|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


Departments of
*
Immunology and
Neurology, Mayo Clinic, Rochester, MN 55905
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In genetically resistant mice, several lines of evidence indicate that MHC class I-restricted CD8+ T cells are important contributors to the process of viral clearance. The ability to clear virus maps to the H-2D class I locus, implicating a role for CD8+ T cells (1, 2). Consistent with this finding, H-2D transgenes from resistant mouse strains confer resistance to susceptible mouse strains (6, 7). The depletion of CD8+ T cells early in the course of viral infection results in increased viral replication within the gray matter of the CNS and increased encephalitis (5). In addition, ß2-microglobulin (ß2m)-deficient mice, which have an otherwise resistant genotype but lack functional class I-restricted immunity, develop viral persistence and demyelinated lesions following virus infection (8, 9, 10). At 7 days after the infection of resistant animals, CD8+ CTLs specific for the viral protein (VP)1 and VP2 virus capsid Ags can be isolated from the brain, suggesting that CTL activity may be responsible for clearance (11, 12). However, the mechanism by which CD8+ T cells clear virus has not been established. In the present study, the mechanisms of cytotoxicity are evaluated in vivo using mice that are genetically deficient in components of the T cell-killing pathways.
In susceptible B10 H-2 congenic mice, the virus infection is cleared from the gray matter but persists indefinitely in the white matter of the spinal cord. No antiviral CTLs can be found within the CNS throughout the infection period (3). However, activated CTLs are present within the lesions. These CTLs can be detected using an Ag nonspecific target cell that expresses anti-CD3 Abs on its surface. The TCRs of activated cytotoxic cells are bound by the anti-CD3 Abs on the target cells, initiating the killing pathway. The Ag specificity of the CTLs within the virus-induced lesions is not known. Their origin and specificity may be critical factors in the subsequent chronic demyelinating disease that follows the establishment of a persistent infection. The role of these cytotoxic cells in demyelination is indicated by studies in which CD8+ T cells are depleted from susceptible mice with systemic Ab treatments at the time of persistent virus infection. Anti-CD8-treated SJL mice that were infected with the Daniel strain of TMEV (DAV) developed fewer demyelinated lesions than animals treated with anti-CD4 or irrelevant Abs (13). This observation is consistent with the hypothesis that the CTLs in the brain and spinal cord of infected susceptible animals recognize non-TMEV Ags in the infected CNS and contribute to demyelination. In the present study, genetically defined mice were used to determine which T cell populations and Ag-presenting molecules are involved in the generation of the CTL populations invoked by TMEV infection in the CNS of susceptible animals.
| Materials and Methods |
|---|
|
|
|---|
We purchased 4- to 8-wk-old female C57BL/6J mice
(H-2b) (B6), C57BL/10J (H-2b) (B10), B10.Q
(H-2q), PL/J (H-2u), DBA/1J Q
(H-2q), SJL/J (H-2s), B10.S (H-2s),
B6.MRL-lpr (H-2b) (B6-lpr) with a mutation in Fas,
B6.C3H-gld (H-2b) (B6-gld) with a mutation in Fas ligand
(FasL), C57BL/6J-Ifgtm1 (H-2b) (B6-Ifg)
deficient in IFN-
, and C57BL/6-Pfp (H-2b) (B6-Pfp) with
a mutation in perforin) from The Jackson Laboratory (Bar Harbor, ME).
Male and female B6 CD4-/- (H-2b), B6
CD8-/- (H-2b), PL/J CD4-/-
(H-2u), PL/J CD8-/- (H-2u), SJL/J
CD4-/- (H-2s), and SJL/J CD8-/-
(H-2s) were obtained from Dr. T. Mak (Department of
Immunology, The Ontario Cancer Institute, University of Toronto,
Toronto, Canada). B10.K (H-2k),
(C57BL/6x129)F3 ß2m-/-
(H-2b) (B6x129), and DBA/1
ß2m-/- (H-2q) mice that were
deficient in class I were bred in our mouse colony or obtained from the
Mayo Clinic Immunogenetic Mouse Colony (Rochester, MN).
Cells
The fibroblast cell lines C57SV (Kb, Db); C57SV/LP expressing the TMEV capsid proteins leader peptide, VP4, VP2, and VP3 (12); L-2 (Kk, Dk); P815 (Kd, Dd); SQSV (Kq, Dq); KSSV (Ks, Ds); Jurkat (a human lymphoma cell line); and 1452C11 (an anti-CD3 hybridoma cell line) were cultured in RPMI 1640 (BioWhittaker, Walkersville, MD) with 5% FCS (Life Technologies, Grand Island, NY). SQSV and KSSV cells expressing H-2 class I were used as targets for the cytotoxicity assay to demonstrate H-2-restricted DAV-, myelin basic protein (MBP)-, or proteolipid protein (PLP)-specific cytotoxicity. 1452C11 cells were used to detect nonspecific T cell-mediated cytotoxicity. CV-1, HeLa, BS-C-1, and HuTK- cells were cultured in DMEM (BioWhittaker) with 10% FCS and used to prepare vaccinia viruses (VVs) (14).
