| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Department of Medicine, Cork University Hospital, and
Department of Surgery, Mercy Hospital, National University of Ireland, Cork, Ireland
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Antigenically distinct cancers must overcome the host’s antitumor immunity to develop. Although a number of classical mechanisms have been proposed to account for tumor evasion of the immune system (these include defective Ag presentation, interference with tumor/T cell interaction, and production of immunosuppressive factors), new evidence points to expression of Fas ligand (FasL)4 as a possible mediator of tumor immune privilege (6). There are three basic findings that support this theory: first, FasL, by inducing FasR-mediated apoptosis of activated leukocytes, serves a number of negative regulatory functions in immunity, including 1) tolerance acquisition (7), 2) immune response termination (8, 9), 3) maintaining immune privilege in certain organs (10, 11), and 4) immunologic protection of allografts in animal transplantation experiments (12, 13, 14, 15). Second, various cancer cell lines express FasL and kill lymphoid cells by Fas-mediated apoptosis in vitro (16, 17, 18, 19, 20), and third, various human tumors have been shown to express FasL in vivo (17, 18, 19, 20, 21). There is as yet a paucity of direct evidence to confirm that FasL-expressing human cancers mount an effective Fas counterattack against Fas-sensitive antitumor immunocytes in vivo.
The aims of this study were to determine 1) whether human esophageal carcinomas express FasL, and 2) whether FasL expression is associated with increased apoptosis of tumor-infiltrating lymphocytes (TIL), thereby contributing to the immune privilege of the tumor. Using human esophageal carcinoma sections, we investigated FasL expression at the mRNA and protein levels. We quantified and compared both the number and cell death rate of CD45-positive TIL in FasL-positive vs FasL-negative tumor regions.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Human esophageal carcinomas (squamous, n = 6; adenocarcinoma, n = 2) were collected following surgical resection of esophageal carcinomas (n = 7) or investigative endoscopic biopsy (n = 1) at Mercy Hospital (Cork, Ireland), following a protocol approved by University Teaching Hospital’s Ethics Committee. None of the patients had received chemo-, radio-, or immunotherapy before tissue collection.
Immunohistochemical detection of FasL and FasR
Paraffin-embedded sections of esophageal tumors were deparaffinized in xylene and rehydrated before analysis. Slides were washed twice for 5 min in a wash buffer containing 50 mM Tris-Cl, pH 7.6, 50 mM NaCl, and 0.001% saponin, and endogenous peroxidase was quenched with 3% hydrogen peroxide in methanol for 5 min. Slides were washed as before, except that the wash buffer for this and all subsequent steps included 1% normal goat serum. Slides were then blocked for 1 h in wash buffer containing 5% normal goat serum. Slides were washed and incubated overnight at 4°C with a rabbit polyclonal anti-human FasL-specific IgG (Santa Cruz Biotechnology, Santa Cruz, CA) at 0.2 µg ml-1 in wash buffer. Ab binding was localized using a biotinylated secondary Ab, avidin-conjugated horseradish peroxidase, and diaminobenzidine substrate, contained within the Vectastain ABC detection kit (Vector Laboratories, Burlingame, CA). The immunizing peptide (FasL, N-terminal amino acids 2–19; Santa Cruz Biotechnology) was included at 2 µg ml-1 during primary Ab incubation in control staining. FasR was immunohistochemically detected using the same protocol, except that a rabbit polyclonal anti-human FasR-specific IgG (Santa Cruz Biotechnology) was used, along with its corresponding immunizing peptide (FasR, amino acids 316–335; Santa Cruz Biotechnology) in control staining. Slides were counterstained with hematoxylin.
Generation of a FasL-specific RNA probe (riboprobe)
A digoxigenin-labeled RNA hybridization probe (344 bp) was generated corresponding to codons 96–210 of the human FasL cDNA sequence. The riboprobe was synthesized by in vitro transcription using digoxygenin-11-UTP and T7 RNA polymerase (Boehringer Mannheim, Mannheim, Germany). Template for the in vitro transcription reaction was generated by PCR amplification of a fragment (codons 96–210) of FasL cDNA using a proofreading thermostable polymerase (UlTma DNA polymerase; Perkin-Elmer, Norwalk, CT) and an antisense primer to which a T7 promoter sequence was added.
RNA was isolated from FasL-expressing cells by homogenization in guanidine thiocyanate (Sigma, St. Louis, MO), followed by phenol extraction and ethanol precipitation. cDNA was synthesized using the AMV reverse transcriptase (Promega, Madison, WI) and random hexanucleotide primers (Boehringer Mannheim).
PCR was performed on the cDNA using the following sense and antisense primers, respectively: FasL, GGATTGGGCCTGGGGATGTTTCA and [pT7]-TTGTGGCTCAGGGGCAGGTTGTTG.
PCR primers were designed using the DNASTAR Lasergene Primerselect program (DNAstar, Madison, WI). Primer pairs were chosen to span introns in the FasL genomic sequence, thus ensuring mRNA-specific amplification. Primers were selected that showed no significant homology to any other genes in the EMBL DNA sequence database.
Thermal cycling (40 cycles) was as follows: denaturation at 96°C for 15 s, annealing at 55°C for 30 s, and extension at 72°C for 3 min. Primers were used at a final concentration of 0.1 µM each, dNTPs at 50 µM, and MgCl2 at 1.5 mM. One unit of UlTma DNA polymerase was used per 50-µl reaction. PCR product specificity was confirmed by restriction mapping.
Using this PCR-amplified FasL cDNA fragment as template, a riboprobe was synthesized by in vitro transcription using digoxygenin-11-UTP and T7 RNA polymerase (Boehringer Mannheim), according to the manufacturer’s instructions. The nucleotide sequence of the FasL probe showed no significant homology to any other sequence in the EMBL DNA sequence database. An unlabeled riboprobe was also synthesized for use in competitive control hybridizations.
Localization of FasL mRNA expression by in situ hybridization
In situ hybridization was performed on paraffin-embedded human esophageal tumor sections (4 µm thick), mounted on aminopropylethoxysilane (APES)-treated slides. Prehybridization treatments involved washing twice 5 min each in 1) PBS, 2) PBS and 0.1 M glycine, 3) PBS and 0.3% Triton X-100, and 4) PBS again. Sections were digested for 30 min at 37°C with proteinase K (10 µg/ml in 100 mM Tris-HCl, 50 mM EDTA, pH 8), fixed for 5 min at 4°C in 4% paraformaldehyde and PBS, and then acetylated twice for 5 min in fresh 0.25% acetic anhydride and 0.1 M triethanolamine (pH 8). Sections were incubated at 37°C for 10 min in a prehybridization buffer consisting of 50% deionized formamide in 4x SSC. Hybridization was performed at 42°C overnight in hybridization buffer (50% formamide, 10% dextran sulfate, 1x Denhardt’s reagent, 4x SSC, 10 mM DTT, 500 µg/ml yeast tRNA, and 1 mg/ml heat-denatured herring sperm DNA) containing 1 ng/µl digoxigenin-labeled riboprobe. After hybridization, tissues were washed with increasing stringency to 0.1x SSC at 37°C. Hybridized probe was detected immunologically using alkaline phosphatase-conjugated sheep anti-digoxigenin Ab (Boehringer Mannheim) and visualized with nitroblue tetrazololium/5-bromo-4-chloro-3-indolyl phosphates (NBT/BCIP; purple/black precipitating product). Control slides involved competitive inhibition of hybridization by adding a 10-fold excess of unlabeled riboprobe to the digoxigenin-labeled riboprobe before hybridization. This resulted in a marked reduction of signal intensity, thus confirming the specificity of hybridization.
CD45 (leukocyte common Ag) staining
To identify tumor-infiltrating immunocytes, CD45 (leukocyte common Ag) staining was performed on paraffin-embedded esophageal tumor sections. Following deparaffinization and rehydration, sections were pretreated by microwave irradiation in 0.01 M citrate buffer for 5 min at 370W. The sections were cooled rapidly by immersing in 0.1 M PBS. The slides were then incubated with a mouse anti-human CD45 monoclonal IgG (Dako, Carpenteria, CA) at a dilution of 1/70 for 1 h. All incubations were conducted at room temperature. Next the slides were washed for 5 min in 0.1 M Tris-buffered saline (TBS), which was used for all washes. Following incubation with a secondary rabbit anti-mouse IgG (Dako) at a dilution of 1/25 for 30 min, washing was repeated. Sections were then incubated for 30 min with alkaline phosphatase-conjugated anti-alkaline phosphatase (APAAP) complex (Dako), at a dilution of 1/50. Following washing, the secondary Ab and APAAP complex incubations were repeated (10 min each), to enhance staining. Sections were then incubated for 10 min with an alkaline phosphatase substrate solution (fast blue; Sigma). CD45-positive immunocytes appeared blue when viewed under light microscopy, and were almost exclusively of lymphoid morphology (i.e., TIL).
Immunocyte cell death detection by CD45/TUNEL dual staining
Cell death was detected in situ in resected esophageal tumors by enzymatic labeling of DNA strand breaks using TUNEL (terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling) (Boehringer Mannheim), according to the manufacturer’s instructions. CD45/TUNEL dual staining was performed to allow apoptotic tumor-infiltrating immunocytes to be identified and enumerated. CD45 staining was performed first on esophageal tumor sections, as described. Following treatment with proteinase K (20 µg/ml in 10 mM Tris-Cl, pH 7.6) for 30 min, sections were washed in PBS and endogenous peroxidase activity was blocked in 3% hydrogen peroxide in methanol for 30 min. Next, the slides were washed. This and all subsequent washes were in PBS. The sections were treated with permeabilization solution (0.1% Triton X-100 in 0.1% sodium citrate) for 15 min. After washing, the labeling reaction was performed using a solution containing terminal deoxynucleotidyl transferase, its buffer, and fluorescein-dUTP. During this step, slides were coverslipped and incubated at 37°C for 60 min in a humidity chamber. Terminal deoxynucleotidyl transferase was omitted from negative control slides, which were included in each run. To localize cells containing labeled DNA strand breaks, sections were washed and incubated with a sheep anti-fluorescein Ab Fab fragment conjugated with horseradish peroxidase at 37°C in a humidity chamber for 30 min. Following washing, TUNEL-positive color development (brown) was obtained by incubating the sections with a diaminobenzidine substrate solution for 15 min. When viewed under light microscopy, CD45 single-positive cells stained blue, while CD45/TUNEL dual-positive cells appeared with brown nuclear staining and blue cytoplasmic/cell surface staining.
Cell counting and labeling indices
To quantify CD45-positive TIL infiltration of FasL-positive vs FasL-negative tumor regions, stained tumor sections were analyzed under light microscopy, as follows. FasL-positive and FasL-negative areas were located on a FasL-stained esophageal tumor section by one investigator. Tumor areas staining with high intensity similar to or greater than that of nearby FasL-positive lymphoid cells were regarded as strongly positive. Tumor areas staining with weak intensity close to the background staining observed in the corresponding peptide control slide were regarded as negligible/negative. A reference slide was used to assure consistent selection of FasL strongly positive or negligible/negative tumor areas. Areas of tumor ulceration were excluded. A consecutive, CD45-stained slide from the same tumor was superimposed on the FasL-stained slide. Using histologic landmarks, the corresponding FasL-positive and FasL-negative areas were located on this slide. The FasL-stained section was removed, and a second investigator, blinded as to the local status of FasL expression, counted the number of CD45-positive TIL per 2000 total nuclei in the area located by the first investigator. A similar approach was used to enumerate CD45/TUNEL dual-positive TIL within FasL-positive vs FasL-negative areas of esophageal tumors. For each type of staining, all slides were stained in a single experiment.
Labeling indices for TIL infiltration were expressed as the percentage of CD45-positive cells per 2000 total nuclei counted. Labeling indices for TIL apoptosis were expressed as the percentage of CD45/TUNEL dual-positive cells per 500 total CD45-positive cells counted.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Using a FasL-specific rabbit polyclonal IgG, FasL-positive
immunohistochemical staining was detected in all esophageal tumors
(squamous, n = 6; adenocarcinoma, n =
2) (Fig. 1
). FasL-binding specificity was
confirmed since staining was inhibited by inclusion of the immunizing
peptide as a competitive inhibitor before primary Ab incubation. The
staining within the tumors varied from strongly positive to
negligible/negative. Although FasL-positive and FasL-negative areas
usually occurred within the same tumor, in all specimens at least 70%
(range 70–100%, n = 8) of the tumor tissue stained
strongly positive. FasL expression was confirmed by detection of FasL
mRNA in consecutive tumor sections using in situ hybridization. FasL
mRNA detection corresponded closely with immunohistochemical staining
for FasL protein (Fig. 1). Hybridization was specific, as a 10-fold
excess of unlabeled riboprobe competitively inhibited hybridization of
labeled riboprobe in control sections.
|
Reduced TIL infiltration of FasL-expressing esophageal tumor islands
All eight esophageal tumors showed infiltrates of cells staining
immunohistochemically positive for CD45 (leukocyte common Ag), which
were almost exclusively of lymphoid morphology, permitting
identification of TIL (Fig. 2). Tonsil
sections included as positive controls stained strongly, and omission
of the primary Ab abolished staining (data not shown). FasL expression
in the eye (10) and testis (11) has been shown to preclude infiltration
of these organs by proinflammatory, Fas-sensitive leukocytes, thereby
maintaining a state of immune privilege at these locations. To evaluate
whether FasL expression by esophageal tumor cells limited immune
effector cell infiltration of the tumor, TIL numbers infiltrating
FasL-positive vs FasL-negative tumor areas were enumerated and compared
(Table I).
|
|
). FasL expression by the tumors
was associated with a statistically significant, mean fourfold
reduction in TIL (range 1.6- to 12-fold, n = 6,
p < 0.05; Wilcoxon Signed Ranks) when compared with
FasL-negative areas within the same tumors. Thus, the expression of
FasL by esophageal cancer cells appears to have a dramatic inhibitory
effect on TIL infiltration of the tumor. Increased cell death of TIL associated with FasL expression by esophageal cancers
FasL expressed in the eye (10) and testis (11) causes apoptosis of
infiltrating Fas-sensitive immune effector cells, precluding
proinflammatory immune responses and thus maintaining immune privilege
in these organs. We wished to investigate whether the diminished TIL
infiltration observed in FasL-expressing esophageal tumor tissue was a
result of apoptotic depletion. CD45/TUNEL dual staining was used to
identify apoptotic TIL in the esophageal cancer sections (Fig. 2).
CD45-positive TIL were first stained immunohistochemically (blue),
followed by detection of DNA strand breaks on the same tumor section
using TUNEL (brown). Dual-stained, apoptotic TIL therefore appeared as
cells with brown TUNEL-positive, condensed, or fragmented nuclei
surrounded by blue cytoplasmic/cell surface CD45 staining. TIL in
immediate contact with tumor cells were examined, and the number that
was CD45/TUNEL dual positive was expressed as a percentage per 500
total CD45-positive TIL counted in the same area. Levels of apoptotic
TIL were quantified in FasL-positive vs FasL-negative areas of the same
tumor (Table II).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Although FasL expression has been reported in a number of human malignancies in vivo, including melanoma (17), hepatocellular carcinoma (18), lung cancer (19), astrocytoma (20), primary tumors (O’Connell et al., manuscript submitted), and liver metastases (21) of colon adenocarcinomas, there is a paucity of direct evidence to confirm that tumor-expressed FasL mediates apoptosis of TIL in vivo in human cancer.
In the present study, the effect of esophageal tumor expression of FasL on effective TIL infiltration was analyzed directly. Both the number of TIL and the level of apoptosis among TIL were quantified in FasL-expressing vs FasL-negative regions of tumors. While more than 70% of neoplastic tissue expressed FasL in all of the esophageal tumors, there were sufficient FasL-negative areas to permit significant comparison between FasL-positive and FasL-negative regions in close proximity within the same tumor. This paired analysis within individual tumors minimized the possible contribution of differences other than FasL expression to our results. Factors such as tumor immunogenicity, patient immune competence, tumor stage, and other factors were therefore relatively controlled. In addition, a recent study demonstrated that in esophageal carcinoma, the total number and activation of tumor-infiltrating T cells are independent of such factors as tumor stage and expression of molecules usually stimulatory to immune responses, including MHC or ICAM-1 (22).
A striking reduction (a mean fourfold) in CD45-positive TIL was observed in FasL-positive areas of tumor relative to FasL-negative regions. Of those CD45-positive TIL that resided within FasL-positive tumor islands, the frequency of cell death detected in situ by TUNEL was a mean twofold greater than that of CD45-positive cells within FasL-negative tumor zones. The cell death rate of TIL detected in FasL-negative tumor areas was only marginally greater than that of extratumoral, stromal leukocytes. These findings suggest that FasL expressed by esophageal tumor cells in vivo causes enhanced apoptosis of leukocytes that infiltrate the tumor, resulting in significant depletion of TIL. The clinical consequence of TIL depletion is suggested by a recent study of colorectal carcinoma, in which lower levels of TIL were associated with poorer prognosis (23). It will be interesting to determine whether the dysfunctional, bystander TIL frequently observed in tumors (24) have a defective Fas pathway, rendering them resistant to FasL-mediated apoptosis.
These results are consistent with the substantial body of evidence that supports a role for FasL in mediating immune privilege in the eye (10), in contributing to immunologic tolerance in the periphery (7), in downsizing immune responses (8, 9), and in supporting allograft survival (12, 13, 14, 15). All of these roles involve FasL-mediated apoptotic depletion of leukocytes. A recent study involving allograft transplantation of murine tumor cells stably transfected with the FasL gene showed that FasL caused local suppression of both humoral and cellular allograft-specific immune responses (15). The latter role is contradicted by the finding that in certain cases, murine allografts genetically manipulated to express FasL caused neutrophil infiltration and allograft destruction (25, 26, 27). It is unclear why FasL appeared to have such contradictory effects in these particular experimental settings (28). Recently, adenovirus-mediated overexpression of FasL in mouse ankle joints ameliorated collagen-induced arthritis, providing powerful evidence for an antiinflammatory role for FasL in vivo (29). No significant neutrophil infiltration was observed in any of the esophageal tumors examined, and our findings implicate FasL as a mediator of immune privilege in the context of spontaneous human cancers.
In all of the esophageal carcinomas, coexpression of FasL and FasR occurred throughout large areas of the tumor, without apparent enhancement of tumor cell apoptotic rate. This is similar to colon cancer cells (16) and lymphoid malignancies (30), which also coexpress FasL and FasR without apoptotic tumor cell suicide/fratracide. Hence, the esophageal tumor cells appear to be relatively resistant not only to FasL expressed by the tumor itself, but to FasL expressed as a cytotoxic mediator by antitumor immune effector cells, such as CTL or NK cells. Fas resistance may therefore contribute to immune evasion, augmenting the effectiveness of the FasL counterattack. Intracellular Fas signal-transduction defects reported in diverse cancers are many and varied (reviewed in 6 , and may be heterogenous in any cancer type. High Bcl-2 expression has been reported in esophageal carcinomas (31), which may contribute to Fas resistance in a proportion of these tumors.
In conclusion, we have demonstrated a statistically significant, quantitative reduction of TIL concomitant with significantly increased TIL apoptosis within FasL-expressing areas of esophageal tumors in vivo. Our findings therefore suggest Fas-mediated apoptotic depletion of TIL in response to FasL expression by esophageal cancers. These results provide the first direct, quantitative evidence to support the Fas counterattack as a mechanism of immune privilege in vivo in human cancer. Fas resistance of the esophageal carcinomas may contribute to tumor immune evasion, protecting the tumor from FasL expressed by CTL and NK cells. Understanding the significance of the Fas counterattack as a mechanism of immune evasion in human cancer should facilitate more effective antitumor therapies. Fas sensitization of tumor cells or protection of TIL from FasL could represent promising targets for future therapeutic strategies.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 M.W.B. and J.O. contributed equally and share first authorship.
3 Address correspondence and reprint requests to Dr. Fergus Shanahan, Department of Medicine, Clinical Sciences Building, University Hospital, Cork, Ireland. E-mail address:
4 Abbreviations used in this paper: FasL, Fas ligand; FasR, Fas receptor; TIL, tumor-infiltrating lymphocyte; TUNEL, terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling.
Received for publication December 5, 1997. Accepted for publication February 5, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and granzyme B expression in mononuclear cell infiltrates in normal colon mucosa and colon carcinoma. Gut 40:113.This article has been cited by other articles:
|
|
 |
|
  T. Das, G. Sa, E. Paszkiewicz-Kozik, C. Hilston, L. Molto, P. Rayman, D. Kudo, K. Biswas, R. M. Bukowski, J. H. Finke, et al. Renal Cell Carcinoma Tumors Induce T Cell Apoptosis through Receptor-Dependent and Receptor-Independent Pathways J. Immunol., April 1, 2008; 180(7): 4687 - 4696. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Zhang, T. Sun, L. Xue, X. Han, B. Zhang, N. Lu, Y. Shi, W. Tan, Y. Zhou, D. Zhao, et al. Functional polymorphisms in FAS and FASL contribute to increased apoptosis of tumor infiltration lymphocytes and risk of breast cancer Carcinogenesis, May 1, 2007; 28(5): 1067 - 1073. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Jewett, C. Head, and N.A. Cacalano Emerging Mechanisms of Immunosuppression in Oral Cancers Journal of Dental Research, December 1, 2006; 85(12): 1061 - 1073. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. B. Frey and N. Monu Effector-phase tolerance: another mechanism of how cancer escapes antitumor immune response J. Leukoc. Biol., April 1, 2006; 79(4): 652 - 662. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K W Chan, P Y Lee, A K Y Lam, S Law, J Wong, and G Srivastava Clinical relevance of Fas expression in oesophageal squamous cell carcinoma J. Clin. Pathol., January 1, 2006; 59(1): 101 - 104. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. E. Ryan, F. Shanahan, J. O'Connell, and A. M. Houston Addressing the "Fas Counterattack" Controversy: Blocking Fas Ligand Expression Suppresses Tumor Immune Evasion of Colon Cancer In vivo Cancer Res., November 1, 2005; 65(21): 9817 - 9823. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Sun, Y. Zhou, H. Li, X. Han, Y. Shi, L. Wang, X. Miao, W. Tan, D. Zhao, X. Zhang, et al. FASL -844C polymorphism is associated with increased activation-induced T cell death and risk of cervical cancer J. Exp. Med., October 3, 2005; 202(7): 967 - 974. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X Zhang, X Miao, T Sun, W Tan, S Qu, P Xiong, Y Zhou, and D Lin Functional polymorphisms in cell death pathway genes FAS and FASL contribute to risk of lung cancer J. Med. Genet., June 1, 2005; 42(6): 479 - 484. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. W. Wolkersdorfer, C. Marx, J. Brown, S. Schroder, M. Fussel, E. P. Rieber, E. Kuhlisch, G. Ehninger, and S. R. Bornstein Prevalence of HLA-DRB1 Genotype and Altered Fas/Fas Ligand Expression in Adrenocortical Carcinoma J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1768 - 1774. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Bohana-Kashtan and C. I. Civin Profiling Tumor Counterattack: Do Fas Ligand-Containing Microvesicles Reduce Anticancer Immunity? Clin. Cancer Res., February 1, 2005; 11(3): 968 - 970. [Full Text] [PDF]
|
|
|
|
|
|
F. Donskov, H. von der Maase, N. Marcussen, S. Hamilton-Dutoit, H. H. T. Madsen, J. J. Jensen, and M. Hokland Fas Ligand Expression in Metastatic Renal Cell Carcinoma During Interleukin-2 Based Immunotherapy: No In vivo Effect of Fas Ligand Tumor Counterattack Clin. Cancer Res., December 1, 2004; 10(23): 7911 - 7916. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Hallermalm, A. De Geer, R. Kiessling, V. Levitsky, and J. Levitskaya Autocrine Secretion of Fas Ligand Shields Tumor Cells from Fas-Mediated Killing by Cytotoxic Lymphocytes Cancer Res., September 15, 2004; 64(18): 6775 - 6782. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Konishi, K. Yamazaki, M. Azuma, I. Kinoshita, H. Dosaka-Akita, and M. Nishimura B7-H1 Expression on Non-Small Cell Lung Cancer Cells and Its Relationship with Tumor-Infiltrating Lymphocytes and Their PD-1 Expression Clin. Cancer Res., August 1, 2004; 10(15): 5094 - 5100. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Sun, X. Miao, X. Zhang, W. Tan, P. Xiong, and D. Lin Polymorphisms of Death Pathway Genes FAS and FASL in Esophageal Squamous-Cell Carcinoma J Natl Cancer Inst, July 7, 2004; 96(13): 1030 - 1036. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. B. Longley, W. L. Allen, U. McDermott, T. R. Wilson, T. Latif, J. Boyer, M. Lynch, and P. G. Johnston The Roles of Thymidylate Synthase and p53 in Regulating Fas-Mediated Apoptosis in Response to Antimetabolites Clin. Cancer Res., May 15, 2004; 10(10): 3562 - 3571. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Schneider-Stock, C. Mawrin, C. Motsch, C. Boltze, B. Peters, R. Hartig, P. Buhtz, A. Giers, A. Rohrbeck, B. Freigang, et al. Retention of the Arginine Allele in Codon 72 of the p53 Gene Correlates with Poor Apoptosis in Head and Neck Cancer Am. J. Pathol., April 1, 2004; 164(4): 1233 - 1241. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. E. Reichert, L. Strauss, E. M. Wagner, W. Gooding, and T. L. Whiteside Signaling Abnormalities, Apoptosis, and Reduced Proliferation of Circulating and Tumor-infiltrating Lymphocytes in Patients with Oral Carcinoma Clin. Cancer Res., October 1, 2002; 8(10): 3137 - 3145. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. H. Igney and P. H. Krammer Immune escape of tumors: apoptosis resistance and tumor counterattack J. Leukoc. Biol., June 1, 2002; 71(6): 907 - 920. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Andreola, L. Rivoltini, C. Castelli, V. Huber, P. Perego, P. Deho, P. Squarcina, P. Accornero, F. Lozupone, L. Lugini, et al. Induction of Lymphocyte Apoptosis by Tumor Cell Secretion of FasL-bearing Microvesicles J. Exp. Med., May 20, 2002; 195(10): 1303 - 1316. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Jodo, S. Xiao, A. Hohlbaum, D. Strehlow, A. Marshak-Rothstein, and S.-T. Ju Apoptosis-inducing Membrane Vesicles. A NOVEL AGENT WITH UNIQUE PROPERTIES J. Biol. Chem., October 19, 2001; 276(43): 39938 - 39944. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Ni, P. Hazarika, C. Zhang, R. Talpur, and M. Duvic Fas Ligand Expression by Neoplastic T Lymphocytes Mediates Elimination of CD8+ Cytotoxic T Lymphocytes in Mycosis Fungoides: A Potential Mechanism of Tumor Immune Escape? Clin. Cancer Res., September 1, 2001; 7(9): 2682 - 2692. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Chen and C. S. Yang Esophageal adenocarcinoma: a review and perspectives on the mechanism of carcinogenesis and chemoprevention Carcinogenesis, August 1, 2001; 22(8): 1119 - 1129. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Zagury, A. Burny, and R. C. Gallo Toward a new generation of vaccines: The anti-cytokine therapeutic vaccines PNAS, July 3, 2001; 98(14): 8024 - 8029. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Radoja, M. Saio, and A. B. Frey CD8+ Tumor-Infiltrating Lymphocytes Are Primed for Fas-Mediated Activation-Induced Cell Death But Are Not Apoptotic In Situ J. Immunol., May 15, 2001; 166(10): 6074 - 6083. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. K. Behrens, F. H. Igney, B. Arnold, P. Moller, and P. H. Krammer CD95 Ligand-Expressing Tumors Are Rejected in Anti-Tumor TCR Transgenic Perforin Knockout Mice J. Immunol., March 1, 2001; 166(5): 3240 - 3247. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. R. Gastman, X.-M. Yin, D. E. Johnson, E. Wieckowski, G.-Q. Wang, S. C. Watkins, and H. Rabinowich Tumor-induced Apoptosis of T Cells: Amplification by a Mitochondrial Cascade Cancer Res., December 1, 2000; 60(24): 6811 - 6817. [Abstract] [Full Text]
|
|
|
|
|
|
M. Shibakita, M. Tachibana, D. K. Dhar, S. Ohno, H. Kubota, H. Yoshimura, S. Kinugasa, R. Masunaga, and N. Nagasue Spontaneous Apoptosis in Advanced Esophageal Carcinoma: Its Relation to Fas Expression Clin. Cancer Res., December 1, 2000; 6(12): 4755 - 4759. [Abstract] [Full Text]
|
|
|
|
|
|
J. C. Reed Mechanisms of Apoptosis Am. J. Pathol., November 1, 2000; 157(5): 1415 - 1430. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. M. Yakes, B. D. Wamil, F. Sun, H.-P. Yan, C. E. Carter, and C. G. Hellerqvist CM101 Treatment Overrides Tumor-induced Immunoprivilege Leading to Apoptosis Cancer Res., October 1, 2000; 60(20): 5740 - 5746. [Abstract] [Full Text]
|
|
|
|
|
|
K. Okada, K. Komuta, S. Hashimoto, S. Matsuzaki, T. Kanematsu, and T. Koji Frequency of Apoptosis of Tumor-infiltrating Lymphocytes Induced by Fas Counterattack in Human Colorectal Carcinoma and Its Correlation with Prognosis Clin. Cancer Res., September 1, 2000; 6(9): 3560 - 3564. [Abstract] [Full Text]
|
|
|
|
|
|
T. S. Griffith, R. D. Anderson, B. L. Davidson, R. D. Williams, and T. L. Ratliff Adenoviral-Mediated Transfer of the TNF-Related Apoptosis-Inducing Ligand/Apo-2 Ligand Gene Induces Tumor Cell Apoptosis J. Immunol., September 1, 2000; 165(5): 2886 - 2894. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I TINHOFER, H WYKYPIEL, I MARSCHITZ, T HENN, R GREIL;, M W BENNETT, J O'CONNELL, D ROCHE, C BRADY, J KELLY, et al. Gastric cancer cell lines lack Fas ligand (FasL) expression but kill T cells via a FasL independent pathway • Reply Gut, May 1, 2000; 46(5): 738 - 740. [Full Text] [PDF]
|
|
|
|
|
|
A.-K. Eerola, Y. Soini, and P. Paakko A High Number of Tumor-infiltrating Lymphocytes Are Associated with a Small Tumor Size, Low Tumor Stage, and a Favorable Prognosis in Operated Small Cell Lung Carcinoma Clin. Cancer Res., May 1, 2000; 6(5): 1875 - 1881. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Hohlbaum, S. Moe, and A. Marshak-Rothstein Opposing Effects of Transmembrane and Soluble FAS Ligand Expression on Inflammation and Tumor Cell Survival J. Exp. Med., April 3, 2000; 191(7): 1209 - 1220. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. R. Gastman, D. E. Johnson, T. L. Whiteside, and H. Rabinowich Tumor-induced apoptosis of T lymphocytes: elucidation of intracellular apoptotic events Blood, March 15, 2000; 95(6): 2015 - 2023. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Reimer, C. Herrnring, D. Koczan, D. Richter, B. Gerber, D. Kabelitz, K. Friese, and H.-J. Thiesen FasL:Fas Ratio-A Prognostic Factor in Breast Carcinomas Cancer Res., February 1, 2000; 60(4): 822 - 828. [Abstract] [Full Text]
|
|
|
|
|
|
B. R. Gastman, Y. Atarashi, T. E. Reichert, T. Saito, L. Balkir, H. Rabinowich, and T. L. Whiteside Fas Ligand Is Expressed on Human Squamous Cell Carcinomas of the Head and Neck, and It Promotes Apoptosis of T Lymphocytes Cancer Res., October 1, 1999; 59(20): 5356 - 5364. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. M. Bukowski, P. Rayman, L. Molto, C. S. Tannenbaum, T. Olencki, D. Peereboom, R. Tubbs, D. McLain, G. T. Budd, T. Griffin, et al. Interferon-{{gamma}} and CXC Chemokine Induction by Interleukin 12 in Renal Cell Carcinoma Clin. Cancer Res., October 1, 1999; 5(10): 2780 - 2789. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. C. Reed Dysregulation of Apoptosis in Cancer J. Clin. Oncol., September 1, 1999; 17(9): 2941 - 2941. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Shibakita, M. Tachibana, D. K. Dhar, T. Kotoh, S. Kinugasa, H. Kubota, R. Masunaga, and N. Nagasue Prognostic Significance of Fas and Fas Ligand Expressions in Human Esophageal Cancer Clin. Cancer Res., September 1, 1999; 5(9): 2464 - 2469. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. O'Connell, M. W. Bennett, G. C. O'Sullivan, J. O'Callaghan, J. K. Collins, and F. Shanahan Expression of Fas (CD95/APO-1) Ligand by Human Breast Cancers: Significance for Tumor Immune Privilege Clin. Vaccine Immunol., July 1, 1999; 6(4): 457 - 463. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. D. Pettersen, K. Hestdal, M. K. Olafsen, S. O. Lie, and F. P. Lindberg CD47 Signals T Cell Death J. Immunol., June 15, 1999; 162(12): 7031 - 7040. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Shimizu, A. Fontana, Y. Takeda, H. Yagita, T. Yoshimoto, and A. Matsuzawa Induction of Antitumor Immunity with Fas/APO-1 Ligand (CD95L)-Transfected Neuroblastoma Neuro-2a Cells J. Immunol., June 15, 1999; 162(12): 7350 - 7357. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Saito, I. Kuss, G. Dworacki, W. Gooding, J. T. Johnson, and T. L. Whiteside Spontaneous ex Vivo Apoptosis of Peripheral Blood Mononuclear Cells in Patients with Head and Neck Cancer Clin. Cancer Res., June 1, 1999; 5(6): 1263 - 1273. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. G. Uzzo, P. Rayman, V. Kolenko, P. E. Clark, T. Bloom, A. M. Ward, L. Molto, C. Tannenbaum, L. J. Worford, R. Bukowski, et al. Mechanisms of Apoptosis in T Cells from Patients with Renal Cell Carcinoma Clin. Cancer Res., May 1, 1999; 5(5): 1219 - 1229. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Yu, K. Israel, Q. Y. Liao, C. M. Aldaz, B. G. Sanders, and K. Kline Vitamin E Succinate (VES) Induces Fas Sensitivity in Human Breast Cancer Cells: Role for Mr 43,000 Fas in VES-triggered Apoptosis Cancer Res., February 1, 1999; 59(4): 953 - 961. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M W Bennett, J O'Connell, G C O'Sullivan, D Roche, C Brady, J Kelly, J K Collins, and F Shanahan Expression of Fas ligand by human gastric adenocarcinomas: a potential mechanism of immune escape in stomach cancer Gut, February 1, 1999; 44(2): 156 - 162. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
