| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Interdisciplinary Graduate Program in Immunology and Department of Internal Medicine, University of Iowa College of Medicine, and
University of Iowa College of Pharmacy, Iowa City, IA 52242; and
Department of Veteran Affairs Medical Center, Iowa City, IA 52246
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B and the
activation of NFB, which induces leukocyte gene transcription and
cytokine secretion. These studies demonstrate a novel pathway of
leukocyte activation triggered by CpG motifs. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B to the nucleus and
to secrete cytokines, including IL-12, TNF-
, and IFN-/ß, and
activates NK cells (5, 6, 7, 8, 9, 10) (A.-K. Yi and A. M. Krieg, unpublished
observations). Vertebrate DNA lacks these immune effects. We have
recently shown that leukocyte activation by bDNA depends on the
presence of unmethylated CpG dinucleotides in particular base contexts
(CpG motifs) and can be mimicked with synthetic oligodeoxynucleotides
(ODN) (11, 12, 13). B cells and monocytes/macrophages treated with DNA
containing CpG motifs (CpG DNA) have increased expression of
c-myc, myn, egr-1, c-jun,
bax, bcl-xL, TNF-, and IL-6 mRNA
and/or protein within 15 to 30 min in vivo and in vitro (4, 13, 14)
(A.-K. Yi and A. M. Krieg, unpublished observations).4
These data suggest that CpG motifs act as a "danger signal" to the
immune system (15).
Cellular uptake of DNA appears to occur via adsorptive endocytosis into
an acidified chloroquine-sensitive intracellular compartment (16, 17).
Leukocyte activation by CpG DNA is not mediated through binding to a
cell surface receptor, but requires cell uptake (11). This suggested
that leukocyte activation by CpG DNA may occur in association with
acidified endosomes and might even be pH dependent. Here we demonstrate
that endosomal acidification of DNA is required for the CpG
DNA-mediated leukocyte activation and is coupled to the rapid
generation of reactive oxygen species (ROS), which leads to NFB
activation and subsequent proto-oncogene and cytokine expression.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Spleen cells were prepared from DBA/2 mice (5–10 wk old; The Jackson Laboratory, Bar Harbor, ME) as described previously (13). Murine B lymphoma WEHI-231 cells and murine monocyte J774 cells were purchased from American Culture Collection (Rockville, MD). All cells were cultured at 37°C in a 5% CO2 humidified incubator and maintained in RPMI 1640 supplemented with 10% FCS, 1.5 mM L-glutamine, 50 µM 2-ME, 100 U/ml penicillin, and 100 µg/ml streptomycin.
ODN and DNA
Escherichia coli (EC) DNA (strain B) and calf thymus (CT) DNA were purchased from Sigma (St. Louis, MO). Nuclease-resistant phosphorothioate ODN (S-ODN) were obtained from Oligos Etc. (Wilsonville, OR). Phosphodiester ODN were purchased from Operon Technologies (Alameda, CA). All DNA and ODN were purified as previously described (13) using pyrogen-free solutions and had undetectable endotoxin by Limulus assay. S-ODN conjugated to FITC on the 5' end were prepared as previously described (18).
Cytokine assays
Murine spleen cells, WEHI-231 cells, or J774 cells were cultured
with or without the indicated inhibitor for the indicated times and
then stimulated with the CpG S-ODN 1826 (TCCATGACGTTCCTGACGTT),
E. coli DNA, LPS (10 µg/ml), PMA (100 ng/ml) plus
ionomycin (1 nM), anti-IgM (10 µg/ml), or anti-CD40 (1
µg/ml) for 4 to 24 h. The levels of cytokines in the culture
supernatants were analyzed by ELISA for IL-6, IL-12, or TNF- as
previously described (13). Inhibitors used for this study were
chloroquine, monensin, bafilomycin A, bis-gliotoxin, gliotoxin,
N-acetyl-L-cysteine (NAC), pyrrolidine
dithiocarbamate (PDTC), and
N-tosyl-L-phenylalanine chlorometryl ketone
(TPCK). Anti-mouse IgM (µ-chain specific), LPS, and all inhibitors
were purchased from Sigma.
Flow cytometry for inhibition of ODN acidification
Efficacy of endosomal acidification inhibitors was verified using FITC-labeled S-ODN as previously described (16). Briefly, WEHI-231 cells or J774 cells (106 cell/ml) were treated with medium, chloroquine (5 µg/ml), monensin (20 µM), or bafilomycin A (250 nM) for 1 h, and then FITC-labeled S-ODN (1 µg/ml) was added. After 3 h of incubation at 37°C, cells were washed three times with PBS and then analyzed by flow cytometry.
Flow cytometry for detection of ROS generation
J774 cells and WEHI-231 B cells (5 x 105 cells/ml) were precultured for 30 min with or without chloroquine (5 µg/ml; <10 µM) or gliotoxin (0.2 µg/ml). Cell aliquots were then cultured for 20 min in RPMI medium with or without a CpG S-ODN 1826 or non-CpG S-ODN 1911 (TCCAGGACTTTCCTCAGGTT) at 1 µM or with PMA plus ionomycin (iono) in the presence of dihydrorhodamine-123. Cells were then analyzed for intracellular ROS production by flow cytometry as described previously (13).
Electrophoretic mobility shift assay (EMSA) and Western blot assay
J774 cells (1 x 106/ml) were cultured in
the presence of CT, EC, or methylated EC DNA (methylated with CpG
methylase as described (11)) at 5 µg/ml or a CpG S-ODN 1826 or a
non-CpG S-ODN 1745 (TCCATGAGCTTCCTGAGTCT) at 0.75 µM for 1
h. In some experiments, J774 cells were precultured for 2 h in the
presence or the absence of chloroquine (2.5–20 µg/ml) and then
stimulated for 1 h with EC DNA, CpG ODN, non-CpG ODN, or LPS (1
µg/ml). Cells were harvested, and cytoplasmic extracts and nuclear
extracts were prepared as previously described (4). EMSA was conducted
with nuclear extracts (5 µg/lane) for NFB activation using
radiolabeled double-stranded phosphodiester ODN containing a consensus
NFB site as previously described (19, 20). The position of the
p50/p65 heterodimer was determined by supershifting with specific Abs
to p65 and p50. Western blot for IB or IBß was performed
with cytoplasmic extracts (50 µg/lane) as previously described (4).
Abs against mouse p50, p52, p65, Rel B, c-Rel, IB, and IBß
were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
Anti-mouse CD40 was purchased from PharMingen (San Diego, CA).
RNase protection assay (RPA)
J774 cells (2 x 106 cells/ml) were cultured for 2 h in the presence or the absence of chloroquine (2.5 µg/ml; <5 µM) or TPCK (50 µM). Cells were then stimulated with the addition of EC DNA (50 µg/ml), CT DNA (50 µg/ml), LPS (10 µg/ml), CpG S-ODN 1826 (1 µM), or control non-CpG S-ODN 1911 (1 µM) for 3 h. Cells were harvested, and total RNA was prepared using RNAzol method according to the manufacturer’s protocol. Levels of mRNA of specific genes were analyzed by RPA as described previously (14). Comparable amounts of RNA (3 µg/lane) were loaded into each lane, as shown by the mRNA loading control for L32, a ribosomal protein.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To test the hypothesis that endosomal acidification of CpG
DNA is necessary for its induction of leukocyte activation, B cell or
monocyte-like cell lines were stimulated with CpG DNA in the presence
or the absence of specific inhibitors previously shown to block
endosomal acidification of DNA including bafilomycin A, chloroquine,
and monensin (16). First, the efficacy of these drugs for inhibiting
the intracellular acidification of CpG DNA was verified using FACS
analysis. Acidification of the FITC molecule quenches its fluorescence.
Therefore, increased levels of fluorescence of the FITC-conjugated ODN
in the cells treated with the inhibitors indicates the effective
inhibition of ODN acidification by the drugs. As shown in Figure 1
, the fluorescence intensity of FITC-ODN
was increased in the presence of these endosomal acidification
inhibitors in the concentration range used in our experiments,
indicating effective inhibition of endosomal acidification by these
drugs.
|
Inhibitors of endosomal acidification block the CpG DNA-induced intracellular ROS generation
Since high concentrations of chloroquine also inhibit LPS-induced
TNF- secretion without affecting LPS-mediated early signaling events
(21), we evaluate whether these endosomal acidification inhibitors can
specifically block the early events in the CpG DNA-mediated leukocyte
activation. The earliest leukocyte activation event that we have been
able to detect in response to CpG DNA is the production of ROS, which
is induced within 5 min in primary spleen cells and both B and
monocyte-like cell lines (Fig. 2) (13)
(A.-K. Yi and A. M. Krieg, unpublished observations). As shown in
Figure 2, a low concentration of chloroquine blocked the CpG
DNA-induced generation of ROS, but had no effect on ROS generation
mediated by PMA or ligation of CD40 or surface Ag receptor (Fig. 2).
Bafilomycin A, which inhibits endosomal acidification by blocking
endosomal ATPase (22), also specifically suppressed CpG DNA-mediated
ROS generation without affecting ROS generation induced by other
stimulants (data not shown). These results suggest that acidification
of DNA may be necessary for CpG DNA-mediated early signaling events,
and this process may precede the CpG DNA-induced ROS generation.
|
B and IBß
degradation and subsequent NFB activation
CpG DNA induces rapid activation of NFB, which is accompanied
by the degradation of IB and IBß, in a sequence-specific
manner (4). Therefore, we next evaluated whether endosomal
acidification of CpG DNA was also required for CpG DNA-induced IB
and IBß degradation and subsequent NFB activation. As shown in
Figure 3A, EC DNA and CpG ODN
induced degradation of IB and IBß and activation of NFB
within 1 h of stimulation in J774 cells. In contrast, control CT
DNA and non-CpG ODN failed to induce NFB activation or IB and
IBß degradation. In addition, methylation of CpG dinucleotides in
EC DNA significantly suppressed EC DNA-mediated NFB activation and
IB and IBß degradation. Chloroquine selectively blocked CpG
DNA (EC DNA or CpG ODN)-induced IB and IBß degradation and
NFB activation (Fig. 3B). However, chloroquine
failed to inhibit any of these LPS-induced intracellular activation
events (Fig. 3B). These experiments support the role
of a pH-dependent signaling mechanism in specifically mediating the
stimulatory effects of CpG DNA.
|
B activation block
CpG DNA-induced gene expression
While NFB is known to be an important regulator of gene
expression, its role in the transcriptional response to CpG DNA was
uncertain. To determine whether endosomal acidification and/or NFB
activation was required for the CpG DNA-mediated induction of gene
expression, we activated cells with CpG DNA in the presence or the
absence of chloroquine; PDTC, an inhibitor of IB phosphorylation;
TPCK, a protease inhibitor that blocks IB degradation; gliotoxin, an
inhibitor of IB degradation; or bisgliotoxin, an inactive congener
of gliotoxin (23, 24, 25). Inhibitor concentrations used in our experiments
were determined based on previous reports of their specificity (16, 23, 24, 25) and on our preliminary dose titrations, which allowed us to use
lower inhibitor concentrations than those employed in prior studies.
These inhibitors of endosomal acidification or NFB activation
completely blocked the CpG DNA-induced expression of proto-oncogene and
cytokine mRNA and protein (Fig. 4; Tables
I–III) (A.-K. Yi and A. M. Krieg, unpublished observations),
suggesting the essential role of NFB as a mediator of these events.
As previously reported (21), chloroquine showed no effect on
LPS-induced gene expression (Fig. 4). None of the inhibitors reduced
cell viability under the experimental conditions used in these studies.
These results suggested that both endosomal acidification and NFB
activation are necessary steps for CpG DNA-mediated immune
activation.
|
B activation
CpG DNA-induced ROS generation could be an incidental
consequence of cell activation or a signal that mediates this
activation. Therefore, we evaluated whether CpG DNA-induced generation
of ROS precedes the NFB activation and may be necessary for the CpG
DNA-mediated NFB activation. As shown in Figure 5, ROS generation in response to CpG DNA
is not inhibited by the NFB inhibitor gliotoxin (23), while CpG
DNA-induced NFB activation was completely blocked by gliotoxin (data
not shown), confirming that the ROS generation is not secondary to
NFB activation. In addition, the ROS scavengers NAC and PDTC blocked
NFB activation, cytokine production, and B cell proliferation
induced by CpG DNA or other stimulants (Tables I–III and data not
shown) (13), consistent with a causal role for ROS generation in these
pathways.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, and IFN-
,
from B cells, monocytes/macrophages, and NK cells (8, 9, 11, 12, 13, 26).
CpG DNA synergizes with Ag receptor-mediated signals to increase IL-6,
TNF-, and Ig secretion and B cell proliferation (11, 12, 13) (A.-K. Yi
and A. M. Krieg, unpublished observations). CpG DNA protects
WEHI-231 B cells and spleen B cells from apoptosis (4, 14).4 However, the molecular mechanisms by which CpG
DNA mediates leukocyte activation are not clearly understood at the
present time. The results in the present study indicate that endosomal
acidification of DNA is required for the CpG DNA-mediated leukocyte
activation and is coupled to the rapid generation of ROS that leads to
IB degradation and NFB activation and subsequent proto-oncogene
and cytokine expression. Our previous studies indicate that B cells and monocytic cell lines do not have a specific membrane receptor for CpG DNA, and cell uptake of the CpG DNA is required for its action (11). Cellular uptake of DNA appears to occur via adsorptive endocytosis into an acidified intracellular compartment (16, 17). This led us to evaluate whether leukocyte activation by CpG DNA occurs in association with acidified endosomes and may even be dependent on the endosomal pH. Inhibitors of endosomal acidification, such as bafilomycin A, chloroquine, and monensin, effectively block CpG DNA-mediated cytokine production in murine spleen cells, B cell lines, and monocyte cell lines (Tables I–III) (A.-K. Yi and A. M. Krieg, unpublished observations), suggesting a requirement for an intracellular pH-dependent step for CpG DNA-mediated immune cell activation.
The pH-dependent step may be the transport or processing of the CpG
DNA, the ROS generation, or some later step in the activation pathway.
For example, high concentrations (100–250 µM) of chloroquine inhibit
LPS-induced TNF- secretion, but not NFB activation or gene
transcription (21). This led us to evaluate whether these endosomal
acidification inhibitors can specifically block the early events in the
CpG DNA-mediated leukocyte activation. Within 30 min after CpG DNA
stimulation, B cells and monocyte-like cell lines have increased
intracellular ROS generation, NFB activation, and induction of the
expression of several proto-oncogenes and cytokine genes (4, 5, 13, 14)
(A.-K. Yi and A. M. Krieg, unpublished observations). At the low
concentrations (
5 µM), chloroquine selectively blocked CpG
DNA-induced ROS generation, IB and IBß degradation, nuclear
translocation of NFB, and proto-oncogene expressions without
affecting any of these events induced by other stimuli, such as LPS,
anti-IgM, anti-CD40, or PMA plus ionomycin (
Figs. 2–4
). These
results indicate that the chloroquine-inhibitable step takes place at a
very early stage of the CpG DNA-mediated signaling pathway. Taken
together, our results suggest that CpG DNA is taken up by the cell via
endocytosis and is acidified in the endosomal compartment, and this
process precedes and even might be necessary for the CpG DNA-mediated
early signaling events such as ROS generation and NFB
activation.
ROS are widely thought to be second messengers in signaling pathways in
diverse cell types. ROS are also known to mediate signals that can lead
to IB degradation and NFB activation (24, 25, 27). Therefore, we
tested whether ROS generated after CpG DNA stimulation precede the
NFB activation and are necessary for the CpG DNA-mediated IB
degradation and NFB activation. ROS generation in response to CpG
DNA is selectively inhibited by chloroquine but is not blocked by
gliotoxin, which inhibits activation of NFB (Fig. 5), indicating
that CpG DNA-mediated ROS generation is not secondary to NFB
activation. Furthermore, the ROS scavengers NAC and PDTC suppressed CpG
DNA-induced IB and IBß degradation and subsequent NFB
activation (data not shown) (4), suggesting a causal role for ROS
generation in CpG DNA-mediated signaling pathway. These data are
compatible with previous evidence supporting a role for ROS in the
activation of NFB (24, 25).
Our studies indicate that leukocytes respond to CpG DNA through a novel
pathway involving the pH-dependent generation of intracellular ROS,
which is essential for the activation of NFB and all the downstream
events observed after CpG DNA stimulation (Fig. 6).
|
Note added in proof. Since the submission of this manuscript, the inhibition of CpG-induced B cell resistance to apoptosis by chloroquine and related compounds has been reported by D. E. MacFarlane and L. Manzel, 1998. J. Immunol. 160:1122.
|
|
|
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Arthur M. Krieg, Department of Internal Medicine, University of Iowa, 540 EMRB, Iowa City, IA 52242. E-mail address:
3 Abbreviations used in this paper: bDNA, bacterial DNA; ODN, oligodeoxynucleotide; ROS, reactive oxygen species; EC, Escherichia coli; CT, calf thymus; S-ODN, phosphorothioate oligodeoxynucleotide; NAC, N-acetyl-L-cysteine; PDTC, pyrrolidine dithiocarbamate; TPCK, N-tosyl-L-phenylalanine chloromethyl ketone; EMSA, electrophoretic mobility shift assay; RPA, ribonuclease protection assay.
4 A.-K. Yi, M. Chang, D. W. Peckham, A. M. Krieg, and R. F. Ashman, Submitted for publication.
Received for publication November 18, 1997. Accepted for publication January 16, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production by stimulation of interleukin-12 and tumor necrosis factor-. Cell. Immunol. 167:72.[Medline]
B and IBß and sustained activation of nuclear factor-B/c-Rel. J. Immunol. 160:1240./ß and - with deoxyribonucleic acid fraction from Mycobacterium bovis BCG. Jpn. J. Cancer Res. 79:866.[Medline]
in vivo and increases the toxicity of lipopolysaccharides. J. Immunol. 156:4570.[Abstract]
production by NK cells and increases sensitivity to endotoxin. J. Immunol. 157:1840.[Abstract]
. Proc. Natl. Acad. Sci. USA 93:2879.B activation. Mol. Cell. Biol. 10:422.B. J. Exp. Med. 183:1829.B in the immune system. Annu. Rev. Immunol. 12:141.[Medline]
B and IB proteins: new discoveries and insights. Annu. Rev. Immunol. 14:649.[Medline]
This article has been cited by other articles:
|
|
 |
|
  G. Chikh, S. D. de Jong, L. Sekirov, S. G. Raney, M. Kazem, K. D. Wilson, P. R. Cullis, J. P. Dutz, and Y. K. Tam Synthetic methylated CpG ODNs are potent in vivo adjuvants when delivered in liposomal nanoparticles Int. Immunol., July 1, 2009; 21(7): 757 - 767. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Tirapu, B. Giquel, L. Alexopoulou, S. Uematsu, R. Flavell, S. Akira, and S. S. Diebold PolyI:C-induced reduction in uptake of soluble antigen is independent of dendritic cell activation Int. Immunol., July 1, 2009; 21(7): 871 - 879. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. El Kebir, L. Jozsef, W. Pan, L. Wang, and J. G. Filep Bacterial DNA Activates Endothelial Cells and Promotes Neutrophil Adherence through TLR9 Signaling J. Immunol., April 1, 2009; 182(7): 4386 - 4394. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-E. Park, Y.-I. Kim, and A.-K. Yi Protein Kinase D1: A New Component in TLR9 Signaling J. Immunol., August 1, 2008; 181(3): 2044 - 2055. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-I. Kim, J.-E. Park, A. Martinez-Hernandez, and A.-K. Yi CpG DNA Prevents Liver Injury and Shock-mediated Death by Modulating Expression of Interleukin-1 Receptor-associated Kinases J. Biol. Chem., May 30, 2008; 283(22): 15258 - 15270. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Yotsumoto, K. Saegusa, and Y. Aramaki Endosomal Translocation of CpG-Oligodeoxynucleotides Inhibits DNA-PKcs-Dependent IL-10 Production in Macrophages J. Immunol., January 15, 2008; 180(2): 809 - 816. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. J. Leppert, J. M. Mansfield, and D. M. Paulnock The Soluble Variant Surface Glycoprotein of African Trypanosomes Is Recognized by a Macrophage Scavenger Receptor and Induces I{kappa}B{alpha} Degradation Independently of TRAF6-Mediated TLR Signaling J. Immunol., July 1, 2007; 179(1): 548 - 556. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Pompei, S. Jang, B. Zamlynny, S. Ravikumar, A. McBride, S. P. Hickman, and P. Salgame Disparity in IL-12 Release in Dendritic Cells and Macrophages in Response to Mycobacterium tuberculosis Is Due to Use of Distinct TLRs J. Immunol., April 15, 2007; 178(8): 5192 - 5199. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Zhou, H. Wei, R. Sun, and Z. Tian Recognition of Double-Stranded RNA by TLR3 Induces Severe Small Intestinal Injury in Mice J. Immunol., April 1, 2007; 178(7): 4548 - 4556. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Wang, H. Zhou, J. Zheng, J. Cheng, W. Liu, G. Ding, L. Wang, P. Luo, Y. Lu, H. Cao, et al. The Antimalarial Artemisinin Synergizes with Antibiotics To Protect against Lethal Live Escherichia coli Challenge by Decreasing Proinflammatory Cytokine Release. Antimicrob. Agents Chemother., July 1, 2006; 50(7): 2420 - 2427. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Kawakami, Y. Ito, P. Charoensit, F. Yamashita, and M. Hashida Evaluation of Proinflammatory Cytokine Production Induced by Linear and Branched Polyethylenimine/Plasmid DNA Complexes in Mice J. Pharmacol. Exp. Ther., June 1, 2006; 317(3): 1382 - 1390. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-K. Yi, H. Yoon, J.-E. Park, B.-S. Kim, H. J. Kim, and A. Martinez-Hernandez CpG DNA-mediated Induction of Acute Liver Injury in D-Galactosamine-sensitized Mice: THE MITOCHONDRIAL APOPTOTIC PATHWAY-DEPENDENT DEATH OF HEPATOCYTES J. Biol. Chem., May 26, 2006; 281(21): 15001 - 15012. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Delgado, J. F. Poschet, and V. Deretic Nonclassical Pathway of Pseudomonas aeruginosa DNA-Induced Interleukin-8 Secretion in Cystic Fibrosis Airway Epithelial Cells. Infect. Immun., May 1, 2006; 74(5): 2975 - 2984. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Andersen, D. Al-Khairy, and R. R. Ingalls Innate Immunity at the Mucosal Surface: Role of Toll-Like Receptor 3 and Toll-Like Receptor 9 in Cervical Epithelial Cell Responses to Microbial Pathogens Biol Reprod, May 1, 2006; 74(5): 824 - 831. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Adachi, A. L. Kindzelskii, A. R. Petty, J.-B. Huang, N. Maeda, S. Yotsumoto, Y. Aratani, N. Ohno, and H. R. Petty IFN-{gamma} Primes RAW264 Macrophages and Human Monocytes for Enhanced Oxidant Production in Response to CpG DNA via Metabolic Signaling: Roles of TLR9 and Myeloperoxidase Trafficking. J. Immunol., April 15, 2006; 176(8): 5033 - 5040. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Jozsef, T. Khreiss, D. El Kebir, and J. G. Filep Activation of TLR-9 Induces IL-8 Secretion through Peroxynitrite Signaling in Human Neutrophils J. Immunol., January 15, 2006; 176(2): 1195 - 1202. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Vijay-Kumar, J. R. Gentsch, W. J. Kaiser, N. Borregaard, M. K. Offermann, A. S. Neish, and A. T. Gewirtz Protein Kinase R Mediates Intestinal Epithelial Gene Remodeling in Response to Double-Stranded RNA and Live Rotavirus J. Immunol., May 15, 2005; 174(10): 6322 - 6331. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Yasuda, Y. Ogawa, I. Yamane, M. Nishikawa, and Y. Takakura Macrophage activation by a DNA/cationic liposome complex requires endosomal acidification and TLR9-dependent and -independent pathways J. Leukoc. Biol., January 1, 2005; 77(1): 71 - 79. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. He, X. Qiao, and A. Cerutti CpG DNA Induces IgG Class Switch DNA Recombination by Activating Human B Cells through an Innate Pathway That Requires TLR9 and Cooperates with IL-10 J. Immunol., October 1, 2004; 173(7): 4479 - 4491. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Marshak-Rothstein, L. Busconi, C. M. Lau, A. S. Tabor, E. A. Leadbetter, S. Akira, A. M. Krieg, G. B. Lipford, G. A. Viglianti, and I. R. Rifkin Comparison of CpG s-ODNs, chromatin immune complexes, and dsDNA fragment immune complexes in the TLR9-dependent activation of rheumatoid factor B cells Innate Immunity, August 1, 2004; 10(4): 247 - 251. [Abstract] [PDF]
|
|
|
|
|
|
K. Funami, M. Matsumoto, H. Oshiumi, T. Akazawa, A. Yamamoto, and T. Seya The cytoplasmic 'linker region' in Toll-like receptor 3 controls receptor localization and signaling Int. Immunol., August 1, 2004; 16(8): 1143 - 1154. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. W. Boule, C. Broughton, F. Mackay, S. Akira, A. Marshak-Rothstein, and I. R. Rifkin Toll-like Receptor 9-Dependent and -Independent Dendritic Cell Activation by Chromatin-Immunoglobulin G Complexes J. Exp. Med., June 21, 2004; 199(12): 1631 - 1640. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Scheller, A. Ullrich, K. McPherson, B. Hefele, J. Knoferle, S. Lamla, A. R. M. Olbrich, H. Stocker, K. Arasteh, V. t. Meulen, et al. CpG Oligodeoxynucleotides Activate HIV Replication in Latently Infected Human T Cells J. Biol. Chem., May 21, 2004; 279(21): 21897 - 21902. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Pichyangkul, K. Yongvanitchit, U. Kum-arb, H. Hemmi, S. Akira, A. M. Krieg, D. G. Heppner, V. A. Stewart, H. Hasegawa, S. Looareesuwan, et al. Malaria Blood Stage Parasites Activate Human Plasmacytoid Dendritic Cells and Murine Dendritic Cells through a Toll-Like Receptor 9-Dependent Pathway J. Immunol., April 15, 2004; 172(8): 4926 - 4933. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Cornelie, J. Hoebeke, A.-M. Schacht, B. Bertin, J. Vicogne, M. Capron, and G. Riveau Direct Evidence that Toll-like Receptor 9 (TLR9) Functionally Binds Plasmid DNA by Specific Cytosine-phosphate-guanine Motif Recognition J. Biol. Chem., April 9, 2004; 279(15): 15124 - 15129. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Shiratsuchi, I. Watanabe, O. Takeuchi, S. Akira, and Y. Nakanishi Inhibitory Effect of Toll-Like Receptor 4 on Fusion between Phagosomes and Endosomes/Lysosomes in Macrophages J. Immunol., February 15, 2004; 172(4): 2039 - 2047. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. P. Gould, J. A. Greene, V. Bhoj, J. L. DeVecchio, and F. P. Heinzel Distinct Modulatory Effects of LPS and CpG on IL-18-Dependent IFN-{gamma} Synthesis J. Immunol., February 1, 2004; 172(3): 1754 - 1762. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-J. Yeo, J.-G. Yoon, and A.-K. Yi Myeloid Differentiation Factor 88-dependent Post-transcriptional Regulation of Cyclooxygenase-2 Expression by CpG DNA: TUMOR NECROSIS FACTOR-{alpha} RECEPTOR-ASSOCIATED FACTOR 6, A DIVERGING POINT IN THE Toll-LIKE RECEPTOR 9-SIGNALING J. Biol. Chem., October 17, 2003; 278(42): 40590 - 40600. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Matsumoto, K. Funami, M. Tanabe, H. Oshiumi, M. Shingai, Y. Seto, A. Yamamoto, and T. Seya Subcellular Localization of Toll-Like Receptor 3 in Human Dendritic Cells J. Immunol., September 15, 2003; 171(6): 3154 - 3162. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. B. Ray and A. M. Krieg Oral Pretreatment of Mice with CpG DNA Reduces Susceptibility to Oral or Intraperitoneal Challenge with Virulent Listeria monocytogenes Infect. Immun., August 1, 2003; 71(8): 4398 - 4404. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-J. Yeo, D. Gravis, J.-G. Yoon, and A.-K. Yi Myeloid Differentiation Factor 88-dependent Transcriptional Regulation of Cyclooxygenase-2 Expression by CpG DNA: ROLE OF NF-{kappa}B AND p38 J. Biol. Chem., June 13, 2003; 278(25): 22563 - 22573. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-K. Yi, J.-G. Yoon, and A. M. Krieg Convergence of CpG DNA- and BCR-mediated signals at the c-Jun N-terminal kinase and NF-{kappa}B activation pathways: regulation by mitogen-activated protein kinases Int. Immunol., May 1, 2003; 15(5): 577 - 591. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. K. Datta, V. Redecke, K. R. Prilliman, K. Takabayashi, M. Corr, T. Tallant, J. DiDonato, R. Dziarski, S. Akira, S. P. Schoenberger, et al. A Subset of Toll-Like Receptor Ligands Induces Cross-presentation by Bone Marrow-Derived Dendritic Cells J. Immunol., April 15, 2003; 170(8): 4102 - 4110. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-J. Yeo, J.-G. Yoon, S.-C. Hong, and A.-K. Yi CpG DNA Induces Self and Cross-Hyporesponsiveness of RAW264.7 Cells in Response to CpG DNA and Lipopolysaccharide: Alterations in IL-1 Receptor-Associated Kinase Expression J. Immunol., January 15, 2003; 170(2): 1052 - 1061. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Yamada, I. Gursel, F. Takeshita, J. Conover, K. J. Ishii, M. Gursel, S. Takeshita, and D. M. Klinman Effect of Suppressive DNA on CpG-Induced Immune Activation J. Immunol., November 15, 2002; 169(10): 5590 - 5594. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Takami, N. Kim, J. Rho, and Y. Choi Stimulation by Toll-Like Receptors Inhibits Osteoclast Differentiation J. Immunol., August 1, 2002; 169(3): 1516 - 1523. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J Sibilia and F-X Limbach Reactive arthritis or chronic infectious arthritis? Ann Rheum Dis, July 1, 2002; 61(7): 580 - 587. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Riedl, D. Stober, C. Oehninger, K. Melber, J. Reimann, and R. Schirmbeck Priming Th1 Immunity to Viral Core Particles Is Facilitated by Trace Amounts of RNA Bound to Its Arginine-Rich Domain J. Immunol., May 15, 2002; 168(10): 4951 - 4959. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-K. Yi, J.-G. Yoon, S.-J. Yeo, S.-C. Hong, B. K. English, and A. M. Krieg Role of Mitogen-Activated Protein Kinases in CpG DNA-Mediated IL-10 and IL-12 Production: Central Role of Extracellular Signal-Regulated Kinase in the Negative Feedback Loop of the CpG DNA-Mediated Th1 Response J. Immunol., May 1, 2002; 168(9): 4711 - 4720. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T.-H. Chuang, J. Lee, L. Kline, J. C. Mathison, and R. J. Ulevitch Toll-like receptor 9 mediates CpG-DNA signaling J. Leukoc. Biol., March 1, 2002; 71(3): 538 - 544. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-K. Yi, J.-G. Yoon, S.-C. Hong, T. W. Redford, and A. M. Krieg Lipopolysaccharide and CpG DNA synergize for tumor necrosis factor-{alpha} production through activation of NF-{kappa}B Int. Immunol., November 1, 2001; 13(11): 1391 - 1404. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Takeshita, C. A. Leifer, I. Gursel, K. J. Ishii, S. Takeshita, M. Gursel, and D. M. Klinman Cutting Edge: Role of Toll-Like Receptor 9 in CpG DNA-Induced Activation of Human Cells J. Immunol., October 1, 2001; 167(7): 3555 - 3558. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Bosarge, J. M. Watt, D. O. McDaniel, E. Swiatlo, and L. S. McDaniel Genetic Immunization with the Region Encoding the {alpha}-Helical Domain of PspA Elicits Protective Immunity against Streptococcus pneumoniae Infect. Immun., September 1, 2001; 69(9): 5456 - 5463. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. H. Baek, S. J. Ha, and Y. C. Sung A Novel Function of Phosphorothioate Oligodeoxynucleotides as Chemoattractants for Primary Macrophages J. Immunol., September 1, 2001; 167(5): 2847 - 2854. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. E. Britigan, T. S. Lewis, M. Waldschmidt, M. L. McCormick, and A. M. Krieg Lactoferrin Binds CpG-Containing Oligonucleotides and Inhibits Their Immunostimulatory Effects on Human B Cells J. Immunol., September 1, 2001; 167(5): 2921 - 2928. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M Miyata, O Ito, H Kobayashi, T Sasajima, H Ohira, S Suzuki, and R Kasukawa CpG-DNA derived from sera in systemic lupus erythematosus enhances ICAM-1 expression on endothelial cells Ann Rheum Dis, July 1, 2001; 60(7): 685 - 689. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Suzuki, M. Yamaya, K. Sekizawa, M. Hosoda, N. Yamada, S. Ishizuka, K. Nakayama, M. Yanai, Y. Numazaki, and H. Sasaki Bafilomycin A1 inhibits rhinovirus infection in human airway epithelium: effects on endosome and ICAM-1 Am J Physiol Lung Cell Mol Physiol, June 1, 2001; 280(6): L1115 - L1127. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. J. Gao, Q. Xue, C. J. Papasian, and D. C. Morrison Bacterial DNA and Lipopolysaccharide Induce Synergistic Production of TNF-{{alpha}} Through a Post-Transcriptional Mechanism J. Immunol., June 1, 2001; 166(11): 6855 - 6860. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. D. Crabtree, L. Jin, D. P. Raymond, S. J. Pelletier, C. W. Houlgrave, T. G. Gleason, T. L. Pruett, and R. G. Sawyer Preexposure of Murine Macrophages to CpG Oligonucleotide Results in a Biphasic Tumor Necrosis Factor Alpha Response to Subsequent Lipopolysaccharide Challenge Infect. Immun., April 1, 2001; 69(4): 2123 - 2129. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. W. Lee, M. K. Song, K. H. Baek, Y. Park, J. K. Kim, C. H. Lee, H.-K. Cheong, C. Cheong, and Y. C. Sung Effects of a Hexameric Deoxyriboguanosine Run Conjugation into CpG Oligodeoxynucleotides on Their Immunostimulatory Potentials J. Immunol., October 1, 2000; 165(7): 3631 - 3639. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Hacker, R. M. Vabulas, O. Takeuchi, K. Hoshino, S. Akira, and H. Wagner Immune Cell Activation by Bacterial Cpg-DNA through Myeloid Differentiation Marker 88 and Tumor Necrosis Factor Receptor-Associated Factor (Traf)6 J. Exp. Med., August 21, 2000; 192(4): 595 - 600. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Liang, C. F. Reich, D. S. Pisetsky, and P. E. Lipsky The Role of Cell Surface Receptors in the Activation of Human B Cells by Phosphorothioate Oligonucleotides J. Immunol., August 1, 2000; 165(3): 1438 - 1445. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Hartmann, R. D. Weeratna, Z. K. Ballas, P. Payette, S. Blackwell, I. Suparto, W. L. Rasmussen, M. Waldschmidt, D. Sajuthi, R. H. Purcell, et al. Delineation of a CpG Phosphorothioate Oligodeoxynucleotide for Activating Primate Immune Responses In Vitro and In Vivo J. Immunol., February 1, 2000; 164(3): 1617 - 1624. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Hartmann and A. M. Krieg Mechanism and Function of a Newly Identified CpG DNA Motif in Human Primary B Cells J. Immunol., January 15, 2000; 164(2): 944 - 953. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. P. Sester, S. J. Beasley, M. J. Sweet, L. F. Fowles, S. L. Cronau, K. J. Stacey, and D. A. Hume Bacterial/CpG DNA Down-Modulates Colony Stimulating Factor-1 Receptor Surface Expression on Murine Bone Marrow-Derived Macrophages with Concomitant Growth Arrest and Factor-Independent Survival J. Immunol., December 15, 1999; 163(12): 6541 - 6550. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Manzel, L. Strekowski, F. M. D. Ismail, J. C. Smith, and D. E. Macfarlane Antagonism of Immunostimulatory CpG-Oligodeoxynucleotides by 4-Aminoquinolines and Other Weak Bases: Mechanistic Studies J. Pharmacol. Exp. Ther., December 1, 1999; 291(3): 1337 - 1347. [Abstract] [Full Text]
|
|
|
|
|
|
A.-K. Yi, D. W. Peckham, R. F. Ashman, and A. M. Krieg CpG DNA rescues B cells from apoptosis by activating NF{kappa}B and preventing mitochondrial membrane potential disruption via a chloroquine-sensitive pathway Int. Immunol., December 1, 1999; 11(12): 2015 - 2024. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. J. Gao, E. G. Zuvanich, Q. Xue, D. L. Horn, R. Silverstein, and D. C. Morrison Cutting Edge: Bacterial DNA and LPS Act in Synergy in Inducing Nitric Oxide Production in RAW 264.7 Macrophages J. Immunol., October 15, 1999; 163(8): 4095 - 4099. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Cowdery, N. J. Boerth, L. A. Norian, P. S. Myung, and G. A. Koretzky Differential Regulation of the IL-12 p40 Promoter and of p40 Secretion by CpG DNA and Lipopolysaccharide J. Immunol., June 1, 1999; 162(11): 6770 - 6775. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Oxenius, M. M. A. Martinic, H. Hengartner, and P. Klenerman CpG-Containing Oligonucleotides Are Efficient Adjuvants for Induction of Protective Antiviral Immune Responses with T-Cell Peptide Vaccines J. Virol., May 1, 1999; 73(5): 4120 - 4126. [Abstract] [Full Text]
|
|
|
|
|
|
D. Broide, J. Schwarze, H. Tighe, T. Gifford, M.-D. Nguyen, S. Malek, J. Van Uden, E. Martin-Orozco, E. W. Gelfand, and E. Raz Immunostimulatory DNA Sequences Inhibit IL-5, Eosinophilic Inflammation, and Airway Hyperresponsiveness in Mice J. Immunol., December 15, 1998; 161(12): 7054 - 7062. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-K. Yi and A. M. Krieg Cutting Edge: Rapid Induction of Mitogen-Activated Protein Kinases by Immune Stimulatory CpG DNA J. Immunol., November 1, 1998; 161(9): 4493 - 4497. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. W. Redford, A.-K. Yi, C. T. Ward, and A. M. Krieg Cyclosporin A Enhances IL-12 Production by CpG Motifs in Bacterial DNA and Synthetic Oligodeoxynucleotides J. Immunol., October 15, 1998; 161(8): 3930 - 3935. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Krieg, T. Wu, R. Weeratna, S. M. Efler, L. Love-Homan, L. Yang, A.-K. Yi, D. Short, and H. L. Davis Sequence motifs in adenoviral DNA block immune activation by stimulatory CpG motifs PNAS, October 13, 1998; 95(21): 12631 - 12636. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
