The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chan, O.
Right arrow Articles by J. Shlomchik, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chan, O.
Right arrow Articles by J. Shlomchik, M.
The Journal of Immunology, 1998, 160: 51-59.
Copyright © 1998 by The American Association of Immunologists

A New Role for B Cells in Systemic Autoimmunity: B Cells Promote Spontaneous T Cell Activation in MRL-lpr/lpr Mice1

Owen Chan* and Mark J. Shlomchik2,*,{dagger}

* Section of Immunobiology and {dagger} Department of Laboratory Medicine, Yale University School of Medicine, New Haven, CT 06520


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A conventional view of the pathogenesis of systemic lupus erythematosus has emerged. The role of B cells is to secrete pathogenic autoantibodies, while the role of T cells is to provide help for autoantibody-producing B cells. A problem with this view is that spontaneous T cell activation as well as T cell infiltration of organs such as kidney and skin are prominent features in systemic lupus erythematosus patients and murine models of lupus. The identification of T cell infiltrates, in particular, suggests that autoantibody-mediated damage may be only part of the story and that T cells could also play a primary role in immune-mediated pathology. To test the role of B cells directly, we previously generated autoimmune-prone MRL-lpr/lpr mice that lack B cells. The complete absence of T cell infiltrates in these mice was surprising, and it prompted us to examine whether a key role of B cells in disease evolution is to prime autoreactive T cells. Here we demonstrate, by comparing B cell-deficient and control mice, that the expansion of activated and memory T cells in the MRL-lpr/lpr mouse is indeed highly dependent on B cells. These results suggest a novel role for B cells in autoimmune disregulation.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Systemic lupus erythematosus (SLE)3 is typically thought of as an immune complex (IC)-mediated disease (1). In this view, the role of B cells is to produce autoantibody that in turn mediates tissue damage (2, 3). Autoantibody or IC deposition in the kidneys and skin is observed in human SLE patients and lupus-prone mouse strains (4, 5, 6, 7, 8, 9, 10). The passive transfer of monoclonal anti-DNA Abs and rheumatoid factors also can induce glomerulonephritis and skin vasculitis in normal mice (5, 11, 12, 13). However, in our view, the concept of SLE as solely an IC-mediated disease seems unlikely to explain all of lupus pathology. It fails to account directly for T cell infiltration of the kidney, skin, and other target organs, a striking characteristic of human SLE and murine lupus-like disease (9, 14, 15, 16, 17, 18, 19, 20, 21, 22).

We have considered a second major role for B cells in SLE immune disregulation, as APC for autoreactive T cells. B cells can under certain conditions activate memory T cells (23, 24, 25). Whether they can prime naive CD4+ T cells in vitro and in vivo remains controversial (26, 27, 28). Mamula, Janeway, and colleagues proposed that B cells could process and present self Ags to naive T cells (29, 30). They hypothesized that this, in turn, would lead to autoreactive T cell priming, and they have demonstrated this pathway in normal mice via direct immunization, including with lupus-related Ags (31). This work in normal mice provided a model suggesting that B cell Ag presentation could be an initiating event that induces autoimmunity in diseased animals. There has as yet been no evidence this pathway operates in spontaneous autoimmune disease. Regardless of whether B cells can prime naive T cells under experimental conditions that include the use of adjuvant, whether they do so in physiologic situations in vivo is questionable, since most workers have found good T cell priming after immunization of B cell-deficient mice (23, 32, 33, 34). Given the controversy over the role of B cells in T cell priming in normal mice, whether or not B cells actually play an important role in the activation of autoreactive T cells in spontaneous autoimmunity is uncertain.

In our study, we test the relevance of B cell APC function in a murine model of systemic autoimmune disease by assaying B cell-deficient MRL-lpr/lpr mice (35) for spontaneous T cell activation. Our results demonstrate that T cell activation is indeed markedly dependent on B cells, since populations of activated and memory T cells are greatly reduced in the B cell-deficient animals, compared with B cell-intact controls. Thus B cells, aside from their established pathogenetic role as autoantibody-secreting cells, play a key immunoregulatory role, most likely as APCs. These results influence our view of the mechanisms of spontaneous induction of autoreactive lymphocytes and could have important therapeutic implications.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Construction of B cell-deficient MRL-lpr/lpr mice

Mice bearing a targeted deletion in the JH locus (JH) were bred with MRL-lpr/lpr mice (35). Animals homozygous for the deletion (JH/JH) are unable to assemble Ig H-chain genes and are thus devoid of mature B cells (36). The resultant F1 JH/+ mice were backcrossed (BC) onto the MRL-lpr/lpr background, fixing lpr homozygosity after BC1. PCR was used to type for the lpr allele (see below). At each BC, JH/+ lpr/lpr animals were intercrossed to yield JH/JH lpr/lpr mice (one-fourth of the progeny), which were used in this study. Mice in this study ranged from F2 mice to BC10 mice (>99.9% MRL genes). No differences were observed between animals at different BC generations; thus, data from all are pooled in the figures and tables.

B cell-deficient (JH/JH) animals were identified by an anti-IgM ELISA and/or a PCR to detect the JH deletion. The deletion was detected via the combination of two PCRs. The Neo PCR detected the Neo insertion in the JH locus. The oligonucleotides used for this PCR were Neo5' (CCTTGCGCAGCTGTGCTCGACGTTG (5' primer)) and Neo3' (GCCGCATTGCATCAGCCATGATGGA (3' primer)). The JH PCR detected the wild-type JH locus. The oligonucleotides used for this PCR were JH5' (GGACCAGGGGGCTCAGGTCACTCAGG (5' primer)) and JH3' (GAGGAGACGGTGACCGTGGTCCCTGC (3' primer)). Amplification conditions were: 94°C for 2 min; 35 cycles of 30 s each at 94°C, 62°C, and 72°C; followed by a 7-min incubation at 72°C.

Homozygosity for lpr was detected by two PCRs. The oligonucleotides used for these PCRs were FAS-I2FOR (AGCATAGATTCCATTTGCT (5' primer)), FAS-Z8 (CAAATTTTATTGTTGCGACA (3' primer)), and FAS-I2BAK (AGTAATGGGCTCAGTGCA (3' primer)). Amplification conditions were: 94°C for 2 min; 35 cycles of 30 s each at 94°C, 58°C, and 72°C; followed by a 7-min incubation at 72°C.

Reagents and Abs

The following reagents were used: CD4 (H129.19-Quantum Red, Sigma Chemical Co., St. Louis, MO), CD8a (53-6.7-Quantum Red, Sigma Chemical Co.), CD44 (Pgp-1-FITC), CD45RB (C363.16A-PE, PharMingen, San Diego, CA), CD62L (Mel-14-biotin). Streptavidin-conjugated PE was added as a secondary step for the biotinylated reagents. Pgp-1, Mel-14, 145-2C11 (anti-CD3), and RA3-6B2 (anti-B220) were purified from hybridoma supernatants on protein G columns (Pharmacia, Piscataway, NJ) after ammonium sulfate precipitation and were conjugated as described (37). The Abs were verified by comparison to commercially available Abs with the same specificities.

Cell preparation and flow cytometry

This was performed essentially as described (37). Spleens and the inguinal LN were removed and disrupted in complete RPMI. Red blood cells were lysed in Tris-buffered ammonium chloride. Cells (1 x 106) were stained for 20 min with the primary Ab and for 15 min with a secondary Ab (where necessary) on ice. Cells were analyzed on a FACScalibur (Becton Dickinson Immunocytometry Systems, San Jose, CA).

Anti-CD3 proliferation assay

Splenocytes were isolated and pooled two to three mice sharing the same phenotype. Red blood cells were removed by treatment with Tris-buffered ammonium chloride. The resultant cells then underwent two rounds of purification via magnetic beads in a VarioMacs Column (Miltenyi Biotec, Auburn, CA) to obtain CD4+ cells. First, the cells were depleted of B220+ cells via negative selection with anti-B220 conjugated with biotin followed by MACS beads conjugated with streptavidin (Miltenyi Biotec, Auburn, CA). Then, the negative fraction underwent positive selection of CD4+ cells using MACS beads conjugated directly with anti-CD4 (Miltenyi Biotec). This protocol usually yielded a purification of >90% CD4+ cells.

The cells then were sorted via flow cytometry (FACStarPlus, Becton Dickinson Immunocytometry Systems) into naive (CD44low, CD62high) and memory subsets (CD44high, CD62low). Typical purities as determined by resorting were >97%. Cells from the individual subsets were then cultured in a 96-well plate (Falcon, Franklin Lakes, NJ) that had been coated overnight with various concentrations of anti-CD3 (145-2C11). PMA (Sigma Chemical Co.). was generally used at a final concentration of 25 ng/ml, and ionomycin (Sigma Chemical Co.) was used at 5 µM. The cells were incubated at 37°C in a humidified 5% CO2 environment. After 72 h, each well was pulsed with 1 µCi of [3H]TdR (ICN, Costa Mesa, CA). After 20 h, cells were harvested in a TomTec harvester (Wallac, Gaithersburg, MD) and TdR incorporation was measured in a Betaplate reader (Wallac).

Statistics

Values from all groups were compared by the nonparametric Mann-Whitney U statistic, using StatView 4.5 (Abacus Software, Berkeley, CA) for the Macintosh. A two-tailed p value of <0.05 was considered significant. Comparisons with p values of >0.05 but <0.1 are discussed as approaching significance.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Cell number and lymphoid organ weight

Splenomegaly and lymphadenopathy are characteristics of older MRL-lpr/lpr mice (7). This cell expansion is primarily composed of a TCR-{alpha}ß+, CD3+, CD4-, CD8-, B220+, CD2-, CD44+ subset of thymus-derived cells but also includes conventional CD4+ and CD8+ T cells (38, 39, 40). We previously reported that 6-mo-old B cell-deficient F2 MRL-lpr/lpr mice have fewer splenocytes and reduced lymphoid organ weight than their B-intact counterparts (35). In the current study using 4- to 8-mo-old F2 and up to BC10 mice, we confirm and extend our previous findings (Table IGo). Spleen and lymph nodes (LN) of B cell-deficient mice have fewer cells; similarly, in B cell-deficient MRL-lpr/lpr animals, the peripheral lymphoid organs are heavier than B-intact, nonhomozygous lpr mice (35). Thus, overall lymphoid organomegaly is highly B cell dependent. However, the magnitude of the differences (3- to 6-fold (Table IGo)) could not be accounted for simply by the absence of B cells per se, since they normally comprise less than one-half of the cells in LN and spleen and usually less than 20% in an MRL-lpr/lpr mouse (and see below).


View this table:
[in this window]
[in a new window]
  		Table I. Lymphoid organ weight and total cell numbers of B-intact and B-deficient MRL-lpr/lpr micea

 
B Cell role in spontaneous CD4+ T cell activation

By 15 wk of age, more than one-half of the CD4+ T cells in MRL-lpr/lpr mice are CD44high, a phenotype which suggests prior activation (41). To assess whether B cells play a role in the activation of T cells in spontaneous autoimmunity, we used this and other phenotypic markers to identify T cell differentiation state via flow cytometry. With the CD44 and CD62L cell surface markers, CD4 and CD8 T cells were identified phenotypically as being naive (CD44low, CD62high), activated (CD44high, CD62Lhigh), or memory (CD44high, CD62Llow) (42, 43, 44). Similarly, CD44 and CD45RB were used to identify naive (CD44low, CD45RBhigh) and memory (CD44high, CD45RBlow) activation states (42, 43, 45).

CD4+ cell percentages. At 4 to 5 mo of age, only a small percentage of CD4+ T cells in B-intact MRL-lpr/lpr mice had a naive phenotype in the spleen and LN, as assessed by CD44 and CD62L (Figs. 1Go and 2). Activated cells comprised the second largest group of CD4+ T cells, while the memory cells occupied the greatest fraction. These data are consistent with other reports on MRL-lpr/lpr mice. However, in the absence of B cells, naive cells comprised a markedly greater percentage of CD4+ T cells as compared with the B-intact animals (spleen: 5.5-fold increase, p < 0.003; LN: 3.9-fold increase, p < 0.0005). Reciprocally, in B-deficient animals, memory cells comprised a smaller fraction in both spleen (39% decrease, p < 0.0005) and LN (69% decrease, p < 0.0002). There was no statistical difference in the percentage of activated cells. The CD44 and CD45RB activation markers similarly demonstrate that the absence of B cells causes a dramatic increase in the fraction of naive T cells and a decrease in the fraction of memory T cells (data not shown).



View larger version (52K):
[in this window]
[in a new window]
  		FIGURE 1. FACS analysis of CD4+ T cells from B-intact and B-deficient MRL-lpr/lpr mice. Spleen and LN cells were analyzed via three-color FACS from B-intact and B-deficient mice. Gates were established on CD4positive cells, and these cells were analyzed for CD44 (FITC) and CD62L (PE) expression. Cells from B-intact mice are splenocytes (A) and LN cells (C). Cells from B-deficient mice are splenocytes (B) and LN cells (D).

 
CD4+ cell numbers. Cell counts revealed that the B-deficient lpr/lpr mice had fewer numbers of CD4+ memory T cells than their B-intact counterparts, as determined by CD44 and CD62L (spleen: 81% decrease, p < 0.005; LN: 82% decrease, p < 0.01) (Fig. 2Go, C and D). Thus, at 4 to 5 mo of age in MRL-lpr/lpr mice, the majority (>75%) of memory CD4+ T cells depend on the presence of B cells. Also, the B-deficient mice had fewer cells in the activated subset (spleen: 66% decrease, p < 0.03; LN: 40% decrease, p < 0.08), where statistical significance is approached for the LN. However, the number of naive cells in the B-deficient mice was statistically indistinguishable from that of B-intact mice.



View larger version (47K):
[in this window]
[in a new window]
  		FIGURE 2. CD4+ T cell percentages and cell numbers. Cell percentages (A and B) were obtained via FACS analysis for the naive (CD44low, CD62high), activated (CD44high, CD62Lhigh), and memory (CD44high, CD62Llow) subsets as shown in Figure 1Go. Cell numbers (C and D) were obtained by multiplying total cell percentages of each activation subset by the total organ cell number for each mouse. Columns show the average of percentages (A and B) or cell numbers (C and D) from a cohort of mice. Error bars represent 1 SD. Data on splenocytes are indicated in A and C, while LN cells are indicated in B and D. Note the different scales of the y-axis in C and D. Sample sizes: B-intact, 4-to 5-mo-old mice (n = 15); B-intact, 6- to 8-mo-old mice (n = 23); B-deficient, 4- to 5-mo-old mice (n = 7); B-deficient, 6- to 8-mo-old mice (n = 4).

 
Both the percentage and number of memory cells CD4+ T cells are greater in B-intact mice than in B-deficient mice. The number of activated cells is also greater in B-intact mice, although B-intact and B-deficient animals do not differ statistically in the percentage of activated cells. Conversely, the percentage of naive cells is less in B-intact mice, although the total naive cell population number is similar. The different patterns observed with cell number vs cell percentage (especially in the naive subset) can be attributed to the differing total lymphoid organ cell counts between the two mouse phenotypes (Table IGo). The significance of these patterns will be discussed below.

B cell role in spontaneous CD8+ T cell activation

To assess whether other cell populations were affected by the absence of B cells, CD8+ T cell activation state was determined using the CD44 and CD62L markers. (A preliminary analysis of CD8 cells from a smaller cohort of mice has recently been reported as part of a review (46).) Analysis of this T cell population demonstrated trends similar to those of the CD4+ T cells. At 4 to 5 mo, in the absence of B cells, there was a decrease in the percentage of activated (spleen: 67% decrease, p < 0.05; LN: 70%, p < 0.05) and memory (spleen: 45% decrease, p < 0.01; LN: 40%, p < 0.04) cells (Fig. 3Go, A and B). There was no statistically significant difference in the percentage of naive cells.



View larger version (47K):
[in this window]
[in a new window]
  		FIGURE 3. CD8+ T cell percentages and cell numbers. Cell percentages (A and B) were obtained via FACS analysis for the naive (CD44low, CD62high), activated (CD44high, CD62Lhigh), and memory (CD44high, CD62Llow) subsets. Cell numbers (C and D) were obtained by multiplying total cell percentages of each activation subset by the total organ cell number for each mouse. Columns show the average of percentages (A and B) or cell numbers (C and D) from a cohort of mice. Error bars represent 1 SD. Data on splenocytes are indicated in A and C, while LN cells are indicated in B and D. Note the different scales of the y-axis in C and D. Sample sizes: B-intact, 4- to 5-mo-old mice, spleen (n = 10); B-intact, 4- to 5-mo-old mice, LN (n = 7); B-intact, 6- to 8-mo-old mice, spleen (n = 21); B-intact, 6- to 8-mo-old mice, LN (n = 20); B-deficient, 4- to 5-mo-old mice, spleen (n = 4); B-deficient, 4- to 5-mo-old mice, LN (n = 2); B-deficient, 6- to 8-mo-old mice, spleen (n = 4); B-deficient, 6- to 8-mo-old mice, LN (n = 3).

 
The number of naive CD8+ T cells remained similar in the absence of B cells (Fig. 3Go, C and D). However, there was a decrease in the number of activated (spleen: 76% decrease, p < 0.05; LN: 96% decrease, p < 0.04) and memory (spleen: 77% decrease, p < 0.07; LN: 89% decrease, p < 0.08) cells, where statistical significance is approached for the memory subset of the spleen and LN. Thus, the results for CD8+ T cells mirrored that of CD4+ T cells.

Age comparison of spontaneous T cell activation

Lymphoaccumulation of CD44high, CD4+ T cells in MRL-lpr/lpr mice increases with age (Ref. 41; unpublished observations). To determine whether this progression was B cell dependent, we analyzed older cohorts (6–8 mo), in addition to the 4- to 5-mo-old cohorts. Here, we compared lymphoid organ weights and, in particular, cell numbers between the young and old cohorts with the same genotype. In B cell-intact MRL-lpr/lpr mice, there was an age-dependent increase in peripheral lymphoid organ weight (spleen: 1.4-fold increase; LN: 1.6-fold increase) (Table IGo). Organ weight in B-deficient mice also increased but to a lesser degree (spleen: 1.2-fold increase; LN: 1.3-fold increase). Although, there were trends to increased weight in spleen and LN in both groups, this difference did not reach statistical significance in any one group, probably due to the inherent mouse-to-mouse variation in lpr/lpr mice.

However, there was a statistically significant increase in memory CD4+ T cell numbers with age in the spleens of B-intact mice (1.9-fold increase, p < 0.03) (Fig. 2GoC). This was not the case for B-deficient mice, in which numbers of splenic memory cells remained stable, showing that the continued accumulation of memory T cells in the spleen is B cell dependent. The change in memory CD4+ T cell number was attributable to the overall increased total splenic cell number and the increase in the percentage of memory cells (1.1-fold increase, p < 0.006).

Memory CD4+ T cells did not continue to expand in the LN after 4 to 5 mo of age. The reasons for this are not clear, but it is possible that the LN at 4 to 5 mo are not structurally capable of encompassing more cells. Consistent with this idea, there was no significant change in LN average weight between the 4- to 5-mo cohort and the 6- to 8-mo cohort of B-intact mice (Table IGo). Differences in homing patterns of CD62L-negative cells may also contribute to the difference between spleen and LN in this regard (47, 48).

Role of B cells in spontaneous T cell activation is specific to autoimmune mice

To ensure that the above-described phenomenon was related to autoimmunity in MRL-lpr/lpr mice, 33-wk-old B-deficient and B-intact mice with a BALB/c background (>BC10 to BALB/c) were investigated by flow cytometry using the same methods. As shown in Figure 4Go, there were no significant differences in the percentages of T cells in each of the compartments between B-deficient and B-intact mice. This is in marked contrast to percentages in even younger MRL-lpr/lpr mice (Figs. 1Go and 2Go). As expected, there were much higher percentages of naive T cells in the BALB/c mice compared with MRL-lpr/lpr (compare with Figs. 1Go and 2Go). Similar data were obtained for CD4+ cells in spleen and CD8+ cells in both spleen and LN. A similar analysis was conducted for 4-mo-old MRL-+/+ mice, an age at which there is little apparent autoimmune disease (our unpublished observation), again with the finding that B cells had no discernible impact on the percentage of naive, activated, or memory T cells (data not shown). Whether the effect of B cells requires the lpr mutation will be determined when we have the opportunity to analyze much older MRL-+/+ mice that do have evident systemic autoimmune disease.



View larger version (51K):
[in this window]
[in a new window]
  		FIGURE 4. FACS analysis of CD4+ T cells from LN of B-intact and B-deficient BALB/c mice. LN cells from B-intact and B-deficient mice were analyzed by three-color FACS. Analysis and gating were performed as in Figure 1Go and Materials and Methods. Two mice of each type are shown, as indicated. Numbers in quadrants are percentages of CD4+ T cells. Note that mice are similar regardless of B cell phenotype.

 
T cell functional analysis

To corroborate the activation state of the cells as identified by their cell surface markers, a functional assay was conducted on the naive (CD44low, CD62high) and memory (CD44high, CD62Llow) CD4+ subsets. Here, we prepared highly purified naive and memory cells from B-intact and B-deficient MRL-lpr/lpr mice and observed their proliferative response to anti-CD3 stimulation. This assay has been used by others to distinguish functionally naive and memory CD4+ T cells (45, 49). In particular, memory cells have a lower threshold response than naive cells to an isolated anti-CD3 proliferative stimulus in the absence of APCs. Results from two experiments are shown in Figure 5Go. Two other experiments gave similar results. In both the B-intact and B-deficient mice, the memory cells proliferated to anti-CD3, even at the low end of the concentration range. In comparison, the naive cells either did not proliferate or proliferated much less at every dose of anti-CD3. These results suggest that phenotypically naive and memory CD4+ T cells in MRL-lpr/lpr mice behave like their counterparts isolated from normal, nonautoimmune mice. This corroborates the surface markers in the FACS analysis as valid indicators of naive and memory T cells.



View larger version (52K):
[in this window]
[in a new window]
  		FIGURE 5. Functional analysis of naive and memory CD4+ T cells. Cells were pooled from two B-intact or B-deficient mice and purified as described in the Materials and Methods. Two representative experiments are shown here. Results are the averages of individual culture wells. Error bars represent 1 SD. Cells from B-intact mice are indicated in A and B. Cells from B-deficient mice are indicated in C and D. PMA/ionomycin treatment served as a positive control for the induction of proliferation. There was no proliferation in the positive control of the experiment in D. The cells were still viable at the setup and end of the sort, as indicated by trypan blue exclusion and microscopic observation. Furthermore, there was proliferation in the memory subset to anti-CD3 while the PMA/ionomycin wells did not indicate any (D), demonstrating that the cells were capable of proliferation. As indicated in A, PMA/ionomycin was not always reliable in inducing proliferation, even in cells known to be capable of proliferation.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
We find that B cells have a major role in the spontaneous activation of T cells in MRL-lpr/lpr mice; in the absence of B cells, the numbers of both activated and memory phenotype T cells were markedly reduced. The work provides in vivo evidence for the hypothesis that B cells are critical for systemic autoimmune disregulation via a direct effect on T cells. Moreover, it begins to define the mechanism by which B cell deficiency completely blocks autoimmune pathology (35), including the infiltration of T cells. This effect on T cell activation is in turn most likely mediated through Ag presentation, although other mechanisms may contribute (see below).

The dependence of activated and memory T cells on B cells is profound; at 6 mo of age, >75% of extant memory CD4 and CD8 T cells in MRL-lpr/lpr mice are B cell dependent by comparison with B-deficient mice. Nevertheless, the absence of B cells does not completely abrogate activated/memory T cells. Other APC, such as dendritic cells or macrophages, may be responsible for initially activating these T cells, whereas B cells are responsible for their subsequent amplification. There is controversy over whether, in normal immunization situations, B cells can prime naive T cells (23, 24), although it seems most likely that this can occur with modest efficiency under some circumstances (27). Whether in spontaneous autoimmunity, activated autoreactive B cells can activate naive T cells is unknown. Thus, at present we favor the idea that B cells principally amplify previously activated T cells, maintaining them in an activated, proliferating state. This would fit with the observation that there are similar total numbers of naive T cells in B-intact and B-deficient mice, yet higher numbers of activated T cells in B-intact mice. The effect of B cells on memory T cells probably occurs through the increased supply of activated precursors. However, since B cells may be required for the maintenance of CD4 memory T cells (R. Ahmed, personal communication), we cannot rule out an effect of B cells on maintenance of memory CD4 T cells. Since B cells are not required to maintain CD8 memory T cells (50, 51), the accumulation of memory CD8 cells is most likely due to B cells promoting entry into the memory compartment. The amplification role of B cells is further suggested by the progressive, age-dependent lymphoaccumulation and increase in memory T cells seen only in the presence of B cells (Figs. 2Go and 3Go). The fractions of residual memory and activated T cells present in B-deficient MRL-lpr/lpr mice are comparable with age-matched non-lpr controls such as BALB/c (Fig. 4Go), MRL-+/+, and C3H/J (our unpublished observations), suggesting that such residual T cells could be accounted for by normal immune system function and maturation, which may be less B cell dependent.

The pivotal role of B cells in T cell expansion likely stems from the ability of B cells to present cognate Ags with remarkable efficiency (52, 53, 54, 55). In mice and humans with systemic autoimmune disease, spontaneously activated B cells are highly enriched for autoreactive specificities (56, 57, 58, 59). Thus, in established autoimmunity, this pool of B cells likely represents a potent reservoir of APCs for activating autoreactive T cells. This view is certainly consistent with our observed dependence of the vast majority of activated T cells on B cells. If this is indeed the mechanism, our finding that CD8 memory and activated T cells are also dependent on B cells suggests that B cells are a major APC for spontaneous class I-restricted autoimmune responses. Reconstitution of B-deficient MRL-lpr/lpr mice with various types of B cells should test these ideas further. Although we favor the role of B cells as APC, it remains possible that the effect of B cells on T cells in this model could be mediated through Abs (60) or even B cell-derived cytokines (61, 62, 63). We doubt that Abs alone could account for T cell priming in our model, since we have not observed any effect on T cell priming after high dose and prolonged reconstitution of polyclonal serum autoantibody in B-less MRL-lpr/lpr mice (our unpublished observation).

Regardless of the mechanism(s) by which B cells promote the spontaneous activation and expansion of T cells in systemic autoimmunity, an implication of this phenomenon is that B cells would be an ideal target for lupus therapy. It would not be sufficient to target autoantibodies alone; in fact, this strategy as executed by plasmapheresis does not work (64). Elimination of previously activated B cells would have the dual effect of ameliorating autoantibodies and of eliminating the reservoir of potent APC for autoreactive T cells. This, in turn, is predicted to delay the progression of disease. It may further be necessary to eliminate activated T cells as well, since they may rely on MHC class II-expressing parenchymal cells for continued Ag presentation when causing damage in tissues. In fact, there is very little in the way of disease-modifying therapy available for systemic autoimmune diseases. A recently described treatment approach that does target autoantibodies and B cells (and probably T cells) is the combination of plasmapheresis and cyclophosphamide (65). Preliminary results suggest that this is indeed a disease-modifying therapy. We speculate that at the heart of the efficacy of this therapy is elimination of autoreactive B cells and their APC function.

Although the current work has demonstrated the inhibition of spontaneous T cell activation in B-deficient mice, the results do not directly prove that this population of T cells is indeed autoreactive. In fact, direct demonstration of autoreactive T cells in systemic autoimmunity has been difficult and is limited to a few notable reports (66, 67, 68, 69, 70, 71, 72). The Ag specificity of T cells probably does play a role, since a TCR transgene that restricts specificity leads to a decreased accumulation of memory T cells in MRL-lpr/lpr mice (73). If self-reactive T cells do exist and play a role in pathogenesis, it is reasonable to assume that they would have the activated/memory phenotype, since effector function is generally associated with activated T cells (49, 74). We would further predict that cell for cell, the activated/memory subpopulations in B-sufficient mice will be enriched for autoreactive specificities. Once generated, such autoreactive T cells could promote autoantibody production in B cells as well as attack target organs (i.e., kidney and skin infiltration). In concert with this view, there is no lymphocytic infiltration in the kidneys (35) and skin (O. Chan, J. McNiff, and M. J. Shlomchik, manuscript in preparation) of MRL-lpr/lpr mice lacking B cells.

A possible role of the Faslpr defect in this context is to cause the retention of primed autoreactive lpr/lpr T cells which would otherwise undergo Fas-mediated death in the periphery (75, 76). However, such accumulating T cells mainly have the aberrant, DN phenotype (CD4-/CD8-/B220+), whereas the cells we enumerated are SP CD4+ and CD8+, most of which are also B220- (our unpublished observation). Thus, the Fas deficiency in the T cell may not alone account for the expansion of SP, phenotypically normal T cells. Because the Fas defect must also be present in B cells themselves, at least to promote autoantibody production (77, 78), a similar failure to eliminate postactivated, autoreactive B cells would lead to an increased pool of B cells capable of activating T cells. These in turn may, as discussed, be potent activators of T cells. Since MRL-+/+ mice are autoimmune prone (79, 80), we suspect that the lpr defect is merely amplifying the autoreactive cell accumulation that takes place at lower levels in Fas-sufficient autoimmune-prone mice. Additional experiments will clarify this point.

Overall, our results prompt a reevaluation of the idea that systemic autoimmune disease is strictly the result of IC-mediated pathogenesis, as recently discussed by Kotzin (1). It further expands the potential functional role of B cells in pathogenesis from Ab-forming cell to APC. This in turn should prompt a reevaluation of the B cell as a therapeutic target in the treatment of systemic autoimmune diseases. This may not apply only to systemic autoimmune diseases, since it was recently shown that B cells are required for the expression of diabetes in the NOD mouse model (81).

Because our genetically based B cell-deficient model is amenable to cell/antibody reconstitution, we hope to use it to evaluate a number of questions raised by the current studies. These include the role of direct B cell APC function vs autoantibody secretion in T cell stimulation, the putative autoreactive specificity and effector functions of B cell-dependent memory T cells, the importance of autoantigen specificity and Fas deficiency of B cells in this role, and the effectiveness of targeting B cells in halting the progress of systemic autoimmune disease.


   Acknowledgments
 
We thank C. Janeway, M. Mamula, A. Haberman, and J. Craft for critical reading of the manuscript. We thank T. Taylor for help in cell sorting.


   Footnotes
 
1 This work was supported by Grant AR44077 from the National Institutes of Health to M.J.S. O.C. was supported by Training Grant AI070019 from the National Institutes of Health to Yale University (C. Janeway). Back

2 Address correspondence and reprint requests to Dr. Mark J. Shlomchik, Laboratory Medicine, Yale University School of Medicine, 333 Cedar Street, Box 208035, New Haven, CT 06526-8035. Back

3 Abbreviations used in this paper: SLE, systemic lupus erythematosus; BC, backcross; PE, phycoerythrin; LN, lymph node(s). Back

Received for publication June 23, 1997. Accepted for publication September 16, 1997.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kotzin, B.. 1996. Systemic lupus erythematosus. Cell 85:303.[Medline]
  2. Lefkowith, J. B., G. S. Gilkeson. 1996. Nephritogenic autoantibodies in lupus. Arthritis Rheum. 39:894.[Medline]
  3. Foster, M. H., J. Sabbaga, S. R. Line, K. S. Thompson, K. J. Barrett, M. P. Madaio. 1993. Molecular analysis of spontaneous nephrotropic anti-laminin antibodies in an autoimmune MRL-lpr/lpr mouse. J. Immunol. 151:814.[Abstract]
  4. Belmont, H. M., S. B. Abramson, J. T. Lie. 1996. Pathology and pathogenesis of vascular injury in systemic lupus erythematosus. Arthritis Rheum. 39:9.[Medline]
  5. Vlahakos, D. V., M. H. Foster, S. Adams, M. Katz, A. A. Ucci, K. J. Barrett, S. K. Datta, M. P. Madaio. 1992. Anti-DNA antibodies form immune deposits at distinct glomerular and vascular sites. Kidney Int. 41:1690.[Medline]
  6. Jonsson, R., C. Svalander, G. Nyberg. 1986. Immune deposits in oral mucosa, skin and kidney in patients with systemic lupus erythematosus. Clin. Exp. Rheumatol. 4:231.[Medline]
  7. Theofilopoulos, A. N., F. J. Dixon. 1985. Murine models of systemic lupus erythematosus. Adv. Immunol. 37:269.[Medline]
  8. Dang, H., R. J. Harbeck. 1984. The in vivo and in vitro glomerular deposition of isolated anti-double-stranded-DNA antibodies in NZB/W mice. Clin. Immunol. Immunopathol. 30:265.[Medline]
  9. Furukawa, F., H. Tanaka, K. Sekita, T. Nakamura, Y. Horiguchi, Y. Hamashima. 1984. Dermatopathological studies on skin lesions of MRL mice. Arch. Dermatol. Res. 276:186.[Medline]
  10. Harrist, T. J., M. C. J. Mihm. 1980. The specificity and clinical usefulness of the lupus band test. Arthritis Rheum. 23:479.[Medline]
  11. Fulpius, T., F. Spertini, L. Reininger, S. Izui. 1993. Immunoglobulin heavy chain constant region determines the pathogenicity and the antigen-binding activity of rheumatoid factor. Proc. Natl. Acad. Sci. USA 90:2345.[Abstract/Free Full Text]
  12. Berney, T., T. Fulpius, T. Shibata, L. Reininger, J. Van Snick, H. Shan, M. Weigert, A. Marshak-Rothstein, S. Izui. 1992. Selective pathogenicity of murine rheumatoid factors of the cryoprecipitable IgG3 subclass. Int. Immunol. 4:93.[Abstract/Free Full Text]
  13. Berney, T., T. Shibata, S. Izui. 1991. Murine cryoglobulinemia: pathogenic and protective IgG3 self-associating antibodies. J. Immunol. 147:3331.[Abstract]
  14. Kuo, T. T., S. K. Lo, H. L. Chan. 1994. Immunohistochemical analysis of dermal mononuclear cell infiltrates in cutaneous lupus erythematosus, polymorphous light eruption, lymphocytic infiltration of Jessner, and cutaneous lymphoid hyperplasia: a comparative differential study. J. Cutan. Pathol. 21:430.[Medline]
  15. David-Bajar, K., S. D. Bennion, J. D. DeSpain, L. E. Golitz, L. A. Lee. 1992. Clinical, histologic, and immunofluorescent distinctions between subacute cutaneous lupus erythematosus and discoid lupus erythematosus. J. Invest. Dermatol. 99:251.[Medline]
  16. Gallo, C. D., A. M. Jevnikar, D. C. Brennan, S. Florquin, S. A. Pacheco, V. R. Kelley. 1992. Autoreactive kidney-infiltrating T-cell clones in murine lupus nephritis. Kidney Int. 42:851.[Medline]
  17. Alexopoulos, E., D. Seron, R. B. Hartley, J. S. Cameron. 1990. Lupus nephritis: correlation of interstitial cells with glomerular function. Kidney Int. 37:100.[Medline]
  18. Markey, A. C., M. H. Allen, C. Pitzalis, D. M. MacDonald. 1990. T-cell inducer populations in cutaneous inflammation: a predominance of T helper-inducer lymphocytes (THi) in the infiltrate of inflammatory dermatoses. Br. J. Dermatol. 122:325.[Medline]
  19. Sanchez, R., R. Jonsson, A. Tarkowski. 1988. Phenotypes of immunocompetent cells and Ia antigen expression in oral mucosa and skin of autoimmune mouse strains. Autoimmunity 1:243.[Medline]
  20. Tarkowski, A., R. Jonsson, R. Sanchez, L. Klareskog, W. J. Koopman. 1988. Features of renal vasculitis in autoimmune MRL lpr/lpr mice: phenotypes and functional properties of infiltrating cells. Clin. Exp. Immunol. 72:91.[Medline]
  21. Jabs, D. A., R. A. Prendergast. 1987. Reactive lymphocytes in lacrimal gland and vasculitic renal lesions of autoimmune MRL/lpr mice express L3T4. J. Exp. Med. 166:1198.[Abstract/Free Full Text]
  22. Moyer, C. F., J. D. Strandberg, C. L. Reinisch. 1987. Systemic mononuclear-cell vasculitis in MRL/Mp-lpr/lpr mice. A histologic and immunocytochemical analysis. Am. J. Pathol. 127:229.[Abstract]
  23. Ronchese, F., B. Hausmann. 1993. B lymphocytes in vivo fail to prime naive T cells but can stimulate antigen-experienced T lymphocytes. J. Exp. Med. 177:679.[Abstract/Free Full Text]
  24. Fuchs, E. J., P. Matzinger. 1992. B cells turn off virgin but not memory T cells. Science 258:1156.[Abstract/Free Full Text]
  25. Chesnut, R. W., H. M. Grey. 1981. Studies on the capacity of B cells to serve as antigen-presenting cells. J. Immunol. 126:1075.[Medline]
  26. Constant, S., N. Schweitzer, J. West, P. Ranney, K. Bottomly. 1995. B lymphocytes can be competent antigen-presenting cells for priming CD4+ T cells to protein antigens in vivo. J. Immunol. 155:3734.[Abstract]
  27. Cassell, D. J., R. H. Schwartz. 1994. A quantitative analysis of antigen-presenting cell function: activated B cells stimulate naive CD4 T cells but are inferior to dendritic cells in providing costimulation. J. Exp. Med. 180:1829.[Abstract/Free Full Text]
  28. Eynon, E. E., D. C. Parker. 1992. Small B cells as antigen-presenting cells in the induction of tolerance to soluble protein antigens. J. Exp. Med. 175:131.[Abstract/Free Full Text]
  29. Mamula, M. J., R.-H. Lin, Jr C. A. Janeway, J. A. Hardin. 1992. Breaking T cell tolerance with foreign and self co-immunogens: a study of autoimmune B and T cell epitopes of cytochrome c. J. Immunol. 149:789.[Abstract]
  30. Lin, R.-H., M. J. Mamula, J. A. Hardin, Jr C. A. Janeway. 1991. Induction of autoreactive B cells allows priming of autoreactive T cells. J. Exp. Med. 173:1433.[Abstract/Free Full Text]
  31. Mamula, M., S. Fatenejad, J. Craft. 1994. B cells process and present lupus autoantigens that initiate autoimmune T cell responses. J. Immunol. 152:1453.[Abstract]
  32. Vella, A. J., M. T. Scherer, L. Shultz, J. W. Kappler, P. Marrack. 1996. B cells are not essential for peripheral T-cell tolerance. Proc. Natl. Acad. Sci. USA 93:951.[Abstract/Free Full Text]
  33. Epstein, M. M., R. F. Di, D. Jankovic, A. Sher, P. Matzinger. 1995. Successful T cell priming in B cell-deficient mice. J. Exp. Med. 182:915.[Abstract/Free Full Text]
  34. Ronchese, F., B. Hausmann, G. G. Le. 1994. Interferon-gamma- and interleukin-4-producing T cells can be primed on dendritic cells in vivo and do not require the presence of B cells. Eur. J. Immunol. 24:1148.[Medline]
  35. Shlomchik, M. J., M. P. Madaio, D. Ni, M. Trounstine, D. Huszar. 1994. The role of B cells in lpr/lpr-induced autoimmunity. J. Exp. Med. 180:1295.[Abstract/Free Full Text]
  36. Chen, J., M. Trounstine, F. W. Alt, F. Young, C. Kurahara, J. F. Loring, D. Huszar. 1993. Immunoglobulin gene rearrangement in B cell deficient mice generated by targeted deletion of the JH locus. Int. Immunol. 5:647.[Abstract/Free Full Text]
  37. Shlomchik, M. J., D. Zharhary, S. Camper, T. Saunders, M. Weigert. 1993. A rheumatoid factor transgenic mouse model of autoantibody regulation. Int. Immunol. 5:1329.[Abstract/Free Full Text]
  38. Rozzo, S. J., R. A. Eisenberg, P. L. Cohen, B. L. Kotzin. 1994. Development of the T cell receptor repertoire in lpr mice. Semin. Immunol. 6:19.[Medline]
  39. Shirai, T., M. Abe, H. Yagita, K. Okumura, H. C. Morse, W. F. Davidson. 1990. The expanded populations of CD4-CD8- T cell receptor {alpha}/ß+ T cells associated with the lpr and gld mutations are CD2-. J. Immunol. 144:3756.[Abstract]
  40. Morse, H. C., W. F. III, R. A. Davidson, E. D. Yetter, J. B. Roths Murphy, R. L. Coffman. 1982. Abnormalities induced by the mutant gene lpr: expansion of a unique lymphocyte subset. J. Immunol. 129:2612.[Abstract]
  41. Giese, T., W. F. Davidson. 1992. Evidence for early onset, polyclonal activation of T cell subsets in mice homozygous for lpr. J. Immunol. 149:3097.[Abstract]
  42. Tough, D. F., J. Sprent. 1994. Turnover of naive- and memory-phenotype T cells. J. Exp. Med. 179:1127.[Abstract/Free Full Text]
  43. Bradley, L. M., M. Croft, S. L. Swain. 1993. T-cell memory: new perspectives. Immunol. Today 14:197.[Medline]
  44. Budd, R. C., J. C. Cerottini, C. Horvath, C. Bron, T. Pedrazzini, R. C. Howe, H. R. MacDonald. 1987. Distinction of virgin and memory T lymphocytes: stable acquisition of the Pgp-1 glycoprotein concomitant with antigenic stimulation. J. Immunol. 138:3120.[Abstract]
  45. Luqman, M., K. Bottomly. 1992. Activation requirements for CD4+ T cells differing in CD45R expression. J. Immunol. 149:2300.[Abstract]
  46. Chan, O., M. P. Madaio, M. J. Shlomchik. 1997. The roles of B cells in MRL/lpr murine lupus. N. Chiorazzi, and R. G. Lahita, and K. Pavelka, and M. Ferrarini, eds. In B Lymphocytes and Autoimmunity Vol. 815:75. New York Academy of Sciences, New York.
  47. Bradley, L. M., S. R. Watson, S. L. Swain. 1994. Entry of naive CD4 T cells into peripheral lymph nodes requires L-selectin. J. Exp. Med. 180:2401.[Abstract/Free Full Text]
  48. Bradley, L. M., G. G. Atkins, S. L. Swain. 1992. Long-term CD4+ memory T cells from the spleen lack MEL-14, the lymph node homing receptor. J. Immunol. 148:324.[Abstract]
  49. Croft, M., S. L. Swain. 1991. B cell response to fresh and effector T helper cells: role of cognate T-B interaction and the cytokines IL-2, IL-4, and IL-6. J. Immunol. 146:4055.[Abstract]
  50. Di Rosa, F., P. Matzinger. 1996. Long-lasting CD8 T cell memory in the absence of CD4 T cells or B cells. J. Exp. Med. 183:2153.[Abstract/Free Full Text]
  51. Asano, M. S., R. Ahmed. 1996. CD8 T cell memory in B cell-deficient mice. J. Exp. Med. 183:2165.[Abstract/Free Full Text]
  52. Lanzavecchia, A.. 1985. Antigen-specific interactions between T and B cells. Nature 314:537.[Medline]
  53. Roosnek, E., A. Lanzavecchia. 1991. Efficient and selective presentation of antigen-antibody complexes by rheumatoid factor B cells. J. Exp. Med. 173:487.[Abstract/Free Full Text]
  54. Lichtman, A. H., H.-P. Tony, D. C. Parker, A. K. Abbas. 1987. Antigen presentation by hapten-specific B lymphocytes. J. Immunol. 138:2822.[Abstract]
  55. Tony, H.-P., N. E. Phillips, D. C. Parker. 1985. Role of membrane immunoglobulin (Ig) crosslinking in membrane Ig-mediated, major histocompatibility-restricted T cell-B cell cooperation. J. Exp. Med. 162:1695.[Abstract/Free Full Text]
  56. Shan, H., M. J. Shlomchik, A. Marshak-Rothstein, D. S. Pisetsky, S. Litwin, M. G. Weigert. 1994. The mechanism of autoantibody production in an autoimmune MRL/lpr mouse. J. Immunol. 153:5104.[Abstract]
  57. Shlomchik, M. J., A. Marshak-Rothstein, C. B. Wolfowicz, T. L. Rothstein, M. G. Weigert. 1987. The role of clonal selection and somatic mutation in autoimmunity. Nature 328:805.[Medline]
  58. Shlomchik, M. J., M. A. Mascelli, H. Shan, M. Z. Radic, D. Pisetsky, A. Marshak-Rothstein, M. Weigert. 1990. Anti-DNA antibodies from autoimmune mice arise by clonal expansion and somatic mutation. J. Exp. Med. 171:265.[Abstract/Free Full Text]
  59. Randen, I., D. Brown, K. M. Thompson, N. Hughes-Jones, V. Pascual, K. Victor, J. D. Capra, O. Forre, J. B. Natvig. 1992. Clonally related IgM rheumatoid factors undergo affinity maturation in the rheumatoid synovial tissue. J. Immunol. 148:3296.[Abstract]
  60. Sallusto, F., A. Lanzavecchia. 1994. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha. J. Exp. Med. 179:1109.[Abstract/Free Full Text]
  61. Llorente, L., Y. Richaud-Patin, R. Fior, J. Alcocer-Varela, J. Wijdenes, B. M. Fourrier, P. Galanaud, D. Emilie. 1994. In vivo production of interleukin-10 by non-T cells in rheumatoid arthritis, Sjogren’s syndrome, and systemic lupus erythematosus: a potential mechanism of B lymphocyte hyperactivity and autoimmunity. Arthritis Rheum. 37:1647.[Medline]
  62. O’Garra, A., M. Howard. 1992. IL-10 production by CD5 B cells. Ann. NY Acad. Sci. 651:182.[Medline]
  63. Burdin, N., C. Van Kooten, L. Galibert, J. S. Abrams, J. Wijdenes, J. Banchereau, F. Rousset. 1995. Endogenous IL-6 and IL-10 contribute to the differentiation of CD40-activated human B lymphocytes. J. Immunol. 154:2533.[Abstract]
  64. Lewis, E. J., L. G. Hunsicker, S. P. Lan, R. B. Rohde, J. M. Lachin. 1992. A controlled trial of plasmapheresis therapy in severe lupus nephritis. N. Engl. J. Med. 326:1374.
  65. Euler, H. H., J. O. Schroeder, P. Harten, R. A. Zeuner, H. J. Gutschmidt. 1994. Treatment-free remission in severe systemic lupus erythematosus following synchronization of plasmapheresis with subsequent pulse cyclophosphamide. Arthritis Rheum. 37:1784.[Medline]
  66. Sainis, K., S. K. Datta. 1988. CD4+ T cell lines with selective patterns of autoreactivity as well as CD4- CD8- T helper cell lines augment the production of idiotypes shared by pathogenic anti-DNA autoantibodies in the NZB x SWR model of lupus nephritis. J. Immunol. 140:2215.[Abstract]
  67. Adams, S., T. Zordan, K. Sainis, S. K. Datta. 1990. T cell receptor Vß genes expressed by IgG anti-DNA autoantibody-inducing T cells in lupus nephritis: forbidden receptors and double negative T cells. Eur. J. Immunol. 20:1435.[Medline]
  68. Mohan, C., S. Adams, V. Stanik, S. Datta. 1993. Nucleosome: a major immunogen for pathogenic autoantibody-inducing T cells of lupus. J. Exp. Med. 177:1367.[Abstract/Free Full Text]
  69. Kaliyaperumal, A., C. Mohan, W. Wu, S. K. Datta. 1996. Nucleosomal peptide epitopes for nephritis-inducing T helper cells of murine lupus. J. Exp. Med. 183:2459.[Abstract/Free Full Text]
  70. Diaz, G. C., A. M. Jevnikar, D. C. Brennan, S. Florquin, S. A. Pacheco, V. R. Kelley. 1992. Autoreactive kidney-infiltrating T-cell clones in murine lupus nephritis. Kidney Int. 42:851.
  71. Deusch, K., R. Fernandez-Notran, M. Konstadoulakis, K. Baur, R. S. Schwartz, M. P. Madaio. 1991. Autoreactive T cells from MRL-Lpr/lpr mice secrete multiple lymphokines and induce the production of IgG anti-DNA antibodies. J. Autoimmunol. 4:563.[Medline]
  72. Weston, K. M., S.-T. Ju, C. Y. Lu, M.-S. Sy. 1988. Autoreactive T cells in MRL/Mp-lpr/lpr mice: characterization of the lymphokines produced and analysis of antigen-presenting cells required. J. Immunol. 141:1941.[Abstract]
  73. Perkins, D. L., J. A. Listman, A. Marshak-Rothstein, W. Kozlow, V. R. Kelly, P. W. Finn, I. J. Rimm. 1996. Restriction of the TCR repertoire inhibits the development of memory T cells and prevents autoimmunity in lpr mice. J. Immunol. 156:4961.[Abstract]
  74. Bradley, L. M., D. D. Duncan, S. Tonkonogy, S. L. Swain. 1991. Characterization of antigen-specific CD4+ effector T cells in vivo: immunization results in a transient population of MEL-14-, CD45RB- helper cells that secretes interleukin 2 (IL-2), IL-3, IL-4, and interferon {gamma}. J. Exp. Med. 174:547.[Abstract/Free Full Text]
  75. Singer, G. G., A. K. Abbas. 1994. The fas antigen is involved in peripheral but not thymic deletion of T lymphocytes in T cell receptor transgenic mice. Immunity 1:365.[Medline]
  76. Papiernik, M., C. Pontoux, P. Golstein. 1995. Non-exclusive Fas control and age dependence of viral superantigen-induced clonal deletion in lupus-prone mice. Eur. J. Immunol. 25:1517.[Medline]
  77. Sobel, E. S., T. Katagiri, K. Katagiri, S. C. Morris, P. L. Cohen, R. A. Eisenberg. 1991. An intrinsic B cell defect is required for the production of autoantibodies in the lpr model of murine systemic autoimmunity. J. Exp. Med. 173:1441.[Abstract/Free Full Text]
  78. Nemazee, D., C. Guiet, K. Buerki, A. Marshak-Rothstein. 1991. B lymphocytes from the autoimmune-prone mouse strain MRL/lpr manifest an intrinsic defect in tetraparental MRL/lpr DBA/2 chimeras. J. Immunol. 147:2536.[Abstract/Free Full Text]
  79. Treadwell, E. L., P. Cohen, D. Williams, K. O’Brien, A. Volkman, R. Eisenberg. 1993. MRL mice produce anti-Su autoantibody, a specificity associated with systemic lupus erythematosus. J. Immunol. 150:695.[Abstract]
  80. Davidson, W. F., J. B. Roths, K. L. Holmes, E. Rudikoff, H. C. Morse. 1984. Dissociation of severe lupus-like disease from polyclonal B cell activation and IL 2 deficiency in C3H- lpr/lpr mice. J. Immunol. 133:1048.[Abstract]
  81. Serreze, D. V., H. D. Chapman, D. S. Varnum, M. S. Hanson, R. P. C. Reifsnyde, S. D. Richard, S. A. Fleming, E. H. Leiter, L. D. Shultz. 1996. B lymphocytes are essential for the initiation of T cell-mediated autoimmune diabetes: analysis of a new "speed congenic" stock of NOD.Ig mu null mice. J. Exp. Med. 184:2049.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
Y. Li, F. Chen, M. Putt, Y. K. Koo, M. Madaio, J. C. Cambier, P. L. Cohen, and R. A. Eisenberg
B Cell Depletion with Anti-CD79 mAbs Ameliorates Autoimmune Disease in MRL/lpr Mice
J. Immunol., September 1, 2008; 181(5): 2961 - 2972.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
T. Kobayashi, K. Takahashi, Y. Nagai, T. Shibata, M. Otani, S. Izui, S. Akira, Y. Gotoh, H. Kiyono, and K. Miyake
Tonic B cell activation by Radioprotective105/MD-1 promotes disease progression in MRL/lpr mice
Int. Immunol., July 1, 2008; 20(7): 881 - 891.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. K. O'Neill, Y. Cao, K. M. Hamel, P. D. Doodes, G. Hutas, and A. Finnegan
Expression of CD80/86 on B Cells Is Essential for Autoreactive T Cell Activation and the Development of Arthritis
J. Immunol., October 15, 2007; 179(8): 5109 - 5116.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Ahuja, J. Shupe, R. Dunn, M. Kashgarian, M. R. Kehry, and M. J. Shlomchik
Depletion of B Cells in Murine Lupus: Efficacy and Resistance
J. Immunol., September 1, 2007; 179(5): 3351 - 3361.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
C. Jiang, J. Foley, N. Clayton, G. Kissling, M. Jokinen, R. Herbert, and M. Diaz
Abrogation of Lupus Nephritis in Activation-Induced Deaminase-Deficient MRL/lpr Mice
J. Immunol., June 1, 2007; 178(11): 7422 - 7431.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Duddy, M. Niino, F. Adatia, S. Hebert, M. Freedman, H. Atkins, H. J. Kim, and A. Bar-Or
Distinct Effector Cytokine Profiles of Memory and Naive Human B Cell Subsets and Implication in Multiple Sclerosis
J. Immunol., May 15, 2007; 178(10): 6092 - 6099.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
D. Herber, T. P. Brown, S. Liang, D. A. Young, M. Collins, and K. Dunussi-Joannopoulos
IL-21 Has a Pathogenic Role in a Lupus-Prone Mouse Model and Its Blockade with IL-21R.Fc Reduces Disease Progression
J. Immunol., March 15, 2007; 178(6): 3822 - 3830.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. Yan, B. P. Harvey, R. J. Gee, M. J. Shlomchik, and M. J. Mamula
B Cells Drive Early T Cell Autoimmunity In Vivo prior to Dendritic Cell-Mediated Autoantigen Presentation
J. Immunol., October 1, 2006; 177(7): 4481 - 4487.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
C. O. Jacob, L. Pricop, C. Putterman, M. N. Koss, Y. Liu, M. Kollaros, S. A. Bixler, C. M. Ambrose, M. L. Scott, and W. Stohl
Paucity of Clinical Disease despite Serological Autoimmunity and Kidney Pathology in Lupus-Prone New Zealand Mixed 2328 Mice Deficient in BAFF
J. Immunol., August 15, 2006; 177(4): 2671 - 2680.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
M. Kalaaji, E. Mortensen, L. Jorgensen, R. Olsen, and O. P. Rekvig
Nephritogenic Lupus An