| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
ICOS Corporation, Bothell, WA 98021
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
4ß7,
Lß2, and Vß3,
in the same cellular context, we expressed an IL-8 receptor (IL-8RA)
and FMLP receptor (FPR) in the lymphoid cell line JY. Chemoattractants
induced a rapid increase in Lß2- and
Vß3-dependent JY adhesion within 5 min,
and it was sustained for 30 min. In contrast, stimulation of
4ß7-dependent adhesion was transient,
returning to basal levels by 30 min. The activation profiles of the
integrins were similar regardless of whether IL-8 or FMLP was used for
induction. We also demonstrate that
4ß7-dependent adhesion was uniquely
responsive to the F actin-disrupting agent cytochalasin D and the
protein kinase C (PKC) inhibitor chelerythrin. While
Vß3- and
Lß2-mediated cell adhesion was
significantly reduced by cytochalasin D,
4ß7-mediated adhesion was enhanced.
Chelerythrin inhibited both the IL-8 and PMA activation of
Lß2 and Vß3.
In contrast, inducible 4ß7 activity was
unaffected, and basal activity was increased. These findings
demonstrate that the mechanism of 4ß7
regulation by chemoattractants is different from that of
Lß2 and Vß3
and that it appears to involve distinct cytoskeletal and PKC
dependencies. In addition, PKC activity may be a positive or negative
regulator of integrin-dependent adhesion. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
4ß1 and
4ß7 can mediate primary adhesion (1, 5).
During secondary adhesion, leukocytes adhere firmly to the endothelium
and undergo a change in cell shape. Binding of leukocyte
ß2 (CD18) and 4 integrins to endothelial
cell ICAMs and VCAM-1 can mediate secondary adhesion (1, 3).
Firm adhesion of leukocytes to the endothelium is dependent on
signaling that leads to integrin activation, which is manifested in
increased avidity for ligands. Leukocyte integrins can be activated via
different receptor types. For example, engagement of T cell surface
molecules such as TCR and L-selectin has been shown to activate binding
of the leukointegrin Lß2 (CD11a/CD18,
LFA-1) to ICAM-1 (6, 7). In addition, soluble mediators such as
chemoattractants including chemokines have been reported to induce
increased integrin-dependent leukocyte adhesion. Classical
chemoattractants such as FMLP and C5a have been shown to activate CD18
integrins on eosinophils (8). Among the different chemokines, IL-8 can
activate integrins on neutrophils and regulate transendothelial
migration of neutrophils (9).
Chemoattractants activate integrins subsequent to binding their
heterotrimeric G protein-coupled receptors. However, little is known of
the exact downstream signaling pathway or the effects of these inducers
on individual integrins. Emerging evidence suggest that protein kinase
C (PKC2) and phosphatidyl
inositol-3 kinase contribute to the signals leading to integrin
activation (10). Work by Campbell et al. (11) and Weber et al. (8)
suggests a complex effect by chemoattractants on integrin activation
and chemotaxis. The T cell line Jurkat, expressing the receptors for
IL-8, MIP-1, C5a, or FMLP, showed a strong but transient activation
of 4ß1-dependent adhesion in the presence
of a high concentration of the appropriate agonist (11). However,
suppression of chemotaxis was observed at higher than optimum agonist
concentrations, indicating distinct regulation of adhesion and
chemotaxis. Stimulation of human eosinophils with RANTES, MCP-3, or C5a
produced a rapid and transient activation of
4ß1 but prolonged activation of
Mß2 (8). These results suggest a
differential regulation of the ß1 and ß2
integrins.
Here, we report different signaling and cytoskeletal requirements for
chemoattractant-stimulated activation of three integrins in the
background of one cell type. We have generated lymphoid cell lines to
address the mechanism of integrin activation subsequent to stimulation
by agonists of G protein-coupled receptors. Thus, we have studied IL-8-
and FMLP-mediated activation of 4ß7,
vß3, and Lß2
in a B lymphoid cell line, JY, expressing IL-8 or FMLP receptors. Our
results demonstrate a distinct regulation of
4ß7 integrin activity relative to that of
Lß2 and vß3
integrins.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The FLAG epitope-specific mAb M1 was from Eastman Kodak
(Rochester, NY). Cells producing the L mAb, TS1/22,
were from American Type Culture Collection (ATCC), Rockville, MD, and
the ß1 mAb, 3S3, was a gift from Dr. John Wilkins,
University of Manitoba (Winnipeg, Canada). The ß2 mAb,
22F12C, and the 4 mAb, 72A1H, were generated at ICOS.
Fib 504.64, a rat anti-mouse ß7 mAb (12) that also
binds to human ß7, was obtained from ATCC. All of the Abs
were purified according to standard procedures.
Generation of human lymphoid cell lines expressing IL-8 or FMLP receptor
The human IL-8RA (IL-8 receptor subtype A) (13) sequence was amplified from genomic DNA. The FMLP receptor (FPR) cDNA was a gift from Dr. Richard Ye (The Scripps Research Institute, La Jolla, CA). HindIII and XbaI restriction endonuclease sites were added by PCR to the 5' and 3' ends of the IL-8RA and the FPR cDNA clones. For IL-8RA, the following oligonucleotide primers were used: 5' (HindIII), 5'ATGCAAGCTTTCAAAT ATTACAGATCCA 3'; and 3' (XbaI), 5'ATGCTCTAGATTTTCAGAGGTTGGAAGAG AC 3'. Sequences of the oligonucleotide primers used for the FPR cDNA are: 5' (HindIII), 5'ATGCAAGCTTGAGACAAATTCCTCTCTC 3'; and 3' (XbaI), 5'ATGCTCTAG ATCACTTTGCCTGTAACGCCAC 3'. The PCR-amplified products were verified by DNA sequencing. The mammalian expression vector, pcDNA3 (Invitrogen, San Diego, CA) was modified by inserting the bovine prolactin signal sequence and the FLAG epitope (Eastman Kodak) 3 prime to the CMV promoter. The HindIII-XbaI site-adapted cDNAs were then ligated to the corresponding sites of the pcDNA3-FLAG expression vector. In the resulting construct, the IL-8RA and FPR cDNAs were in-frame to the prolactin signal sequence and the FLAG epitope.
The FLAG-tagged receptors were expressed in the human B lymphoblastoid cell line, JY, obtained from ATCC. For each electorporation, 1 x 107 cells were centrifuged, washed in ice-cold PBS, and resuspended in 0.5 ml of PBS. Thirty micrograms of the expression construct DNA was added to the cell suspension and incubated on ice for 10 min. Electroporation was done at 250 V, 960 µFd capacitance, using a Bio-Rad (Hercules, CA) electroporator. After incubating the electroporated cells on ice for 10 min, they were transferred to the growth medium for 24 h. The transfected cells were then selected using G418 at 1 mg/ml in medium. Expression of the receptors on the surface of the transfected cells was monitored using the anti-FLAG Ab, M1 (Eastman Kodak). About 10% of the G418-resistant cells expressed the FLAG epitope. The cell population was stained with the M1 Ab and sorted for high levels of receptor-expressing cells. After two rounds of sorting, 95% of the cells expressed the FLAG epitope. Functional expression of the receptors was confirmed by cell adhesion and chemotactic assays in the presence of IL-8 and FMLP (see below). These cells were designated JY-8 and JY-fp.
Adhesion assay
Adhesion assays were performed in 96-well Easy Wash plates
(Corning Glass, Corning, NY) using a modified procedure (14). Each well
was coated with 50 µl of ICAM-1/Fc (10 µg/ml), VCAM-1/Fc (5
µg/ml), or vitronectin (0.5 µg/ml) in 50 mM bicarbonate buffer (pH
9.6). Some wells were coated with a ß2 mAb (22F12C,
ICOS), to quantitate the maximum number of input cells binding, (taken
as 100%) or glycophorin, to determine background binding. Plates were
blocked with 1% BSA in PBS for 1 h at room temperature. Wells
were then rinsed and 200 µl of adhesion buffer (RPMI + 0.2%
human serum albumin) was added with or without PMA (20 ng/ml), IL-8, or
FMLP. Cells (100 µl of 1 x 106/ml) were then added
to each well, and plates were incubated at 37°C in 5%
CO2 for the indicated time. Cells were allowed to settle on
the plate for 25 min, and then PMA (20 ng/ml) or IL-8 or FMLP was
added. In some assays, cells were mixed with cytochalasin D and added
to the wells such that the final concentration of cytochalasin D was 10
µg/ml. For chelerythrin treatment, cells were preincubated with the
inhibitor at 37°C for 10 min and then added to wells. Adherent cells
were fixed with the addition of 50 µl of a 10% glutaraldehyde
solution and stained with 0.5% crystal violet (Sigma, St. Louis, MO)
solution. The plates were washed in several changes of water. After
washing, 70% ethanol was added, and adherent cells were quantitated by
determining absorbance at 570 nm using a SPECTRAmax 250 microplate
spectrophotometer system (Molecular Devices, Sunnyvale, CA). Percentage
of cell binding was determined using the formula:
 |
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
For a detailed analysis of integrin activation by
chemoattractants, we have established cell lines stably expressing
either of two chemoattractant receptors. The formyl peptide receptor,
FPR, is representative of the classical chemoattractant receptor, and
the other, IL-8RA (CCR1), is a member of the chemokine (CXC)
receptor family. Based on their pertussis toxin sensitivity, it is
believed that both of these receptors transduce a signal through the Gi
class of G proteins (15, 16). These receptors were tagged with the FLAG
epitope at their N termini and were expressed in the human B lymphoid
cell line JY. JY cells express the integrins
Lß2,
vß3, and 4ß7
(Fig. 1
), all of which may be stimulated
by PMA (data not shown). The untransfected cells did not respond to the
chemoattractants, as there was no increased
Lß2-, Vß3-,
or 4ß7-dependent binding observed in the
presence of either FMLP or IL-8 (data not presented). After
transfection and G418 selection, cells were sorted using a mAb that
binds to the FLAG epitope. Following two rounds of sorting, cell lines
expressing high levels of FPR (JY-fp) and IL-8RA (JY-8) were
established (Fig. 1). Cell surface expression of both the IL-8 and FMLP
receptors remained stable for months without subsequent G418
selection.
|
We tested JY-8 and JY-fp for their ability to activate integrins
upon treatment with IL-8 or FMLP. Of the four known
ß2 (CD18) integrins, JY cells express only
Lß2, which binds to ICAM-1. As shown in
Figure 2, IL-8 stimulated JY-8 adhesion
to ICAM-1 in a concentration-dependent manner. The maximum response was
observed at about 60 ng/ml of IL-8 (Fig. 2A). This
concentration of IL-8 also resulted in maximal stimulation of
4ß7- and
Vß3-dependent adhesion (data now shown).
At this concentration, there was a two- to threefold increase in
Lß2-mediated adhesion to ICAM-1. This
response was similar in magnitude to PMA-stimulated JY-8 adhesion to
ICAM-1 (Fig. 2A). Adhesion of JY-8 to ICAM-1 was
completely and specifically blocked by the L (CD11a) mAb
and the ß2 (CD18) mAb (data not shown). JY cells
transfected with the expression vector (JY-vector) did not demonstrate
IL-8-stimulated binding (Fig. 2A).
|
600 nM (Fig. 2
B). At
this concentration of FMLP, there was an approximately threefold
increase in binding of JY-fp to ICAM-1. FMLP did not stimulate adhesion
of JY-vector cells (Fig. 2B). Thus, JY-fp and JY-8
express functional chemoattractant receptors.
Activation profiles of Lß2,
vß3, and 4ß7
by IL-8 and FMLP
We determined and compared the magnitude and rate of
chemoattractant-mediated activation of three integrins expressed in
JY-8 and JY-fp. JY cells express the integrins
4ß7 and
Vß3 (Fig. 1), which bind to VCAM-1 and
vitronectin, respectively (17, 18). JY cells may express a very low
level of ß1 integrin (Fig. 1, second row, middle
panel), however, binding to VCAM-1 was blocked by
ß7-blocking mAb, and not by ß1-blocking mAb
(data not shown). Thus, we compared binding of the JY-8 and JY-fp cells
to ICAM-1, VCAM-1, and vitronectin as an indication of the activation
profile of Lß2,
4ß7, and Vß3.
In the absence of stimulation, there was a slight increase in JY-8 and
JY-fp binding to ICAM-1 within the first 5 min. Thereafter, this level
of binding did not change significantly for up to 30 min (Fig. 3, A and D).
In the presence of the appropriate agonists, however, both the JY-8 and
the JY-fp cells showed two- to threefold enhanced binding to ICAM-1
within 5 min. Thus, there is a rapid activation of
Lß2 induced by the binding of either
agonist to their corresponding receptors. The initial two- to threefold
increase in binding was sustained for at least 30 min.
|
Vß3 was similar
to that of Lß2 (Fig. 3, C and
F). There was a rapid increase in JY-8 and JY-fp cell
binding to vitronectin within 5 min of adding either IL-8 or FMLP, as
compared with the binding in the absence of either agonist. The maximum
level of induced binding in the presence of the agonists was two- to
threefold. Since the activation of vß3 was
sustained, the ratio of induced binding to uninduced binding did not
change significantly for as long as 30 min.
The activation profile of 4ß7 in JY-8 and
JY-fp differed from that of Lß2 and
Vß3. As shown in Figure 3B,
there was increased binding of the JY-8 cells to VCAM-1 within the
first 5 min after adding IL-8, indicating a rapid activation of
4ß7. Both the response time and fold
increase was similar to that of Lß2 and
Vß3. However, the induced
4ß7-mediated binding in response to IL-8
was not sustained. After the initial 5 min, a steady decrease in
binding was observed. By 30 min, the extent of cell adhesion to VCAM-1
in the presence of IL-8 was essentially the same as in the absence of
IL-8. This resulted in a decreased ratio of binding to VCAM-1 in the
presence of IL-8 vs in the absence of IL-8. The observed decrease in
the ratio between 5 and 30 min is in contrast to the profile of binding
to ICAM-1 and vitronectin, indicating a differential temporal
regulation of 4ß7.
Chemoattractant-stimulated binding of JY-fp cells to VCAM-1 was similar
to that of JY-8. As shown in Figure 3E, FMLP caused a rapid
increase in the JY-fp cell binding to VCAM-1 within 5 min. With longer
periods of incubation, the agonist-stimulated binding was not
sustained. Since both JY-8 and JY-fp demonstrated a transient induction
of binding to VCAM-1 relative to ICAM-1 and vitronectin, this suggests
a unique and integrin-proximal modulation of the
4ß7 activity.
Differential effect of cytochalasin D on activation of
Lß2-,
4ß7-, and
Vß3-mediated activation of cell adhesion
Cytochalasin D, which prevents actin polymerization (19),
blocks PMA-induced Lß2-mediated
aggregation of JY cells, suggesting a role for F actin in the
regulation of Lß2 activity (20). We tested
whether IL-8- or PMA-induced activation of integrins on JY-8 requires
an intact cytoskeleton. Because FMLP- and IL-8-stimulated responses
were identical, with perhaps both receptors interacting with the same
Gi, only IL-8 was used in these and subsequent assays. Cytochalasin
D treatment significantly reduced both IL-8- and PMA-induced cell
binding to ICAM-1 (Fig. 4A). A similar pattern
of cytochalasin D inhibition was observed for
Vß3-dependent adhesion to vitronectin
(Fig. 4C). In contrast to that of
Lß2 and Vß3,
4ß7-mediated JY-8 binding was markedly
enchanced in the presence of the same concentration of cytochalasin D
(Fig. 4B). A greater than threefold enhancement of
4ß7-mediated JY-8 cell binding to VCAM-1
was observed in the presence of cytochalasin D alone. IL-8 or PMA
further increased JY-8 cell adhesion to VCAM-1 in the presence of
cytochalasin D. Thus, 4ß7 differs from
Lß2 and Vß3
in its requirement of F actin.
|
Members of the PKC family of enzymes can stimulate
integrin-dependent adhesion, since the PKC agonist, PMA, stimulates
integrin activity. Calphostin C, a potent inhibitor of diacylglycerol
and Ca2+-dependent PKC isoforms (21), can block
PMA-induced 4ß1 and
Mß2 integrin activation (16). However,
calphostin C did not inhibit IL-8- or FMLP-stimulated
4ß1- and
Mß2-dependent adhesion (16).
We used chelerythrin (22), a catalytic domain antagonist of different
PKC isoforms, to determine whether different PKC family members are
involved in IL-8-mediated integrin activation in JY-8. Although
chelerythrin may have broad specificity, its IC50 for
different PKC isoforms can vary. Initially, we determined the effect of
a range of concentrations of chelerythrin on
Lß2-dependent JY-8 adhesion to ICAM-1
(Fig. 5). At concentrations <6 µM,
chelerythrin did not inhibit IL-8- or PMA-stimulated binding. At 6
µM, there was no inhibition of PMA-stimulated binding, although
IL-8-stimulated binding was blocked 50%, while at 12.5 µM or higher
concentrations, chelerythrin substantially blocked both IL-8- and
PMA-stimulated cell adhesion. These results suggest a role for PKC in
IL-8- mediated stimulation of
Lß2.
|
Lß2, 4ß7, and
Vß3 activity. Because at 12.5 µM
chelerythrin blocked both chemoattractant- and PMA-stimulated adhesion
of JY-8 to ICAM-1 (Fig. 5), it was used in additional experiments.
Chelerythrin was not used at higher concentrations at which additional
PKC isoforms or kinases might be inhibited. As seen in Figure 6, A and C, at this
concentration chelerythrin markedly inhibited both IL-8- and
PMA-stimulated Lß2 and
vß3 activity. In contrast, chelerythrin
did not inhibit IL-8-stimulated JY-8 adhesion and only marginally
inhibited PMA-stimulated adhesion (Fig. 6B) to VCAM-1
(Fig. 6B). Furthermore, chelerythrin treatment increased
basal level binding to VCAM-1 by approximately twofold and IL-8-induced
binding by about 20%. These results indicate that
4ß7 differs from
Lß2 and Vß3
in PKC dependency.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Lß2,
Vß3, and 4ß7,
in a common cellular context. These studies resulted in three key
observations. First, stimulation of JY transfectants with the
appropriate chemoattractant resulted in a rapid activation of all three
integrins. Second, although their initial activation profiles were
similar, a significant difference was observed in the temporal behavior
of the integrins. IL-8 or FMLP induced prolonged stimulation of
Lß2 and
Vß3-dependent adhesion, whereas under
similar conditions, 4ß7-dependent adhesion
was transient. After 5 min of IL-8 or FMLP stimulation,
4ß7-mediated cell adhesion to VCAM-1
begins to decline, and by 30 min it returns to the unstimulated level.
Third, the 4ß7 integrin differed from
Lß2 and Vß3
in its sensitivity to both cytochalasin D and chelerythrin treatment.
While Lß2- and
Vß3-dependent adhesion was significantly
reduced by cytochalasin D, 4ß7 function
was enhanced under identical conditions. Chelerythrin significantly
blocked Lß2 and
Vß3 activity, whereas, at the same
concentration, it enhanced 4ß7 activity.
These data demonstrate differential integrin regulation in JY
cells.
Different temporal regulation of integrin activity by
chemoattractants has been demonstrated in leukocytes isolated from
blood. In human eosinophils, 4ß1
activity was up-regulated in a transient manner, whereas
Mß2 activity demonstrated a prolonged
increase in the presence of several chemoattractants (8). In accordance
with these results, transient activation of
4ß1 in Jurkat cell transfectants
expressing the IL-8RA has been reported (11). A transient up-regulation
of the activity of 4ß7 in mouse pre-B cell
transfectants expressing ß7 and FPR has also been
reported (11). Our results with JY cells that express endogenous
4ß7 further extends this observation.
Collectively, these studies demonstrate that the 4
integrins 4ß1 and
4ß7 are transiently activated by several
chemokines/chemoattractants in a variety of cell types. Data presented
here provide evidence that two chemoattractants can stimulate prolonged
up-regulation of the activity of Lß2 and
Vß3 in the same cell that demonstrates
transient 4ß7 activity. Thus,
4ß7 may possess a different
integrin-proximal mechanism of regulation. To begin to determine the
mechanism for this difference, we addressed the role of F actin
involvement.
Our results with cytochalasin D demonstrate a requirement of intact
actin filaments in JY cells for both IL-8- and PMA-stimulated
Lß2 and
Vß3-dependent adhesion. Consistent with
this finding, cytochalasin B has been reported to abolish
PMA-stimulated, Lß2-mediated aggregation
of JY cells (20). At similar concentrations of cytochalasin D as that
used in our assays, Kucink et al. (23) also reported inhibition of
Lß2 activity, although at lower
concentrations cytochalasin D showed a stimulatory effect. Both our
data and others (20) suggest that an intact actin cytoskeleton is
essential for Lß2-mediated adhesion. In
addition, using CHO cells expressing a chimeric integrin,
IIbL/ß3ß2,
which contains the cytoplasmic tails of L and
ß2 chains, a similar inhibitory effect of cytochalasin on
adhesion to fibrinogen was observed, although it did not alter the high
affinity status of the integrin thus implying a requirement for an
Lß2 cytoplasmic tail-cytoskeleton
interaction for adhesion (24). These results contrasts with that of the
activity of another ß2 integrin,
Mß2 (Mac-1), in eosinophils.
Chemoattractant-stimulated increase in the adhesiveness of
Mß2 in eosinophils was unaffected by
cytochalasin treatment (8). Thus, even though both
Lß2 and Mß2
share a common ß-chain, they demonstrate distinct regulation. This
difference may therefore be a function of their -chains or of the
different cell types utilized. Integrins that share a common -chain,
4ß1 and 4ß7,
may also differ in their cytochalasin sensitivity. We demonstrated that
in JY cells 4ß7-dependent basal level
adhesion was enhanced by cytochalasin. In addition, IL-8- or
PMA-induced 4ß7-dependent adhesion was
further augmented by cytochalasin. However, in human eosinophils the
chemoattractant-stimulated increase in the activity of
4ß1 was inhibited by cytochalasins,
suggesting a requirement of an intact cytoskeleton (8). Thus, the
cytochalasin-sensitive or -insensitive nature of 4
integrins could be attributed to the ß-chains (ß1 vs
ß7) or to differences in the cell types used in the
binding studies.
In addition to F-actin, we also addressed the role of PKC in integrin
activation. Chelerythrin binds to the catalytic domain of PKC and is
thought to inhibit all PKC isoforms (22). IL-8 and PMA stimulate
translocation of PKC from the cytosol to the membrane in JY-8 (C.
Sadhu, K. Dick, and D. E. Staunton, unpublished observation). Our
data show that both PMA and IL-8 stimulation of
Lß2- and
Vß3-dependent adhesion are chelerythrin
sensitive, indicating a role for PKC in the signaling pathways employed
by both stimuli. However, under identical conditions chelerythrin had
an opposite effect on activation of 4ß7.
While chelerythrin inhibited Lß2 and
Vß3 activity, it enhanced the activity of
4ß7. This suggests that PKC may also
function as a negative regulator of
4ß7-dependent adhesion.
In summary, we have shown that in the same cellular context,
4ß7 regulation differs from
Lß2 and Vß3
in its 1) temporal pattern of activation, 2) requirement of an intact
cytoskeleton, and 3) sensitivity to PKC inhibition. These results
suggest the existence of integrin-specific steps in the pathways of
integrin regulation. The transient nature of
4ß7 adhesion and relative independence of
F actin structure may reflect the distinct function of
4ß7 in primary or rolling adhesion.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Abbreviations used in this paper: PKC, protein kinase C; FPR, FMLP receptor.
Received for publication October 30, 1997. Accepted for publication February 3, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  C. Sadhu, H. J. Ting, B. Lipsky, K. Hensley, L. F. Garcia-Martinez, S. I. Simon, and D. E. Staunton CD11c/CD18: novel ligands and a role in delayed-type hypersensitivity J. Leukoc. Biol., June 1, 2007; 81(6): 1395 - 1403. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. P. Abonia, K. F. Austen, B. J. Rollins, S. K. Joshi, R. A. Flavell, W. A. Kuziel, P. A. Koni, and M. F. Gurish Constitutive homing of mast cell progenitors to the intestine depends on autologous expression of the chemokine receptor CXCR2 Blood, June 1, 2005; 105(11): 4308 - 4313. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Butta, E. G. Arias-Salgado, C. Gonzalez-Manchon, M. Ferrer, S. Larrucea, M. S. Ayuso, and R. Parrilla Disruption of the {beta}3 663-687 disulfide bridge confers constitutive activity to {beta}3 integrins Blood, October 1, 2003; 102(7): 2491 - 2497. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Sadhu, B. Masinovsky, K. Dick, C. G. Sowell, and D. E. Staunton Essential Role of Phosphoinositide 3-Kinase {delta} in Neutrophil Directional Movement J. Immunol., March 1, 2003; 170(5): 2647 - 2654. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Maki, R. E. Morales, V. A. Carroll, W. G. Telford, R. N. Knibbs, L. M. Stoolman, and S. T. Hwang CCR6 Colocalizes with CD18 and Enhances Adhesion to Activated Endothelial Cells in CCR6-Transduced Jurkat T Cells J. Immunol., September 1, 2002; 169(5): 2346 - 2353. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Berger, S. Budhu, E. Lu, Y. Li, D. Loike, S. C. Silverstein, and J. D. Loike Different Gi-coupled chemoattractant receptors signal qualitatively different functions in human neutrophils J. Leukoc. Biol., May 1, 2002; 71(5): 798 - 806. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. R. Beals, A. C. Edwards, R. J. Gottschalk, T. W. Kuijpers, and D. E. Staunton CD18 Activation Epitopes Induced by Leukocyte Activation J. Immunol., December 1, 2001; 167(11): 6113 - 6122. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. S.C. Weber, G. Ostermann, A. Zernecke, A. Schroder, L. B. Klickstein, and C. Weber Dual Role of H-Ras in Regulation of Lymphocyte Function Antigen-1 Activity by Stromal Cell-derived Factor-1alpha : Implications for Leukocyte Transmigration Mol. Biol. Cell, October 1, 2001; 12(10): 3074 - 3086. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Mukai, M. Iwasaki, P. Gao, M. Tomura, Y. Yashiro-Ohtani, S. Ono, M. Murai, K. Matsushima, M. Kurimoto, M. Kogo, et al. IL-12 plays a pivotal role in LFA-1-mediated T cell adhesiveness by up-regulation of CCR5 expression J. Leukoc. Biol., September 1, 2001; 70(3): 422 - 430. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Lupher Jr., E. A. S. Harris, C. R. Beals, L. Sui, R. C. Liddington, and D. E. Staunton Cellular Activation of Leukocyte Function-Associated Antigen-1 and Its Affinity Are Regulated at the I Domain Allosteric Site J. Immunol., August 1, 2001; 167(3): 1431 - 1439. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. R. Chan, S. J. Hyduk, and M. I. Cybulsky Chemoattractants Induce a Rapid and Transient Upregulation of Monocyte {alpha}4 Integrin Affinity for Vascular Cell Adhesion Molecule 1 Which Mediates Arrest: An Early Step in the Process of Emigration J. Exp. Med., May 21, 2001; 193(10): 1149 - 1158. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Sanz-Rodriguez, A. Hidalgo, and J. Teixido Chemokine stromal cell-derived factor-1{alpha} modulates VLA-4 integrin-mediated multiple myeloma cell adhesion to CS-1/fibronectin and VCAM-1 Blood, January 15, 2001; 97(2): 346 - 351. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Legler, G Wiedle, F. Ross, and B. Imhof Superactivation of integrin (&agr;)v(&bgr;)3 by low antagonist concentrations J. Cell Sci., January 4, 2001; 114(8): 1545 - 1553. [Abstract] [PDF]
|
|
|
|
 |
|
 J. R. Huth, E. T. Olejniczak, R. Mendoza, H. Liang, E. A. S. Harris, M. L. Lupher Jr., A. E. Wilson, S. W. Fesik, and D. E. Staunton NMR and mutagenesis evidence for an I domain allosteric site that regulates lymphocyte function-associated antigen 1 ligand binding PNAS, May 9, 2000; 97(10): 5231 - 5236. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Clissi, D. D'Ambrosio, J. Geginat, L. Colantonio, A. Morrot, N. W. Freshney, J. Downward, F. Sinigaglia, and R. Pardi Chemokines Fail to Up-Regulate {beta}1 Integrin-Dependent Adhesion in Human Th2 T Lymphocytes J. Immunol., March 15, 2000; 164(6): 3292 - 3300. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Pampori, T. Hato, D. G. Stupack, S. Aidoudi, D. A. Cheresh, G. R. Nemerow, and S. J. Shattil Mechanisms and Consequences of Affinity Modulation of Integrin alpha Vbeta 3 Detected with a Novel Patch-engineered Monovalent Ligand J. Biol. Chem., July 30, 1999; 274(31): 21609 - 21616. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. S.C. Weber, L. B. Klickstein, and C. Weber Specific Activation of Leukocyte beta 2 Integrins Lymphocyte Function-associated Antigen-1 and Mac-1 by Chemokines Mediated by Distinct Pathways via the alpha Subunit Cytoplasmic Domains Mol. Biol. Cell, April 1, 1999; 10(4): 861 - 873. [Abstract] [Full Text]
|
|
|
|
 |
|
 T. V. Byzova and E. F. Plow Activation of {alpha}V{beta}3 on Vascular Cells Controls Recognition of Prothrombin J. Cell Biol., December 28, 1998; 143(7): 2081 - 2092. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wang, H. Chen, and E. J. Brown L-plastin Peptide Activation of alpha vbeta 3-mediated Adhesion Requires Integrin Conformational Change and Actin Filament Disassembly J. Biol. Chem., April 20, 2001; 276(17): 14474 - 14481. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. S. Harris, T. M. McIntyre, S. M. Prescott, and G. A. Zimmerman The Leukocyte Integrins J. Biol. Chem., July 28, 2000; 275(31): 23409 - 23412. [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
, IL-8 
) was measured as described
in the legends to Figures 2