Theilers murine encephalomyelitis virus
DAV was used in all experiments (15). DAV stock was diluted to 2 x 107 plaque-forming units (PFU)/ml, and 10 µl of virus (2 x 105 PFU) was injected into the right cerebral hemisphere of test mice.
Preparation of recombinant VVs containing murine MBP (18.5 kDa) and PLP (31 kDa)
RNA isolated from the CNS of a B10 mouse with a Rapid Total RNA Isolation Kit (5 Prime3 Prime, Boulder, CO) was used as a template for a reverse transcription reaction with a First Strand cDNA Synthesis Kit (Pharmacia Biotech, Piscataway, NJ). The murine MBP and PLP cDNA were amplified from the reverse transcription product by RT-PCR using the following primers, VMBP-1, GATCGATCGATCGATGTCGACCACCATGGCATCACAGAAGAGACC; VMBP-2, GTCAGTCGCGGCCGCGGTACCTATCAGAACTTGGTGCCT; VPLP-1, GATCGATCGATCGATGTCGACCACCATGGGCTTGTTAGAGTGTTGT; and VPLP-2, GTCAGTCGCGGCCGCGGTACCTATCAGAACTTGGTGCCTCGG. The resulting PCR products were digested with SalI and KpnI, ligated into SalI/KpnI-digested pSC11 (14), and sequenced to verify the cDNA sequences of MBP and PLP. Recombinant VVs containing MBP and PLP were generated, plaque-purified, and amplified using standard methods (14). Briefly, the recombinant plasmids were transfected into the wild-type VV-infected CV-1 cells; the cells were collected after a 2-day culture, sonicated, and used to infect HuTK- cells for screening. The viral plaques formed by infection with recombinant viruses were selected by 5-bromodeoxyuridine (50 µg/ml) and X-gal (0.033%). After two rounds of plaque-purification, the recombinant VVs were amplified in HeLa cells to prepare virus stocks in HBSS (Life Technologies) with 0.1% BSA (Sigma, St. Louis, MO). VV stocks were titrated on monolayers of BS-C-1 cells that were growing in 24-well plates using published methodology (14). These resulting recombinant viruses were designated as VMBP or VPLP.
Antibodies
mAbs specific to murine Fas, H-2Ks, Ds, Kq, and Dq were obtained from PharMingen (San Diego, CA). FITC-labeled anti-mouse Lyt-2 and streptavidin (SA)-phycoerythrin-labeled anti-mouse L3T4 were obtained from Becton Dickinson (San Jose, CA). mAb RL172 (anti-CD4) and mAb 3.168 (anti-CD8) were provided by P. Wettstein (Department of Immunology, Mayo Clinic, Rochester, MN). mAb NK1.1 that was specific for NK cells was provided by P. Leibson (Department of Immunology, Mayo Clinic). Rabbit anti-human MBP was obtained from DAKO (Carpinteria, CA). Rat anti-human PLP was obtained from Agmed (Bedford, MA). Biotinylated goat anti-rabbit IgG and biotinylated rabbit anti-rat IgG were obtained from Vector Laboratories (Burlingame, CA). Alkaline phosphatase-conjugated SA and fluorescein (FITC)-conjugated affinipure F(ab')2 fragment goat anti-mouse IgG were obtained from The Jackson Laboratory.
Fluorescence-activated cell sorter
FACS was performed as described previously (12) to detect class I expression on the surface of SQSV and KSSV target cells, the presence of CD4+ T cells and CD8+ T cells in the CNS-infiltrating lymphocytes (ILs), and the efficiency of in vitro depletion of CD4+ T cells and CD8+ T cells with the corresponding Abs listed above. The results showed that SQSV and KSSV cells expressed suitable H-2 class I on their surface (data not shown). More than 96% of CD4+ or CD8+ T cells were depleted from the CNS-ILs following treatment with mAb RL172, which was specific to CD4, or mAb 3.168, which was specific to CD8, with rabbit complete complement (Pel-Freez Clinical Systems, Brown Deer, WI).
Western blot
The expression of murine MBP or PLP by recombinant vaccinia-infected cells was verified by Western blot. Monolayers of BS-C-1 cells were infected with recombinant VMBP or VPLP at 10 PFU/cell at 37°C in 5% CO2 for 4 h, collected, dissolved in 2x sample loading buffer (0.125 M Tris (pH 6.8), 20% glycerol, 10% 2-ME, 4.6% SDS), boiled at 100°C for 5 min, and loaded onto 10% SDS-PAGE. The gel was run at 200 V for 1.5 h and transferred to a nitrocellulose filter (Pharmacia Biotech) overnight at 30 V. The nitrocellulose filter was incubated with either rabbit anti-human MBP Ab or rat anti-human PLP Ab, respectively, at room temperature for 4 h, washed, and then incubated with secondary biotinylated goat anti-rabbit IgG or biotinylated rabbit anti-rat IgG at room temperature for 2 h, respectively. The filters were subsequently washed and incubated with alkaline phosphatase-conjugated SA for 1 h. Developing was completed by adding substrate solution (0.1 M Tris (pH 9.5), 0.1 M NaCl, 5 mM MgCl2, 0.033% nitroblue tetrazolium salt and 0.0165% 5bromo-4-chloro-3-indoyl phosphate p-toluidine salt) at room temperature for 30 min. The results demonstrated that the recombinant VMBP- or VPLP-infected cells expressed MBP (18.5 kDa) or PLP (31 kDa) (data not shown).
CNS-ILs from DAV-infected mice
At 7 or 45 days postinjection (d.p.i.), the brains and spinal cords were removed from 10 mice and pooled by strain. These time points were chosen because both resistant and susceptible strains of mice show maximal infiltration of inflammatory cells in the CNS from acute encephalitis at 7 days, whereas, resistant mice have cleared infection and susceptible mice have persistent virus infection and CNS inflammation at 45 days. CNS-ILs were isolated as described previously by a Percoll gradient (3, 12) and were resuspended to 2 x 106/ml in RPMI 1640 with 5% FCS. Twofold serial dilutions were made to provide CNS-ILs to target ratios of 100:1 to 6.25:1.
Preparation of target cells
DAV- or recombinant vaccinia-infected and uninfected cells, 1452C11 cells, and Jurkat cells served as targets for the cytotoxicity assay. Recombinant vaccinia-infected cells were prepared by infection with recombinant vaccinia at 10 PFU/cell and were labeled with 200 µCi of sodium chromate (51Cr; Amersham, Arlington Heights, IL) at 37°C for 3 h. DAV-infected targets were prepared by infection with DAV at 10 PFU/cell at 1 day before assay (3, 12). On the day of assay, 106 target cells were labeled with 200 µCi of sodium chromate at 37°C for 1 h. After labeling and infection, cells were washed three times with RPMI 1640, resuspended to 2 x 104/ml in RPMI 1640 with 5% FCS, and added to 96-well, U-bottom plates at 100 µl/well.
Cytotoxicity assay
The cytotoxicity assay was performed and calculated as described previously (3, 12). Syngeneic target cells were used when possible. Because H-2u-expressing target cells were not available, we used the TMEV-infected or vaccinia-infected P815 (H-2d) cells as targets in the experiments testing for H-2u-restricted, virus-specific CTLs generated from PL/J-derived mice. The use of P815 cells is appropriate, because H-2u is a natural recombinant which shares the Dd and Ld Ag-presenting molecules with P815. The H-2u haplotype was originally typed as positive for the H-2.4 serologic specificity. This result was interpreted as indicating that the u haplotype is a natural recombinant which included the H-2Dd gene. Additional evidence that this is in fact the case comes from a variety of studies. Nine mAbs (four of which are specific for Ld and five of which are specific for Dd) all react strongly with H-2u-expressing spleen cells (our unpublished observations) (16). This finding indicates that H-2u shares the duplicated D-region gene structure with H-2d and expresses two molecules that are indistinguishable from Dd and Ld based on 10 serologically defined epitopes. A complementation skin graft analysis using recombinants (B10.RUB1 and B10.RUB2, both Ku/Db in genotype, from the mouse colony of Dr. C. David, personal communication) demonstrated that hybrid mice comprised of (recombinant x H-2d)F1 mice accept skin grafts from H-2u mice. This is clear evidence that the D region class I Ag-presenting molecules encoded by H-2u are identical with those found in H-2d from the perspective of T cells. Finally, previous investigations have shown that H-2u-restricted T cells recognize viral Ags presented by P815 cells (17). Therefore, it is logical to expect the H-2D and L molecules of P815 to present appropriate peptide Ags to PL/J T cells if these T cells are in fact present.
In vitro depletion of NK cells, CD4+ T cells, or CD8+ T cells from CNS-ILs
The depletion of NK cells, CD4+ T cells, and CD8+ T cells from CNS-ILs was performed as described previously with mAb NK1.1, mAb 3.168 (anti-CD8), or mAb RL172 (anti-CD4) (12). The efficiencies of depletion were determined by FACS as described above.
| Results |
|---|
|
|
|---|
Previous data showed that class I-restricted DAV-specific
cytotoxicity is present in the CNS-ILs from 7-day-infected resistant
B10 (Kb, Db) mice but not in the CNS-ILs
from 7-day-infected susceptible B10.Q (Kq, Dq)
or B10.S (Ks, Ds) mice (Fig. 1
) (3). Similarly, susceptible SJL/J,
DBA/1J, and PL/J mice did not generate D-restricted,
virus-specific CTLs. As no H-2u target cell lines were
available, the P815 cell line, which shows Ld and
Dd MHC Ag-presenting molecules with the H-2u
haplotype of PL/J, was used as a target (17). To determine whether T
cell-mediated cytotoxicity against an Ag other than virus is present in
the CNS of susceptible mice, we chose to use 1452C11 cells, an
anti-CD3 hybridoma cell line, as targets for cytotoxicity assay.
Activated cytotoxic cells expressing CD3 bind anti-CD3 Abs on the
1452C11 cell surface and lyse 1452C11 cells. CNS-ILs isolated from
either resistant B10 (H-2b) and B10.K (H-2k)
mice or from susceptible B10.Q, B10.S, SJL/J (H-2s), and
PL/J (H-2u) mice at 7 d.p.i. and from B10.Q and B10.S
at 45 d.p.i. induced significant lysis of 1452C11 cells. In
contrast, normal splenic CD3+ T cells (present in the
spleen at the same ratio to non-T mononuclear cells as found in the
CNS-ILs) (4) do not lyse 1452C11 target cells, indicating that
activated cells are necessary for cytotoxicity against these cells
(Fig. 2
). An assessment of cytotoxicity
by CNS-ILs in resistant mice at 45 d.p.i. was not possible, as
virus is cleared from these mice, and inflammatory cells are not
present in the CNS. We conclude that TMEV infection induces activated
cytotoxic T cells in the CNS of both resistant and susceptible C57BL
congenic mice; the T cells in resistant mice are specific for TMEV
viral Ags, while the cytotoxic T cells in susceptible mice are
not.
|
|
To determine the mechanism of T cell-mediated cytotoxicity in the
CNS of TMEV-infected mice, we intracerebrally injected B6, B6-Pfp that
is deficient in perforin, B6-lpr that is deficient in Fas, B6-gld that
is deficient in FasL, and B6-Ifg mice that is deficient in IFN-
. At
7 d.p.i., CNS-ILs from these mice served as effectors against
1452C11 cells, uninfected C57SV cells, and transfected C57SV/LP cells
expressing TMEV proteins as targets. In a 5-h assay, CNS-ILs from B6,
B6-Ifg, B6-lpr, and B6-gld mice lysed 1452C11 (Fig. 3
A) and C57SV/LP cells
(Fig. 3
B) but not uninfected C57SV cells. In
contrast, no killing of virus targets or 1452C11 cells was observed in
B6-Pfp mice (Fig. 3
, A and B). Therefore,
nonspecific T cell-mediated cytotoxicity and class I-restricted
TMEV-specific cytotoxicity is mediated by perforin; Fas/FasL
interactions or IFN-
are not required for killing in the standard
5-h cytotoxicity assay.
|
Some T cells and NK cells kill target cells using FasL, which
induces apoptosis of Fas+ cells. To determine whether
CNS-ILs can kill target cells via the Fas pathway, CNS-ILs from B6-Pfp,
B6-lpr, and B6-gld mice at 7 d.p.i. served as effectors against
1452C11 cells and Fas+ Jurkat cells for a standard 5-h
cytotoxicity assay and a longer 10-h assay that was compatible with
Fas/FasL-mediated killing. CNS-ILs from B6-Pfp did not lyse 1452C11
cells but did lyse Jurkat cells in both the 5-h and 10-h assay (Fig. 4
). In contrast, CNS-ILs from B6-lpr and
B6-gld mice lysed both Jurkat cells and 1452C cells. Therefore, the
lysis of Jurkat is mediated by either the perforin or Fas pathways.
|
CD8+ T cells are predominantly responsible for T cell-mediated cytotoxicity in the CNS of resistant and susceptible mice following intracerebral TMEV inoculation
Intracerebral inoculation of DAV induced virus-specific cytotoxicity in the CNS of resistant B10 mice that was mediated by CD8+ T cells but not by CD4+ T cells or NK cells (12, 18). Class II-restricted, DAV-specific cytotoxicity was not demonstrated in the CNS of B10 or B6x129 ß2m-/- mice (H-2b) (12), although both CD4+ and CD8+ T cell populations have the potential for cytotoxic activity (12, 18, 19, 20, 21). 1452C11 target cells were used to determine the T cell subsets responsible for cytotoxicity irrespective of Ag specificity. Abs directed against CD4 (mAb RL172), CD8 (3.168), and NK cells (NK1.1) were used in vitro with rabbit serum complement to deplete CNS-ILs isolated from DAV-infected B6, B10.Q, B10.S, or DBA/1 mice.
At 7 d.p.i., cytotoxic activity was reduced significantly by the depletion of B6 CNS-ILs with anti-CD8 Ab (1.8 ± 1.8%) or anti-CD8 and anti-CD4 Abs together (0 ± 2%) as compared with untreated CNS-ILs (17.8 ± 4.2%, p < 0.05), but the partial depletion observed with anti-CD4 treatment (11.6 ± 2.0%) at an E:T ratio of 50:1 did not reach a statistically significant level. T cell-mediated cytotoxicity against 1452C11 cells was inhibited by depletion with anti-CD8 Ab treatment from CNS-ILs that were isolated from susceptible B10.S mice (12 ± 2.2%, p < 0.05) at 7 d.p.i. as compared with untreated CNS-ILs (23 ± 2.9%) at an E:T ratio of 100:1 but was not inhibited by depletion with anti-CD4 Ab (29.9 ± 2.9%) or anti-NK Ab (31.2 ± 1.4%). Depletion of CNS-ILs isolated from 7 day-infected susceptible B10.Q mice with either anti-CD4 or anti-CD8 Ab appeared to inhibit cytotoxicity against 1452C11 cells (14.6 ± 0.5% and 14.9 ± 2.0%, respectively) as compared with untreated CNS-ILs (31.9 ± 7.5%) at an E:T ratio of 80:1, although none of these comparisons were statistically different. A second H-2q mouse line, DBA/1, was evaluated to determine whether CD4+ cells from this haplotype consistently display cytotoxicity in this assay. CNS-ILs lysed 19.9% ± 0.7 of the 1452C11 targets at an E:T ratio of 100:1. Depletion with anti-CD4 Abs and complement did not result in a significant reduction (76% of the lytic activity of the cells treated with complement alone), while depletion of the cells with anti-CD8 and complement resulted in a significant decrease (39% of the group treated with complement alone, p < 0.05). The depletion of CNS-ILs with both anti-CD8 and anti-CD4 in combination with complement was even more effective, reducing cytotoxicity to 13% of control levels (p < 0.05). Therefore, the nonspecific T cell-mediated cytotoxicity to 1452C11 cells generated in CNS-ILs from both resistant or susceptible mice following intracerebral TMEV inoculation is mediated primarily by CD8+ T cells, although CD4+ T cells may participate in this process in some mouse lines.
Class I is required for the generation of T cell-mediated cytotoxicity in the CNS
ß2m-/- mice reportedly have
TCR-
+ CD8+ T cells, a normal repertoire
of CD4+ T cells, and a greatly reduced population of
TCR-
ß+ CD8+ T cells (22, 23). To determine
the role of class I in the generation of T cell-mediated cytotoxicity
in the CNS, we injected TMEV intracerebrally into B6x129
ß2m-/- mice (resistant H-2b
genotype) and DBA/1 ß2m-/- mice
(susceptible H-2q genotype) and isolated CNS-ILs at 7
d.p.i. (Fig. 5
). CNS-ILs from B6x129
ß2m-/- mice did not lyse uninfected C57SV
(1.2 ± 1.3%), C57SV/LP (0 ± 1.9%), or 1452C11 cells
(5 ± 1.4%) at an E:T ratio of 100:1. Similarly, CNS-ILs from
DBA/1 ß2m-/- mice did not lyse uninfected
SQSV (0 ± 2.3%), DAV-infected SQSV (3.9 ± 5.6%), and
1452C11 cells (4.3 ± 0.7%). Therefore, the generation of both
DAV-specific and nonspecific T cell-mediated cytotoxicity in the CNS of
intracerebrally infected mice is class I-dependent. This class I MHC
dependency was observed in both mice of resistant and susceptible
genotype. This finding is consistent with the view that the nonviral
specific CTL population is derived primarily from CD8+ T
cells.
|
To further determine the roles of CD4+ or
CD8+ T cells in the generation of T cell-mediated
cytotoxicity, CNS-ILs isolated from CD4 and CD8 knockout mice were
investigated. CNS-ILs were isolated 7 days after intracerebral
infection with DAV either from B6, B6 CD4-/-, and B6
CD8-/- mice with a resistant H-2b genotype;
from PL/J, PL/J CD4-/-, and PL/J CD8-/-
mice with a susceptible H-2u genotype; or from SJL/J, SJL/J
CD4-/-, and SJL/J CD8-/- mice with a
susceptible H-2s genotype. Decreased T cell-mediated
cytotoxicity against 1452C11 cells was demonstrated in the CNS-ILs from
two strains of CD8-/- mice of either resistant or
susceptible genotype as compared with infected control mice (Fig. 6
, A and C).
Of interest, little cytotoxicity against 1452C11 cells was observed in
CNS-ILs from all three strains of CD4-/- mice of either
resistant or susceptible haplotype (Fig. 6
, AC). No
class I-restricted, DAV-specific cytotoxicity was demonstrated in
CD4-/- or CD8-/- mice of either resistant
or susceptible genotype (Fig. 6
, AC). These results
indicate that CD4+ T cells play a central role in the
development of CD8-associated, T cell-mediated cytotoxicity in the CNS
of TMEV-infected mice. The finding that a decreased but appreciable
amount of virus nonspecific CTLs can be generated in the absence of CD8
is more difficult to interpret. Whether this remaining cytotoxicity is
associated with a residual population of class I-restricted T cells
that develop along the CD8 pathway in the absence of the CD8 coligand,
or whether another cytolytic cell population such as class II
restricted, virus-specific CD4+ cells are contributing to
this response is not known.
|
The presence of activated CTLs of nonviral yet unknown specificity in the CNS raises the possibility that these cells may contribute to demyelination by means of the autoimmune destruction of myelin. Murine MBP and PLP are targets of the class II-restricted CD4+ T cells that mediate experimental autoimmune encephalomyelitis (24), another important animal model of demyelination. To assess whether MBP and PLP are the targets of the class I-restricted cytotoxicity in the CNS-ILs isolated from early (7 d.p.i.) or chronically (45 d.p.i.) DAV-infected susceptible B10.Q (H-2q), B10.S (H-2s), and SJL/J (H-2s) mice, we prepared recombinant vaccinia constructs that would express MBP and PLP in SQSV (Kq, Dq) and KSSV (Ks, Ds) target cells in a T cell-mediated cytotoxicity assay. The expression of MBP or PLP in VMBP- or VPLP-infected target cells was demonstrated by Western blot using anti-MBP or anti-PLP Abs (data not shown). Recombinant VMBP or VPLP could induce Ag-specific Ab production and delayed-type hypersensitivity (DTH) reactions in B10.Q mice. B10.Q mice that were inoculated i.p. twice (14 days apart) with 2 x 106 PFU of recombinant VMBP or VPLP showed a high titer of MBP-specific Ab and PLP-specific Ab (data not shown). The DTH response to the two myelin Ags was detected by inoculating purified myelin into the ears of mice 2 wk after the second vaccination with recombinant virus. Ear thickness increased by 51.5 ± 0.5 µm in VMBP-infected B10.Q mice and by 70.5 ± 15.5 µm in VPLP-infected B10.Q mice. In contrast, ear thickness did not change in B10.Q mice inoculated with either HBSS (Gibco BRL) buffer (0 mm) or recombinant VKb (0 mm). Therefore, we concluded that these VVs were effective in driving the expression of MBP and PLP in target cells and in generating Ab and DTH responses in vivo.
Cells infected with the recombinant VVs were used to test whether MBP
and PLP could serve as targets for the activated cytotoxic T cells
isolated from the DAV-infected CNS of susceptible mice. CNS-ILs
isolated from acutely (Fig. 7
A) or chronically
infected (Fig. 7
B) B10.Q, B10.S, or SJL/J mice did
not lyse uninfected, DAV-infected, VMBP-infected, or VPLP-infected SQSV
(Kq, Dq) or KSSV (Ks,
Ds) cells. We conclude that DAV, MBP, and PLP are not the
targets of the class I-restricted cytotoxicity in the CNS-ILs of
susceptible mice with demyelination.
|
| Discussion |
|---|
|
|
|---|
Of particular interest is the observation that even though susceptible B10.Q and B10.S mice did not develop class I-restricted DAV-specific CTLs in the CNS, the ILs did display significant T cell-mediated cytotoxicity as measured using an Ag-independent target, both during the acute infection phase and the chronic demyelination phase of the disease. This cytotoxicity also appears to be mediated predominantly by CD8+ T cells, although CD4+ T cells appear to be essential in the development of this response. During the demyelinating phase of the disease, CD4+ T cells are observed predominantly in perivascular regions, while CD8+ T cells are observed infiltrating the parenchyma of inflammatory lesions (4). The distribution of the CD8+ cells is consistent with their suspected role in the pathogenesis of demyelination. In line with this hypothesis, depletion of CD8+ T cells with mAbs during late disease of susceptible SJL/J strain of mice infected with DAV decreased the number and severity of demyelinated lesions (13). Therefore, the presence of these CD8+ cytotoxic T cells appears to be a central factor in the demyelination of susceptible mice infected with DAV. The nature of the Ags recognized by these cells, if any, remains to be determined.
The stimulus for generating CTLs in mice that are unable to mount a specific CTL response to viral Ags is not known. Recent studies have documented the recruitment and TCR-independent activation of nonspecific CTLs at the site of virus infection (25, 26). Cytokine release in response to an ongoing infection has been implicated. One significant difference between the virus systems investigated earlier and the present model is that DAV establishes a persistent infection. Consequently, cytokine stimulation of nonspecifically recruited T cells could continue over an extended period of time. Although the consequences of the nonspecific activation of T cells in a virus infection are controversial (26), the fact that persistent virus infections have not been evaluated in this context leaves this as an open question. One possibility is that chronic stimulation permits cytotoxic T cells to develop at the site of infection in the CNS against brain-specific Ags. Another intriguing possibility is that TCR-independent stimulation over a prolonged period results in cytokine release that directly or indirectly damages oligodendrocytes and myelin.
We tested whether two known autoantigens (MBP and PLP) implicated in MS pathogenesis were the targets of cytotoxicity in the CNS of mice susceptible to TMEV-induced demyelination. MBP and PLP are the main proteins of myelin. Peptides from human myelin (MBP110118) and (PLP8088) have been demonstrated to be targets of HLA-A2-restricted CD8+ CTLs isolated from MS patients and some healthy persons (27). Recently, class II responses against PLP have been demonstrated after the onset of significant demyelination in the Theilers model (28). MBP and PLP have also been reported to be targets of class II-restricted immunity in experimental autoimmune encephalomyelitis (23). Class II-restricted autoimmune responses against MBP and PLP have been demonstrated following TMEV infection (29), but it is unknown whether these are critical for demyelination. To test whether MBP and PLP were the targets of the CD8+ CTLs in TMEV infection, we generated recombinant VVs expressing murine MBP and PLP in the infected cells as targets for the cytotoxicity assay. We could not detect class I-restricted CD8+ T cell-mediated cytotoxicity against murine MBP and PLP in the CNS of susceptible B10.Q, B10.S, and SJL/J mice during acute and chronic TMEV infection. While it is still possible that other myelin Ags are the focus of an autoimmune response, these findings also are consistent with the view that the CD8+ CTLs in the CNS of susceptible mice influence the demyelinating process in an AgR-independent manner.
Minimal CD8+ T cell cytotoxicity was observed in the CNS of CD4-/- mice that had been intracerebrally infected with TMEV, indicating the critical importance of CD4+ T cells in the generation of CD8+ CTLs. The requirement of CD4+ T cells for the generation of CD8+ CTLs appears to depend upon the source of Ags. Studies performed with a mAb to selectively deplete CD4+ T cells in vivo demonstrated impaired class I-restricted CTL responses to vaccinia, lymphocytic choriomeningitis virus (LCMV), and poxvirus (30, 31, 32). CD4+ T cells were required for the successful induction of a primary CD8+ CTL response against herpes simplex virus (33) and against minor H Ags (34). Tumor rejection in ß2m-/- mice by CD8+ CTLs is dependent upon CD4+ T cell activity, because in vivo depletion of CD4+ T cells by the introduction of anti-CD4 mAb abrogated their antitumor response and resulted in death of animals (35). CD4+ T cells are also essential to sustain the CD8+ T cell response that eventually leads to the elimination of chronic LCMV infection (36). However, in other studies, CD4+ T cells were not essential for the generation of antiviral CTL responses to ectromelia virus and vaccinia (37, 38), herpes simplex virus type 1 (39), LCMV (36, 38, 40), influenza A virus (41), and murine CMV (42). Our studies indicate that in the TMEV model system, CD4+ T cells are required for the generation of optimal CD8+ T cell cytotoxicity.
Finally, we demonstrated that class I-mediated, DAV-specific
cytotoxicity and nonspecific cytotoxicity from T cells isolated
directly from the CNS is mediated by perforin but not by FasL or
IFN-
in a 5-h assay. However, some FasL-mediated cytotoxicity was
demonstrated in the CNS-ILs of TMEV-infected mice but not in the spleen
of uninfected mice, indicating that activated cells are required for
cytotoxicity. Therefore, our studies indicate that T cells from the CNS
can lyse their targets by perforin-dependent granule exocytosis and by
inducing apoptosis that is mediated by Fas/FasL interaction. Of
interest, CNS-ILs isolated from TMEV-infected B6-Pfp, B6-lpr, and
B6-gld mice lysed human lymphoma cell lines, indicating the presence of
a non-MHC-restricted, Ag nonspecific target cell-killing mechanism in
CNS-ILs that is mediated by perforin and FasL. This mechanism may play
a role in immune regulation or "bystander" immunopathology to
mediate demyelination.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Moses Rodriguez, Mayo Clinic/Foundation, 200 First Street SW, Rochester, MN 55905. E-mail address: ![]()
3 Abbreviations used in this paper: TMEV, Theilers murine encephalomyelitis virus; CNS, central nervous system; IL, infiltrating lymphocyte; MS, multiple sclerosis; ß2m, ß2-microglobulin; DAV, Daniel strain of Theilers murine encephalomyelitis virus; MBP, myelin basic protein; PLP, proteolipid protein; VV, vaccinia virus; PFU, plaque-forming units; VP, viral protein; FasL, Fas ligand; SA, streptavidin; d.p.i., days postinfection; LCMV, lymphocytic choriomeningitis virus; DTH, delayed-type hypersensitivity. ![]()
Received for publication October 22, 1997. Accepted for publication January 30, 1998.
| References |
|---|
|
|
|---|
production in the absence of CD8+ T lymphocytes in virus-infected ß2-microglobulin-deficient mice. Cell. Immunol. 173:261.[Medline]
This article has been cited by other articles:
![]() |
M. Rodriguez, L. Zoecklein, J. G. Kerkvliet, K. D. Pavelko, L. Papke, C. L. Howe, L. R. Pease, and C. David Human HLA-DR Transgenes Protect Mice from Fatal Virus-Induced Encephalomyelitis and Chronic Demyelination J. Virol., April 1, 2008; 82(7): 3369 - 3380. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Ure, T. E. Lane, M. T. Liu, and M. Rodriguez Neutralization of chemokines RANTES and MIG increases virus antigen expression and spinal cord pathology during Theiler's virus infection Int. Immunol., May 1, 2005; 17(5): 569 - 579. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rodriguez, L. J. Zoecklein, C. L. Howe, K. D. Pavelko, J. D. Gamez, S. Nakane, and L. M. Papke Gamma Interferon Is Critical for Neuronal Viral Clearance and Protection in a Susceptible Mouse Strain following Early Intracranial Theiler's Murine Encephalomyelitis Virus Infection J. Virol., November 15, 2003; 77(22): 12252 - 12265. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Tsunoda, L.-Q. Kuang, and R. S. Fujinami Induction of Autoreactive CD8+ Cytotoxic T Cells during Theiler's Murine Encephalomyelitis Virus Infection: Implications for Autoimmunity J. Virol., November 13, 2002; 76(24): 12834 - 12844. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-S. Kang, M. A. Lyman, and B. S. Kim The Majority of Infiltrating CD8+ T Cells in the Central Nervous System of Susceptible SJL/J Mice Infected with Theiler's Virus Are Virus Specific and Fully Functional J. Virol., June 5, 2002; 76(13): 6577 - 6585. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Redwine, M. J. Buchmeier, and C. F. Evans In Vivo Expression of Major Histocompatibility Complex Molecules on Oligodendrocytes and Neurons during Viral Infection Am. J. Pathol., October 1, 2001; 159(4): 1219 - 1224. [Abstract] [Full Text] |
||||
![]() |
M. Trottier, P. Kallio, W. Wang, and H. L. Lipton High Numbers of Viral RNA Copies in the Central Nervous System of Mice during Persistent Infection with Theiler's Virus J. Virol., August 15, 2001; 75(16): 7420 - 7428. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. D. Murray, D. B. McGavern, S. Sathornsumetee, and M. Rodriguez Spontaneous remyelination following extensive demyelination is associated with improved neurological function in a viral model of multiple sclerosis Brain, July 1, 2001; 124(7): 1403 - 1416. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Wu, Y. Sun, J. Wang, X. Lin, Y. Wang, L. E. Pegg, A. Futterer, K. Pfeffer, and Y.-X. Fu Signal Via Lymphotoxin-{{beta}}R on Bone Marrow Stromal Cells Is Required for an Early Checkpoint of NK Cell Development J. Immunol., February 1, 2001; 166(3): 1684 - 1689. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Drescher, P. D. Murray, X. Lin, J. A. Carlino, and M. Rodriguez TGF-{beta}2 Reduces Demyelination, Virus Antigen Expression, and Macrophage Recruitment in a Viral Model of Multiple Sclerosis J. Immunol., March 15, 2000; 164(6): 3207 - 3213. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Bergmann, J. D. Altman, D. Hinton, and S. A. Stohlman Inverted Immunodominance and Impaired Cytolytic Function of CD8+ T Cells During Viral Persistence in the Central Nervous System J. Immunol., September 15, 1999; 163(6): 3379 - 3387. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Perrin, V. Schnuriger, A.-L. Quiquerez, P. Saas, C. Pannetier, N. de Tribolet, J.-M. Tiercy, J.-P. Aubry, P.-Y. Dietrich, and P. R. Walker Astrocytoma infiltrating lymphocytes include major T cell clonal expansions confined to the CD8 subset Int. Immunol., August 1, 1999; 11(8): 1337 - 1350. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Johnson, M. K. Njenga, M. J. Hansen, S. T. Kuhns, L. Chen, M. Rodriguez, and L. R. Pease Prevalent Class I-Restricted T-Cell Response to the Theiler's Virus Epitope Db:VP2121-130 in the Absence of Endogenous CD4 Help, Tumor Necrosis Factor Alpha, Gamma Interferon, Perforin, or Costimulation through CD28 J. Virol., May 1, 1999; 73(5): 3702 - 3708. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |