the mutated (AEPINIQTW) versions of peptide 262–270. We pulsed HLA-B4403+ EBV-B cells with these peptides and tested them for recognition by CTL 360b/40. As shown in Figure 8GoA, the mutated peptide was efficiently recognized by the CTLs, whereas the normal peptide was not. As expected from the presence of the binding motif, the normal peptide can bind to HLA-B4403, since increasing amounts of this peptide reduce the binding of a control peptide to HLA-B4403 (Fig. 8GoB). We conclude that the mutation found in position 1023 of the KIAA0205 gene in LB831-BLC tumor cells creates a new epitope in peptide 262–270 and is therefore responsible for the recognition of the tumor cells by CTL 360b/40.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 8. The mutation creates a new epitope in peptide 262–270. A, Lytic activity of CTL clone 360b/40 on LG2-EBV cells pulsed with the indicated synthetic peptides. Chromium-labeled HLA-B4403 EBV-transformed cells (LG2-EBV) were pulsed for 30 min with the peptides at various concentrations before the addition of CTL 360b/40 at an E:T ratio of 5. Chromium release was measured after 4 h. B, Comparison of the normal and mutated peptides for their binding affinity to HLA-B4403. The ability of these peptides to compete with a standard peptide for binding to HLA-B4403 was measured with antityrosinase CTL 22/31, which recognizes the tyrosinase peptide SEIWRDIDF bound to the HLA-B4403 molecule. Results are presented as percentages of the specific lysis obtained with the tyrosinase peptide alone, which was 87%. In the absence of the tyrosinase peptide, the lysis of C1R-B4403 cells was 14%. Competitor peptides included the normal and mutated KIAA0205 262–270 peptides AEPIDIQTW ({circ}) and AEPINIQTW (•), respectively. The EBNA-3C-derived peptide EENLLDFVRF (50, 51) was used as a positive control for binding to HLA-B4403 ({blacksquare}). The irrelevant peptide LPRWPPPEL was used as a negative control ({square}). Chromium release was measured after 2 h.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To our knowledge, this report is the first to describe human CTL clones specifically directed against bladder tumor cells. These CTLs could only be obtained after the in vitro stimulation of blood lymphocytes with B7-1-transfected tumor cells. Since B7-1-expressing cells appear to be required for the activation of naive T cells, this suggests the lack of in vivo priming of tumor-specific CTLs (40). Alternatively, in vivo priming of the CTLs may be suboptimal, due to inappropriate activation or tumor-induced immunosuppression, and may result in a very weak response or a state of nonresponsiveness. A requirement for in vitro stimulation with B7+ cells to obtain CTLs against a human head and neck carcinoma has also been observed, suggesting that this requirement may be common to human tumors other than melanoma and RCC (41).

Although a significant proportion of bladder tumors express the genes MAGE, BAGE, and GAGE (42), which were initially characterized on melanoma, nothing is known about the Ags that are actually recognized by autologous CTLs on bladder tumors. We show here that our CTL clones recognize three different tumor Ags. This finding is in line with the observations concerning melanoma and RCC, where the autologous CTL response was found to be directed against a number of distinct Ags (43, 44, 45, 46, 47). This diversity of tumor Ags may prove essential for the success of cancer immunotherapy. Simultaneous immunization against several Ags may increase the efficacy of cancer vaccines and reduce the emergence of escaping variants arising through a loss of Ag expression.

The function of the KIAA0205 protein is not known. Its ubiquitous expression might reflect a housekeeping function. It contains no signal peptide nor any known targeting signal to specific organelles, and might therefore be located in the cytosol.

Several mutations that generate antigenic peptides recognized by CTLs on human tumors appear to play a role in oncogenesis. This is the case for cyclin dependent kinase 4, whose mutation prevents binding to its inhibitor p16 and therefore constitutively drives the cell into the cycle (19). This also appears to be the case for the mutated ß-catenin, which is stabilized and thereby aberrantly activates gene transcription by constitutively forming activating complexes with transcription factor LEF-1 (20, 48). We also recently reported a mutation generating an antigenic peptide in caspase-8, a protease involved in the transduction of the apoptotic signal through the FAS and the TNF receptor (41). The ability of the mutated caspase-8 to transduce the apoptotic signal appears to be reduced relative to its normal counterpart. Because the function of the KIAA0205 protein is unknown, it is very difficult to determine whether the mutation reported here also has an oncogenic effect. Preliminary experiments of transfection into NIH-3T3 cells failed to detect a transforming property for the mutated KIAA0205.

In the last five years, a number of human tumor Ags that are recognized by class I-restricted CTLs have been characterized, mainly on melanoma and RCC (49). This work has allowed the development of new clinical trials targeted specifically against defined tumor Ags. Such trials are currently being evaluated in melanoma (50). The results presented here represent the first molecular characterization of a tumor Ag recognized by CTLs on a bladder tumor. They indicate that the genetic approach aimed at cloning the gene encoding the antigenic target of previously established CTLs, which was initially developed in melanoma, is also efficient in bladder cancer and will hopefully lead to the characterization of clinically useful Ags in this tumor type.


    Acknowledgments
 
We thank Vinh Ha Thi and Anne Authom for assistance in the sequencing experiments. We are also grateful to Dr. Alain Amar-Costesec for help in protein analysis and to Drs. Pierre van der Bruggen and Pierre Coulie for helpful discussions.


    Footnotes
 
1 This work was supported in part by the Caisse Générale d’Epargne et de Retraite-Assurances-Belgium, by the Belgian Program on Interuniversity Poles of Attraction instituted by the Belgian state, Prime Minister’s Office, Office for Science, Technology, and Culture, and by the BIOMED 1 and BIOMED 2 programs of the European Community. J.-J.P. was supported by a grant from the Association pour la Recherche contre le Cancer (France) and by grant PHRC A0A94015 from the Assistance Publique des Hôpitaux de Paris (France); B.G. was supported by a postdoctoral fellowship from the European Community, and J.-C.R. is a research associate with the Fonds National de la Recherche Scientifique (Belgium). Back

2 Present address: SmithKline Beecham Biologicals, Rue de l’Institut 89, 1330 Rixensart, Belgium. Back

3 Address correspondence and reprint requests to Dr. Benoît J. Van den Eynde, Ludwig Institute for Cancer Research, Brussels Branch and Cellular Genetics Unit, Université Catholique de Louvain, Avenue Hippocrate 74, UCL 7459, B-1200 Brussels, Belgium. Back

4 Abbreviations used in this paper: RCC, renal cell carcinoma; BCG, Bacillus of Calmette-Guérin; MLTC, mixed lymphocyte tumor cell culture; tRNA, total RNA; bp, base pair; EBNA, EBV nuclear Ag. Back

Received for publication January 7, 1998. Accepted for publication February 6, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. van der Bruggen, P., C. Traversari, P. Chomez, C. Lurquin, E. De Plaen, B. Van den Eynde, A. Knuth, T. Boon. 1991. A gene encoding an antigen recognized by cytolytic T lymphocytes on a human melanoma. Science 254:1643.[Abstract/Free Full Text]
  2. Traversari, C., P. van der Bruggen, I. F. Luescher, C. Lurquin, P. Chomez, A. Van Pel, E. De Plaen, A. Amar-Costesec, T. Boon. 1992. A nonapeptide encoded by human gene MAGE-1 is recognized on HLA-A1 by cytolytic T lymphocytes directed against tumor antigen MZ2-E. J. Exp. Med. 176:1453.[Abstract/Free Full Text]
  3. van der Bruggen, P., J.-P. Szikora, P. Boël, C. Wildmann, M. Somville, M. Sensi, T. Boon. 1994. Autologous cytolytic T lymphocytes recognize a MAGE-1 nonapeptide on melanomas expressing HLA-Cw*1601. Eur. J. Immunol. 24:2134.[Medline]
  4. Gaugler, B., B. Van den Eynde, P. van der Bruggen, P. Romero, J. J. Gaforio, E. De Plaen, B. Lethé, F. Brasseur, T. Boon. 1994. Human gene MAGE-3 codes for an antigen recognized on a melanoma by autologous cytolytic T lymphocytes. J. Exp. Med. 179:921.[Abstract/Free Full Text]
  5. van der Bruggen, P., J. Bastin, T. Gajewski, P. G. Coulie, P. Boël, C. De Smet, C. Traversari, A. Townsend, T. Boon. 1994. A peptide encoded by human gene MAGE-3 and presented by HLA-A2 induces cytolytic T lymphocytes that recognize tumor cells expressing MAGE-3. Eur. J. Immunol. 24:3038.[Medline]
  6. Herman, J., P. van der Bruggen, I. Luescher, S. Mandruzzato, P. Romero, J. Thonnard, K. Fleischhauer, T. Boon, P. G. Coulie. 1996. A peptide encoded by human gene MAGE-3 and presented by HLA-B44 induces cytolytic T lymphocytes that recognize tumor cells expressing MAGE-3. Immunogenetics 43:377.[Medline]
  7. Boël, P., C. Wildmann, M.-L. Sensi, R. Brasseur, J.-C. Renauld, P. Coulie, T. Boon, P. van der Bruggen. 1995. BAGE, a new gene encoding an antigen recognized on human melanomas by cytolytic T lymphocytes. Immunity 2:167.[Medline]
  8. Van den Eynde, B., O. Peeters, O. De Backer, B. Gaugler, S. Lucas, T. Boon. 1995. A new family of genes coding for an antigen recognized by autologous cytolytic T lymphocytes on a human melanoma. J. Exp. Med. 182:689.[Abstract/Free Full Text]
  9. Gaugler, B., N. Brouwenstijn, V. Vantomme, J.-P. Szikora, C. W. Van der Spek, J.-J. Patard, T. Boon, P. Schrier, B. J. Van den Eynde. 1996. A new gene coding for an antigen recognized by autologous cytolytic T lymphocytes on a human renal carcinoma. Immunogenetics 44:323.[Medline]
  10. Brichard, V., A. Van Pel, T. Wölfel, C. Wölfel, E. De Plaen, B. Lethé, P. Coulie, T. Boon. 1993. The tyrosinase gene codes for an antigen recognized by autologous cytolytic T lymphocytes on HLA-A2 melanomas. J. Exp. Med. 178:489.[Abstract/Free Full Text]
  11. Wölfel, T., A. Van Pel, V. Brichard, J. Schneider, B. Seliger, K.-H. Meyer zum Büschenfelde, T. Boon. 1994. Two tyrosinase nonapeptides recognized on HLA-A2 melanomas by autologous cytolytic T lymphocytes. Eur. J. Immunol. 24:759.[Medline]
  12. Coulie, P. G., V. Brichard, A. Van Pel, T. Wölfel, J. Schneider, C. Traversari, S. Mattei, E. De Plaen, C. Lurquin, J.-P. Szikora, J.-C. Renauld, T. Boon. 1994. A new gene coding for a differentiation antigen recognized by autologous cytolytic T lymphocytes on HLA-A2 melanomas. J. Exp. Med. 180:35.[Abstract/Free Full Text]
  13. Kawakami, Y., S. Eliyahu, K. Sakaguchi, P. F. Robbins, L. Rivoltini, J. R. Yannelli, E. Appella, S. A. Rosenberg. 1994. Identification of the immunodominant peptides of the MART-1 human melanoma antigen recognized by the majority of HLA-A2-restricted tumor-infiltrating lymphocytes. J. Exp. Med. 180:347.[Abstract/Free Full Text]
  14. Bakker, A. B. H., M. W. J. Schreurs, A. J. de Boer, Y. Kawakami, S. A. Rosenberg, G. J. Adema, C. G. Figdor. 1994. Melanocyte lineage-specific antigen gp100 is recognized by melanoma-derived tumor-infiltrating lymphocytes. J. Exp. Med. 179:1005.[Abstract/Free Full Text]
  15. Kawakami, Y., S. Eliyahu, C. Jennings, K. Sakaguchi, X. Kang, S. Southwood, P. F. Robbins, A. Sette, E. Appella, S. A. Rosenberg. 1995. Recognition of multiple epitopes in the human melanoma antigen gp100 by tumor-infiltrating T lymphocytes associated with in vivo tumor regression. J. Immunol. 154:3961.[Abstract]
  16. Wang, R.-F., M. R. Parkhurst, Y. Kawakami, P. F. Robbins, S. A. Rosenberg. 1996. Utilization of an alternative open reading frame of a normal gene in generating a novel human cancer antigen. J. Exp. Med. 183:1131.[Abstract/Free Full Text]
  17. Wang, R.-F., E. Appella, Y. Kawakami, X. Kang, S. A. Rosenberg. 1996. Identification of TRP-2 as a human tumor antigen recognized by cytotoxic T lymphocytes. J. Exp. Med. 184:2207.[Abstract/Free Full Text]
  18. Coulie, P. G., F. Lehmann, B. Lethé, J. Herman, C. Lurquin, M. Andrawiss, T. Boon. 1995. A mutated intron sequence codes for an antigenic peptide recognized by cytolytic T lymphocytes on a human melanoma. Proc. Natl. Acad. Sci. USA 92:7976.[Abstract/Free Full Text]
  19. Wölfel, T., M. Hauer, J. Schneider, M. Serrano, C. Wölfel, E. Klehmann-Hieb, E. De Plaen, T. Hankeln, K.-H. Meyer zum Büschenfelde, D. Beach. 1995. A p16INK4a-insensitive CDK4 mutant targeted by cytolytic T lymphocytes in a human melanoma. Science 269:1281.[Abstract/Free Full Text]
  20. Robbins, P. F., M. El-Gamil, Y. F. Li, Y. Kawakami, D. Loftus, E. Appella, S. A. Rosenberg. 1996. A mutated ß-catenin gene encodes a melanoma-specific antigen recognized by tumor-infiltrating lymphocytes. J. Exp. Med. 183:1185.[Abstract/Free Full Text]
  21. Brändle, D., F. Brasseur, P. Weynants, T. Boon, B. Van den Eynde. 1996. A mutated HLA-A2 molecule recognized by autologous cytotoxic T lymphocytes on a human renal cell carcinoma. J. Exp. Med. 183:2501.[Abstract/Free Full Text]
  22. Fisk, B., T. L. Blevins, J. T. Wharton, C. G. Ioannides. 1995. Identification of an immunodominant peptide of HER-2/neu protooncogene recognized by ovarian tumor-specific cytotoxic T lymphocyte lines. J. Exp. Med. 181:2109.[Abstract/Free Full Text]
  23. Morales, A.. 1992. From the 19th to the 21st centuries: BCG in the treatment of superficial bladder cancer. Eur. Urol. 21:2.
  24. Haas, G. P., D. Solomon, S. A. Rosenberg. 1990. Tumor-infiltrating lymphocytes from nonrenal urological malignancies. Cancer Immunol. Immunother. 30:342.[Medline]
  25. Nouri, A. M. E., A. Bergbaum, E. Lederer, D. Crosby, A. Shamsa, R. T. D. Oliver. 1991. Paired tumour-infiltrating lymphocyte (TIL) and tumour cell line from bladder cancer: a new approach to study tumour immunology in vitro. Eur. J. Cancer 27:608.
  26. Storkus, W. J., D. N. Howell, R. D. Salter, J. R. Dawson, P. Cresswell. 1987. NK susceptibility varies inversely with target cell class I HLA antigen expression. J. Immunol. 138:1657.[Medline]
  27. Fleischhauer, K., N. A. Kernan, R. J. O’Reilly, B. Dupont, S. Y. Yang. 1990. Bone marrow-allograft rejection by T lymphocytes recognizing a single amino acid difference in HLA-B44. N. Engl. J. Med. 323:1818.[Medline]
  28. Fleischhauer, K., D. Avila, F. Vilbois, C. Traversari, C. Bordignon, H.-J. Wallny. 1994. Characterization of natural peptide ligands for HLA-B*4402 and -B*4403: implications for peptide involvement in allorecognition of a single amino acid change in the HLA-B44 heavy chain. Tissue Antigens 44:311.[Medline]
  29. Hérin, M., C. Lemoine, P. Weynants, F. Vessière, A. Van Pel, A. Knuth, R. Devos, T. Boon. 1987. Production of stable cytolytic T-cell clones directed against autologous human melanoma. Int. J. Cancer 39:390.[Medline]
  30. Boon, T., J. Van Snick, A. Van Pel, C. Uyttenhove, M. Marchand. 1980. Immunogenic variants obtained by mutagenesis of mouse mastocytoma P815: T lymphocyte-mediated cytolysis. J. Exp. Med. 152:1184.[Abstract/Free Full Text]
  31. Parham, P., C. J. Barnstable, W. F. Bodmer. 1979. Use of a monoclonal antibody (W6/32) in structural studies of HLA-A,B,C antigens. J. Immunol. 123:342.[Abstract/Free Full Text]
  32. Brichard, V. G., J. Herman, A. Van Pel, C. Wildmann, B. Gaugler, T. Wölfel, T. Boon, B. Lethé. 1996. A tyrosinase nonapeptide presented by HLA-B44 is recognized on a human melanoma by autologous cytolytic T lymphocytes. Eur. J. Immunol. 26:224.[Medline]
  33. Espevik, T., J. Nissen-Meyer. 1986. A highly sensitive cell line, WEHI 164 clone 13, for measuring cytotoxic factor/tumor necrosis factor from human monocytes. J. Immunol. Methods 95:99.[Medline]
  34. Hansen, M. B., S. E. Nielsen, K. Berg. 1989. Re-examination and further development of a precise and rapid dye method for measuring cell growth/cell kill. J. Immunol. Methods 119:203.[Medline]
  35. Davis, L. G., M. D. Dibner, J. F. Battey. 1986. Guanidine isothiocyanate preparation of total RNA. Basic Methods in Molecular Biology 130. Elsevier, New York.
  36. Ennis, P. D., J. Zemmour, R. D. Salter, P. Parham. 1990. Rapid cloning of HLA-A,B cDNA by using the polymerase chain reaction: frequency and nature of errors produced in amplification. Proc. Natl. Acad. Sci. USA 87:2833.[Abstract/Free Full Text]
  37. Traversari, C., P. van der Bruggen, B. Van den Eynde, P. Hainaut, C. Lemoine, N. Ohta, L. Old, T. Boon. 1992. Transfection and expression of a gene coding for a human melanoma antigen recognized by autologous cytolytic T lymphocytes. Immunogenetics 35:145.[Medline]
  38. Mizushima, S., S. Nagata. 1990. pEF-BOS, a powerful mammalian expression vector. Nucleic Acids Res. 18:5322.[Free Full Text]
  39. Rammensee, H.-G., T. Friede, S. Stevanovic. 1995. MHC ligands and peptide motifs: first listing. Immunogenetics 41:178.[Medline]
  40. Gajewski, T. F., J.-C. Renauld, A. Van Pel, T. Boon. 1995. Costimulation with B7-1, IL-6, and IL-12 is sufficient for primary generation of murine antitumor cytolytic T lymphocytes in vitro. J. Immunol. 154:5637.[Abstract]
  41. Mandruzzato, S., F. Brasseur, G. Andry, T. Boon, P. van der Bruggen. 1997. A CASP-8 mutation recognized by cytolytic T lymphocytes on a human head and neck carcinoma. J. Exp. Med. 186:785.[Abstract/Free Full Text]
  42. Marchand, M., C. Chatzopoulous, F. Brasseur, M. Guéguen, J.-J. Patard, P. François, P. J. Van Cangh, B. J. Van den Eynde. 1996. Tumour antigens recognized by cytolytic T lymphocytes: perspectives for specific immunotherapy of bladder cancer and other genitourinary tumours. Eur. Urol. Update Series 5:118.
  43. Van den Eynde, B., P. Hainaut, M. Hérin, A. Knuth, C. Lemoine, P. Weynants, P. van der Bruggen, R. Fauchet, T. Boon. 1989. Presence on a human melanoma of multiple antigens recognized by autologous CTL. Int. J. Cancer 44:634.[Medline]
  44. Lehmann, F., M. Marchand, P. Hainaut, P. Pouillart, X. Sastre, H. Ikeda, T. Boon, P. G. Coulie. 1995. Differences in the antigens recognized by cytolytic T cells on two successive metastases of a melanoma patient are consistent with immune selection. Eur. J. Immunol. 25:340.[Medline]
  45. Knuth, A., T. Wölfel, E. Klehmann, T. Boon, K.-H. Meyer zum Büschenfelde. 1989. Cytolytic T-cell clones against an autologous human melanoma: specificity study and definition of three antigens by immunoselection. Proc. Natl. Acad. Sci. USA 86:2804.[Abstract/Free Full Text]
  46. Anichini, A., R. Mortarini, C. Maccalli, P. Squarcina, K. Fleischhauer, L. Mascheroni, G. Parmiani. 1996. Cytotoxic T cells directed to tumor antigens not expressed on normal melanocytes dominate HLA-A2.1-restricted immune repertoire to melanoma. J. Immunol. 156:208.[Abstract]
  47. Brouwenstijn, N., B. Gaugler, K. M. Krüse, C. W. Van der Spek, A. Mulder, S. Osanto, B. J. Van den Eynde, P. I. Schrier. 1996. Renal-cell carcinoma-specific lysis by cytotoxic T lymphocyte clones isolated from peripheral blood lymphocytes and tumor-infiltrating lymphocytes. Int. J. Cancer 68:177.[Medline]
  48. Rubinfeld, B., P. Robbins, M. El-Gamil, I. Albert, E. Porfiri, P. Polakis. 1997. Stabilization of ß-catenin by genetic defects in melanoma cell lines. Science 275:1790.[Abstract/Free Full Text]
  49. Van den Eynde, B. J., T. Boon. 1997. Tumor antigens recognized by T lymphocytes. Int. J. Clin. Lab. Res. 27:81.[Medline]
  50. Marchand, M., P. Weynants, E. Rankin, F. Arienti, F. Belli, G. Parmiani, N. Cascinelli, A. Bourlond, R. Vanwijck, Y. Humblet, J.-L. Canon, C. Laurent, J.-M. Naeyaert, R. Plagne, R. Deraemaeker, A. Knuth, E. Jäger, F. Brasseur, J. Herman, P. G. Coulie, T. Boon. 1995. Tumor regression responses in melanoma patients treated with a peptide encoded by gene MAGE-3. Int. J. Cancer 63:883.[Medline]
  51. Khanna, R., S. R. Burrows, M. G. Kurilla, C. A. Jacob, I. S. Misko, T. B. Sculley, E. Kieff, D. J. Moss. 1992. Localization of Epstein-Barr virus cytotoxic T cell epitopes using recombinant vaccinia: implications for vaccine development. J. Exp. Med. 176:169.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
M. Sensi and A. Anichini
Unique Tumor Antigens: Evidence for Immune Control of Genome Integrity and Immunogenic Targets for T Cell-Mediated Patient-Specific Immunotherapy
Clin. Cancer Res., September 1, 2006; 12(17): 5023 - 5032.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Grube, K. Rezvani, A. Wiestner, H. Fujiwara, G. Sconocchia, J. J. Melenhorst, N. Hensel, G. E. Marti, L. W. Kwak, W. Wilson, et al.
Autoreactive, Cytotoxic T Lymphocytes Specific for Peptides Derived from Normal B-Cell Differentiation Antigens in Healthy Individuals and Patients with B-Cell Malignancies
Clin. Cancer Res., February 1, 2004; 10(3): 1047 - 1056.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
D. Chopin, R. Barei-Moniri, P. Maille, M.-A. Le Frere-Belda, B. Muscatelli-Groux, N. Merendino, L. Lecerf, A. Stoppacciaro, and F. Velotti
Human Urinary Bladder Transitional Cell Carcinomas Acquire the Functional Fas Ligand during Tumor Progression
Am. J. Pathol., April 1, 2003; 162(4): 1139 - 1149.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K.-i. Hanada, D. M. Perry-Lalley, G. A. Ohnmacht, M. P. Bettinotti, and J. C. Yang
Identification of Fibroblast Growth Factor-5 as an Overexpressed Antigen in Multiple Human Adenocarcinomas
Cancer Res., July 1, 2001; 61(14): 5511 - 5516.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. Probst-Kepper, V. Stroobant, R. Kridel, B. Gaugler, C. Landry, F. Brasseur, J.-P. Cosyns, B. Weynand, T. Boon, and B. J. Van den Eynde
An Alternative Open Reading Frame of the Human Macrophage Colony-Stimulating Factor Gene Is Independently Translated and Codes for an Antigenic Peptide of 14 Amino Acids Recognized by Tumor-Infiltrating Cd8 T Lymphocytes
J. Exp. Med., May 21, 2001; 193(10): 1189 - 1198.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J.-L. Gala, S. Loric, Y. Guiot, S. R. Denmeade, A. Gady, F. Brasseur, M. Heusterspreute, P. Eschwège, Philippe De Nayer, P. Van Cangh, et al.
Expression of Prostate-specific Membrane Antigen in Transitional Cell Carcinoma of the Bladder: Prognostic Value?
Clin. Cancer Res., October 1, 2000; 6(10): 4049 - 4054.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
L. Heidecker, F. Brasseur, M. Probst-Kepper, M. Gueguen, T. Boon, and B. J. Van den Eynde
Cytolytic T Lymphocytes Raised Against a Human Bladder Carcinoma Recognize an Antigen Encoded by Gene MAGE-A12
J. Immunol., June 1, 2000; 164(11): 6041 - 6045.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
B. J. Van den Eynde, B. Gaugler, M. Probst-Kepper, L. Michaux, O. Devuyst, F. Lorge, P. Weynants, and T. Boon
A New Antigen Recognized by Cytolytic T Lymphocytes on a Human Kidney Tumor Results from Reverse Strand Transcription
J. Exp. Med., December 20, 1999; 190(12): 1793 - 1800.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A.G.S. Buggins, N. Lea, J. Gaken, D. Darling, F. Farzaneh, G.J. Mufti, and W.J.R. Hirst
Effect of Costimulation and the Microenvironment on Antigen Presentation by Leukemic Cells
Blood, November 15, 1999; 94(10): 3479 - 3490.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Bilsborough, A. Van Pel, C. Uyttenhove, T. Boon, and B. J. Van den Eynde
Identification of a Second Major Tumor-Specific Antigen Recognized by CTLs on Mouse Mastocytoma P815
J. Immunol., March 15, 1999; 162(6): 3534 - 3540.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guéguen, M.
Right arrow Articles by Van den Eynde, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guéguen, M.
Right arrow Articles by Van den Eynde, B. J.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
Medline Plus Health Information
*Bladder Cancer


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS