The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kraus, E.
Right arrow Articles by Barclay, A. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kraus, E.
Right arrow Articles by Barclay, A. N.
The Journal of Immunology, 1998, 160: 5209-5212.
Copyright © 1998 by The American Association of Immunologists

Cutting Edge: Novel RNA Ligands Able to Bind CD4 Antigen and Inhibit CD4+ T Lymphocyte Function1

Elmar Kraus*, William James{dagger} and A. Neil Barclay2,*

* Medical Research Council Cellular Immunology Unit, {dagger} Sir William Dunn School of Pathology, University of Oxford, Oxford, United Kingdom


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results and Discussion
References
 
The value of high affinity-specific reagents in immunology is exemplified by the use of mAbs. Recent in vitro selection methods suggested that oligonucleotides may provide a useful alternative, especially where Abs have been insufficient thus far. We used a systematic evolution of ligands by exponential enrichment (SELEX) procedure to derive high affinity oligonucleotide ligands (aptamers) recognizing CD4. These RNase-resistant aptamers bound with high affinity and specificity as demonstrated using BIAcore (Stevenage, U.K.) technology. They also bound native CD4 on rat lymphocytes and specifically interfered with labeling by high affinity mAbs. All aptamers recognized the same binding site in the CDR2-like region in domain 1 of CD4. The applicability of these aptamers for immunologic studies was clearly demonstrated by their ability to block a fully allogeneic MLR in a CD4-specific manner. The high affinity and stability of aptamers point to their value in the analysis and functional manipulation of the immune system.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results and Discussion
References
 
The study of immunology was revolutionized when the mAb technique became widely applied. The advantages of mAbs were that they were highly specific, were stable, could be produced in large amounts, and were of high affinity. For these reasons, they were widely used to block interactions, to purify or localize target proteins, and to act as surrogate ligands in cellular reactions. Because mAbs are traditionally raised in laboratory animals, one clear disadvantage is that their production is limited to Ags that are immunogenic in the systems used, although some progress has been made in bypassing this by the in vitro production of Abs (1).

The systematic evolution of ligands by exponential enrichment (SELEX)3 method is based on the in vitro selection of rare oligonucleotide ligands followed by their amplification and cloning. The so-called "aptamers" that are isolated by this method display a high affinity and specificity to the target molecule on which they are selected (2). The limited biochemical diversity of nucleotides compared with amino acids in proteins is offset by the large complexities of libraries of potential aptamers that can be easily produced and investigated. The SELEX method involves synthesizing DNA oligonucleotides that contain a region of random sequence flanked by constant regions that allow amplification and transcription. A typical library has a complexity of about 1015, which is then transcribed into RNA. These RNA molecules adopt a multiplicity of structures, which allows some of them to bind to a given target structure. RNA that binds to the target is separated from unbound, and, utilizing the fixed regions, the separated RNA is reverse transcribed and PCR-amplified (3, 4) to produce a template for the next round of selection. This cycle is repeated until individual clones and hence aptamers can be obtained (2).

To use such aptamers for diagnostic or therapeutic uses, they need to be resistant to nucleases that are commonly found in body fluids. It has been demonstrated that RNA molecules containing a fluoro (F) or an amino (NH2) group at the 2' position of the ribose of pyrimidines are sufficiently RNase resistant to allow such applications (5, 6, 7, 8). These modifications are not only compatible with the enzymatic processes involved in the SELEX process (transcription and reverse transcription), they also widen the spectrum of potential tertiary structures due to their different chemistry. In addition, especially fluoro-substituted RNAs give rise to more compact and rigid aptamers with a likelihood of higher affinity compared with standard RNA or amino-modified RNA aptamers (9).

The CD4 Ag, which contains four Ig-like domains in the extracellular region, is an accessory protein in Ag recognition via its interaction with MHC Class II on APCs. It is also a receptor for HIV-1 (10, 11). Abs recognizing CD4 can block both Ag presentation and HIV binding (12, 13, 14). Abs against CD4 are also commonly used to induce tolerance in animal model systems of human diseases (15). We describe the production of RNA-aptamers against rat CD4 using 2'-modified nucleotides and recombinant CD4. Their specificity and value as tools were evaluated by surface plasmon resonance in the BIAcore (Stevenage, U.K.), flow cytometry, and in functional analysis in mixed lymphocyte reactions.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results and Discussion
References
 
The SELEX process

Technical details of the SELEX process were largely as described elsewhere (16). The random region consisted of 36 residues flanked by 24 and 23 residues on the 5' and 3' side, respectively, giving a full sequence of 83. The oligonucleotide library was produced by Genosys (Cambridge, U.K.). 2'fluoro-modified pyrimidine nucleotides (Amersham, U.K.), together with unmodified purine nucleotides, were used for in vitro transcriptions with an optimized transcription buffer (17). Recombinant sCD4 corresponding to the complete extracellular domain was prepared as described (18, 19) and coupled to cyanogen bromide (CNBr)-activated Sepharose 4B beads (Pharmacia, Milton Kegnes, U.K.). Partitioning was performed in modified PBS (1 mM MgCl2, 1 mM CaCl2) with the Sepharose-immobilized sCD4 for 24 h in the first round and for 2.5 h in all the following rounds. After the incubation, beads were washed five times in binding buffer, and bound RNA was eluted with 7 M urea followed by phenol/chloroform treatment. The recovered RNA was reverse transcribed with avian myeloblastosis virus (AMV) reverse transcriptase (Pharmacia), and the product was amplified via PCR under slightly mutagenic conditions (16) to give rise to a new template for the next round of selection. To reduce inadvertent selection for RNAs that bind to the Sepharose matrix, absorption steps using uncoupled Sepharose 4B beads were incorporated every third round. After 15 rounds of selection, the resulting cDNA was amplified with primers containing the recognition sites for the restriction endonucleases HindIII and BamHI (primer 1: GCCGGATCCGCCTGTTGTGAGCCTCCTGTCGAA; and primer 2: CCGAAGCTTAATACGACTCACTATAGGGAGACAAGAATAAACGCTCAA). The PCR product was digested with both nucleases and cloned into pUC19 vector. Single clones were isolated and sequenced using an Applied Biosystems 360 automatic sequencer (Warrington, U.K.).

BIAcore analysis

For BIAcore analysis, 25 µl of RNA, at a concentration of about 100 µg/ml in modified HBSS (10 mM HEPES, pH 7.4, 150 mM NaCl, 1 mM MgCl2, and 1 mM CaCl2), was injected at 5 µl/min into flow cells where rat sCD4 was immobilized directly onto the surface of the chip using an amine coupling kit and sCD4 at 35 µg/ml in 10 mM sodium acetate (pH 5.0). Results were evaluated with the BIAevaluation III program (BIAcore).

Flow cytometry

Rat lymph node cells (2 x 105) were preincubated for 15 min with 1 µg RNA in 100 µl before addition of saturating amounts of Ab. After 30 min, cells were washed and stained with FITC-coupled rabbit anti-mouse Abs (Pierce, Chester, U.K.). Five thousand live-gated events were recorded in a FACScan (Becton Dickinson, Oxford, U.K.) and analyzed with the CellQuest software. Abs MRC OX21 (directed against human C3b inactivator) (20); MRC OX8 (anti-CD8) and W3/25 (anti-CD4) (21); and MRC OX 63 and OX 65 (both anti-CD4) (14) were used as tissue culture supernatants.

Mixed lymphocyte reactions and proliferation assays

Lymph node responders (5 x 105) of the PVG strain of rats were incubated with 5 x 105 irradiated (3000 rad) splenic stimulator cells of the DA strain in 96-well plates for 3 days, followed by a pulse with [3H]thymidine for 18 h. The cells were harvested and analyzed in a ß-plate reader (Wallac, Milton Kegnes, U.K.). Where indicated, RNA, W3/25 IgG, or W3/25 Fab fragments were added to the responder cells 15 min before stimulator cells were added.


   Results and Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
References
 
In vitro selection of RNA aptamers that bind to recombinant rat CD4 immobilized on Sepharose.

In an attempt to identify high affinity RNA ligands for rat CD4, a pool of about 5 x 1014 different RNA molecules was transcribed from a DNA library randomized at 36 positions. This RNA was subjected to 15 rounds of an in vitro selection procedure with recombinant rat sCD4 as the target. Using the BIAcore, weak signals could be seen after as few as six rounds (data not shown) and strong specific binding to rat sCD4 after 10 rounds of selection (Fig. 1GoA). After 15 rounds of selection, clones of RNA aptamers were isolated and individually tested for specific binding to rat sCD4. Specificity of binding was demonstrated for two selected aptamers by testing them also on human sCD4, which has approximately 53% sequence identity to rat CD4 (Fig. 1Go, B and C).



View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 1. BIAcore analysis of aptamer specificity. A, RNA from unselected pools (injection 1), round 10 (injection 2), and round 11 (injection 3) was injected into flow cells where either 5000 response units (RU) of rat CD4 were immobilized (solid lines) or control protein (albumin, interrupted lines, 10,000 RU). Only selected RNA bound to rat CD4, and neither selected nor unselected RNA bound to the albumin control; B and C show the specific binding of two cloned aptamers (clones 8 and 14, respectively) to rat CD4 (solid lines) but not to human CD4 (interrupted lines).

 
RNA sequences of CD4-specific aptamers

The PCR product after the last round of selection was cloned into pUC19, with 32 clones being analyzed separately for CD4 binding. Ten clones (31% of total) showed specific binding to sCD4, and sequences of these were grouped according to sequence similarity into three different families and two orphan clones (Fig. 2Go). This result clearly demonstrates that there are several independent solutions for specific high affinity binding of RNA to rat sCD4, as demonstrated for other targets by others (9, 22, 23). Preliminary BIAcore kinetic analysis suggested an affinity in the low nanomolar range.



View larger version (39K):
[in this window]
[in a new window]
  		FIGURE 2. Sequence families of sCD4-specific aptamers. The PCR product after the last selection was cloned and sequenced. Only the sequences corresponding to the random portion of the initial construct are shown. The aptamers are grouped based on sequence similarity.

 
Mapping of the binding site of CD4-specific aptamers

To map the binding site of the aptamers on CD4 (for which we would like to suggest the name "aptatope"), rat lymph node cells were preincubated with RNA from representative clones from each group of aptamers and then stained with CD4-specific mAbs or with mAbs against other cell surface molecules. Only staining with the high affinity mAbs MRC OX63 and W3/25 (24) was affected by aptamers, suggesting that the exposed CDR2-like loop recognized by these Abs (14) was the actual aptatope. The degree of blocking varied, with some clones reducing labeling by only 10%, whereas clone 14 gave 90% inhibition when OX63 staining was investigated (Fig. 3Go). None of the CD4-specific aptamers gave significant blocking of Abs recognizing different regions of CD4 or other lymphocyte surface Ags (Fig. 3Go, and data not shown). Thus, it seems as if all the different RNA species isolated bind to the same aptatope on CD4, irrespective of their different sequences. The existence of dominant aptatopes has been observed for other protein-aptamer interactions before (25). Why some sites make particularly good aptatopes is not yet known but may well have something to do with the local distribution of basic residues in particular regions of proteins.



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 3. Flow cytometry analysis showing selected RNA aptamers block CD4 mAb binding to rat lymph node cells. Lymph node cells were preincubated with representative members of each family of CD4-specific aptamers and from the two orphans and then stained with the indicated Abs. Binding was detected with FITC-labeled rabbit anti-mouse Abs, with graphs of the control staining being filled with black. Various levels of blocking were obtained of the CD4 mAbs W3/25 and OX63 but not other mAbs.

 
RNA aptamers have the capacity to inhibit mixed lymphocyte reactions

The ability of aptamers to block functional assays was tested using a mixed lymphocyte reaction where the W3/25 CD4 mAb, which binds the same site as the tested aptamer clones (Fig. 3Go) and is of particularly high affinity (24), gives effective inhibition (26). Clear inhibition by CD4-specific aptamers by about 50% was observed in the fully allogeneic mixed lymphocyte reactions with an RNA concentration of 5 µg/ml, as illustrated for one experiment in Figure 4Go. No inhibitory effects due to nonspecific cytotoxicity of added RNA could be observed with a polyclonal RNA control. Clone 8, which binds CD4 less well and has a different sequence (Fig. 2Go), gave partial inhibition (Fig. 3Go, and data not shown). Thus the ability to block the MLR correlated with CD4 binding activity. The inhibition observed with the monovalent RNA is clearly less than with bivalent W3/25 IgG. Fab fragments of W3/25 were less effective than the full IgG and were similar to the aptamers in their ability to inhibit a MLR. It cannot be excluded that the activity of the Fab may be due to minor levels of contamination with intact IgG or to aggregation of the Fab.



View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 4. RNA aptamers inhibit a fully allogeneic mixed lymphocyte reaction. Data from one representative experiment show good inhibition by aptamer 14, W3/25 Fab, and almost complete inhibition at all concentrations by W3/25 IgG. A control using unselected RNA had no effect.

 
Aptamers so far have been shown to be able to block a variety of interactions, including binding of cytokines to their receptors (22), the binding of CD62L or L-selectin (27), and (so far only for DNA aptamers) in short term in vivo systems (27, 28). Our study here shows that CD4-specific RNA aptamers could be readily produced and had sufficient affinity and lifespan to give effective inhibition of an interaction involving very strong stimuli in a fully allogeneic mixed lymphocyte interaction. It seems feasible that aptamers will be of value in the manipulation of the immune system. This might be especially true when highly conserved proteins are to be targeted, where there is a difficulty in raising high affinity mAbs because of tolerance across species barriers.


   Acknowledgments
 
We thank Professor Raymond Dwek (Institute of Glycobiology, Oxford University) for his continuous interest and support and also Anton van der Merwe for his input in the early stages of the project and his especially valuable advice on the BIAcore. The authors also thank R. Goddard and S. Simmonds for technical assistance and D. Mason for critically reading the manuscript.


   Footnotes
 
1 This research was supported by the Medical Research Council and by a fellowship to E.K. from the Deutsche Forschungsgemeinschaft (Grant Kr 1738/1-1). Back

2 Address correspondence and reprint requests to Dr. A. N. Barclay, MRC Cellular Immunology Unit, Sir William Dunn School for Pathology, University of Oxford, South Parks Road, Oxford OX1 3RE, U.K. E-mail address: Back

3 Abbreviations used in this paper: SELEX, systematic evolution of ligands by exponential enrichment; sCD4, soluble CD4. Back

Received for publication March 4, 1998. Accepted for publication April 3, 1998.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
References
 

  1. Griffiths, A. D., S. C. Williams, O. Hartley, I. M. Tomlinson, P. Waterhouse, W. L. Crosby, R. E. Kontermann, P. T. Jones, N. M. Low, T. J. Allison, T. D. Prospero, H. R. Hoogenboom, A. Nissim, J. P. L. Cox, J. L. Harrison, M. Zaccolo, E. Gherardi, G. Winter. 1994. Isolation of high affinity human antibodies directly from large synthetic repertoires. EMBO J. 13:3245.[Medline]
  2. Gold, L., B. Polisky, O. Uhlenbeck, M. Yarus. 1995. Diversity of oligonucleotide functions. Annu. Rev. Biochem. 64:763.[Medline]
  3. Ellington, A. D., J. W. Szostak. 1990. In vitro selection of RNA molecules that bind specific ligands. Nature 346:818.[Medline]
  4. Tuerk, C., L. Gold. 1990. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage-T4 DNA-polymerase. Science 249:505.[Abstract/Free Full Text]
  5. Pieken, W. A., D. B. Olson, F. Benseler, H. Aurup, F. Eckstein. 1991. Kinetic characterization of nuclease-resistant 2'-modified hammerhead ribozymes. Science 253:314.[Abstract/Free Full Text]
  6. Lin, Y., Q. Qui, S. C. Gill, S. D. Jayasena. 1994. Modified RNA sequence pools for in vitro selection. Nucleic Acids Res. 22:5229.[Abstract/Free Full Text]
  7. Green, L. S., D. Jellinek, C. Bell, L. A. Beebe, B. D. Feistner, S. C. Gill, F. M. Jucker, N. Janjic. 1995. Nuclease-resistant nucleic-acid ligands to vascular-permeability factor vascular endothelial growth-factor. Chem. Biol. 2:683.[Medline]
  8. Jellinek, D., L. S. Green, C. Bell, C. K. Lynott, N. Gill, C. Vargeese, G. Kirschenheuter, D. P. C. McGee, P. Abesinghe, W. A. Pieken, R. Shapiro, D. B. Rifkin, D. Moscatelli, N. Janjic. 1995. Potent 2'-amino-2'-deoxypyrimidine RNA inhibitors of basic fibroblast growth factor. Biochemistry 34:11363.[Medline]
  9. Pagratis, N. C., C. Bell, Y. F. Chang, S. Jennings, T. Fitzwater, D. Jellinek, C. Dang. 1997. Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nat. Biotechnol. 15:68.[Medline]
  10. Dagleish, A. G., P. C. L. Beverly, P. R. Clapham, M. F. Crawford, M. F. Greaves, R. A. Weiss. 1984. The CD4 (T4) antigen is an essential component of the receptor for the AIDS retrovirus. Nature 312:763.[Medline]
  11. Simon, J. H. M., C. Somoza, G. A. Schockmel, M. Collin, S. J. Davis, A. F. Williams, W. James. 1993. A rat CD4 mutant containing the gp120-binding site mediates human immunodeficiency virus type 1 infection. J. Exp. Med. 177:949.[Abstract/Free Full Text]
  12. Corbeau, P., R. Benkirane, C. Weil, S. David, S. Emiliani, D. Olive, C. Mawas, A. Serre, C. Devaux. 1993. Ig CDR-3-like region of CD4 is involved in syncytia formation but not in viral entry. J. Immunol. 150:290.[Abstract]
  13. Truneh, A., D. Buck, D. R. Cassat, R. Juzszak, S. Kassis, S. E. Ryu, D. Healey, R. Sweet, Q. Sattenau. 1991. A region in domain 1 of CD4 distinct from the primary gp120 binding site is involved in HIV infection and virus-mediated fusion. J. Biol. Chem. 266:5942.[Abstract/Free Full Text]
  14. Simon, J. H. M., P. Stumbles, N. Signoret, C. Somoza, M. Puklavec, Q. J. Sattentau, A. N. Barclay, W. James. 1997. Role of CD4 epitopes outside the gp120-binding site during entry of human immunodeficiency virus type 1. J. Virol. 71:1476.[Abstract]
  15. Cobbold, S. P., E. Adams, S. E. Marshall, J. D. Davies, H. Waldmann. 1996. Mechanisms of peripheral tolerance and suppression induced by monoclonal antibodies to CD4 and CD8. Immunol. Res. 149:5.
  16. Fitzwater, T., B. Polisky. 1996. A SELEX primer. Methods Enzymol. 267:275.[Medline]
  17. Heidenreich, O., S. H. Kang, D. A. Brown, X. Xu, P. Swiderski, J. J. Rossi, F. Eckstein, M. Nerenberg. 1995. Ribozyme-mediated RNA degradation in nuclei suspension. Nucleic Acids Res. 23:2223.[Abstract/Free Full Text]
  18. Davis, S. J., R. L. Brady, A. N. Barclay, K. Harlos, G. G. Dodson, A. F. Williams. 1990. Crystallization of a soluble form of the rat T-cell surface glycoprotein CD4 complexed with Fab from the W3/25 monoclonal antibody. J. Mol. Biol. 213:7.[Medline]
  19. Brady, R., E. Dodson, G. Dodson, G. Lange, S. Davies, A. F. Williams, A. N. Barclay. 1993. Crystal structure of domains 3 and 4 of rat CD4: relation to the NH2-terminal domains. Science 260:979.[Abstract/Free Full Text]
  20. Hsiung, L. M., A. N. Barclay, M. R. Brandon, E. Sim, R. R. Porter. 1982. Purification of human C3b inactivator by monoclonal-antibody affinity chromatography. Biochem. J. 203:293.[Medline]
  21. Brideau, R. J., P. B. Carter, W. R. McMaster, M. Webb. 1980. Two subsets of rat T lymphocytes defined with monoclonal antibodies. Eur. J. Immunol. 10:609.[Medline]
  22. Kubik, M. F., C. Bell, T. Fitzwater, S. R. Watson, D. M. Tasset. 1997. Isolation and characterization of 2'-fluoro-, 2'-amino-, and 2'-fluoro-/amino-modified RNA ligands to human IFN-gamma that inhibit receptor binding. J. Immunol. 159:259.[Abstract]
  23. Weiss, S., D. Proske, M. Neumann, M. H. Groschup, H. A. Kretschmar, M. Famulok, E.-L. Winnacker. 1997. RNA aptamers specifically interact with the prion protein PrP. J. Virol. 71:8790.[Abstract]
  24. Mason, D., A. F. Williams. 1990. The kinetics of antibody binding to membrane antigens in solution and at the cell surface. Biochem. J. 187:1.
  25. Wiegand, T. W., P. B. Williams, S. C. Dreskin, M. H. Jouvin, J. P. Kinet, D. Tasset. 1996. High-affinity oligonucleotide ligands to human IgE inhibit binding to Fc{epsilon} receptor I. J. Immunol. 157:221.[Abstract]
  26. Webb, M., D. W. Mason, A. F. Williams. 1979. Inhibition of a mixed lymphocyte response by a monoclonal antibody specific for a rat T lymphocyte subset. Nature 282:841.[Medline]
  27. Hicke, B. J., S. R. Watson, A. Koenig, C. K. Lynott, R. F. Bargatze, Y. F. Chang, S. Ringquist, L. Moon-McDermot, S. Jennings, T. Fitzwater, H. L. Han, N. Varki, I. Albinana, M. C. Willis, A. Varki, D. Parma. 1996. DNA aptamers block L-selectin function in vivo: inhibition of human lymphocyte trafficking in SCID mice. J. Clin. Invest. 98:2688.[Medline]
  28. Bless, N. M., D. Smith, J. Charlton, B. J. Czermak, H. Schmal, H. P. Friedl, P. A. Ward. 1997. Protective effects of an aptamer inhibitor of neutrophil elastase in lung inflammatory injury. Curr. Biol. 7:877.[Medline]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
N. M. Sayer, M. Cubin, A. Rhie, M. Bullock, A. Tahiri-Alaoui, and W. James
Structural Determinants of Conformationally Selective, Prion-binding Aptamers
J. Biol. Chem., March 26, 2004; 279(13): 13102 - 13109.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
M. Khati, M. Schuman, J. Ibrahim, Q. Sattentau, S. Gordon, and W. James
Neutralization of Infectivity of Diverse R5 Clinical Isolates of Human Immunodeficiency Virus Type 1 by gp120-Binding 2'F-RNA Aptamers
J. Virol., December 1, 2003; 77(23): 12692 - 12698.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
A. Tahiri-Alaoui, L. Frigotto, N. Manville, J. Ibrahim, P. Romby, and W. James
High affinity nucleic acid aptamers for streptavidin incorporated into bi-specific capture ligands
Nucleic Acids Res., May 15, 2002; 30(10): e45 - e45.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Chem.Home page
S. D. Jayasena
Aptamers: An Emerging Class of Molecules That Rival Antibodies in Diagnostics
Clin. Chem., September 1, 1999; 45(9): 1628 - 1650.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kraus, E.
Right arrow Articles by Barclay, A. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kraus, E.
Right arrow Articles by Barclay, A. N.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS