The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chesney, J.
Right arrow Articles by Bucala, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chesney, J.
Right arrow Articles by Bucala, R.
Right arrowPubmed/NCBI databases
*Substance via MeSH
The Journal of Immunology, 1998, 160: 419-425.
Copyright © 1998 by The American Association of Immunologists

Regulated Production of Type I Collagen and Inflammatory Cytokines by Peripheral Blood Fibrocytes

Jason Chesney*, Christine Metz*, Abram B. Stavitsky{dagger}, Michael Bacher* and Richard Bucala1,*

* The Picower Institute for Medical Research, Laboratory of Medical Biochemistry, Manhasset, NY 11030; and {dagger} Case Western Reserve University, Department of Molecular Biology and Microbiology, Cleveland, OH 44106


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We recently described a novel population of blood-borne cells, termed fibrocytes, that display a distinct cell surface phenotype (collagen+/CD13+/CD34+/CD45+), rapidly enter sites of tissue injury, and contribute to scar formation. To further characterize the role of these cells in vivo, we examined the expression of type I collagen and cytokine mRNAs by cells isolated from wound chambers implanted into mice. Five days after chamber implantation, CD34+ fibrocytes but not CD14+ monocytes or CD90+ T cells expressed mRNA for type I collagen. Fibrocytes purified from wound chambers also were found to express mRNA for IL-1ß, IL-10, TNF-{alpha}, JE/MCP, MIP-1{alpha}, MIP-1ß, MIP-2, PDGF-A, TGF-ß1, and M-CSF. The addition of IL-1ß (1–100 ng/ml), a critical mediator in wound healing, to fibrocytes isolated from human peripheral blood induced the secretion of chemokines (MIP-1{alpha}, MIP-1ß, MCP-1, IL-8, and GRO{alpha}), hemopoietic growth factors (IL-6, IL-10, and macrophage-CSF), and the fibrogenic cytokine TNF-{alpha}. By contrast, IL-1ß decreased the constitutive secretion of type I collagen as measured by ELISA. Additional evidence for a role for fibrocytes in collagen production in vivo was obtained in studies of livers obtained from Schistosoma japonicum-infected mice. Mouse fibrocytes localized to areas of granuloma formation and connective matrix deposition. We conclude that fibrocytes are an important source of cytokines and type I collagen during both the inflammatory and the repair phase of the wound healing response. Furthermore, IL-1ß may act on fibrocytes to effect a phenotypic transition between a repair/remodeling and a proinflammatory mode.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The host response to tissue injury requires a complex interplay of cellular, humoral, and connective tissue elements (1, 2). Platelets play an early role in this response by releasing chemotactic factors that act to recruit peripheral blood leukocytes into the injured site. Peripheral blood leukocytes then produce a variety of mediators that serve to combat infection and coordinate successive steps of the tissue repair response (1, 2, 3). Fibrogenic cytokines such as TGF-ß1 and TNF-{alpha} stimulate connective tissue cells to proliferate and to secrete extracellular matrix proteins (4). The normal outcome of this cascading series of events is elimination of the invasive stimulus followed by connective tissue scar formation and, over time, by remodeling of the injured site.

We recently described a population of novel, blood-borne fibroblast-like cells that rapidly enter sites of tissue injury and contribute to connective tissue scar formation (5, 6, 7). Termed fibrocytes, these cells comprise ~0.5% of peripheral blood leukocytes and display an adherent, spindle-shaped morphology (Ref. 5 and J. Chesney, unpublished observations). Fibrocytes obtained from blood express the fibroblast products collagen I, collagen III, and fibronectin, as well as the leukocyte common Ag CD45RO, the pan-myeloid Ag CD13, and the hemopoietic stem cell Ag CD34. Fibrocytes do not synthesize epithelial (cytokeratin), endothelial (von Willebrand factor VIII-related protein), or smooth muscle ({alpha}-actin) cell markers and are negative for nonspecific esterases as well as the monocyte/macrophage-specific markers CD14 and CD16 (5). Fibrocytes also do not express proteins produced by dendritic cells or their precursors (CD25, CD10, and CD38) or by the pan-B cell Ag CD19 (5, 8, 9, 10).

In the present study, we report that fibrocytes isolated from wound chambers or peripheral blood express cytokines and type I collagen. Mouse fibrocytes participating in tissue repair in vivo were found to express type I collagen and inflammatory cytokine mRNAs and were identified to localize to areas of matrix deposition in Schistosoma japonicum-infected, granulomatous livers. In vitro, IL-1ß and TNF-{alpha} stimulated inflammatory cytokine secretion by human peripheral blood fibrocytes, while IL-1ß inhibited type I collagen synthesis. IL-1ß, an important mediator of wound healing responses, may play an important role in effecting a fibrocyte transition from a "repair" to a "proinflammatory" phenotype.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

BALB/c and C57BL/6 mice (18–20 gm) of both sexes were purchased from The Jackson Laboratory, Bar Harbor, ME.

Fibrocyte isolation from peripheral blood

Fibrocytes were harvested and cultured as previously described (5, 6). Briefly, total PBMCs first were isolated from human or murine blood by centrifugation over Ficoll-Paque (Pharmacia, Uppsala, Sweden) following the manufacturer’s protocol. After overnight culture on fibronectin-coated plates (6-well plates, 5 x 106 PBMCs/well) (Becton Dickinson Labware, Bedford, MA) in DMEM (Life Technologies, Gaithersburg, MD) supplemented with 20% FCS (HyClone Labs, Logan, UT), the nonadherent cells were removed by a single, gentle aspiration. Following 10 days of continuous culture, the adherent cells were lifted by incubation in cold 0.05% EDTA/PBS and were depleted by immunomagnetic selection of contaminating T cells (Dynabeads M-450 pan-T, anti-CD2, Dynal, Lake Success, NY), monocytes (Dynabeads M-450 anti-CD14, Dynal), and B cells (Dynabeads M-450 Pan-B, anti-CD19, Dynal). Fibrocyte purity was verified to be >95% (70–80% before depletion of contaminating cells) by FACS analysis (described below). Cell viability was determined to be >90% by trypan blue exclusion.

FACS analysis

2 x 105 purified fibrocytes/sample were washed twice in PBS containing 0.1% sodium azide (Sigma Chemical Co., St. Louis, MO) and 1% BSA (Sigma). The cells were resuspended in 25 µl of diluted Ab (in PBS) and incubated for 30 min on ice (11). The cells then were washed twice and resuspended in 200 µl of PBS. At least 10,000 cells were analyzed on a FACScan instrument (Becton Dickinson). Cells were stained using both phycoerythrin-conjugated anti-CD34 mAb (clone 8G12) (Becton Dickinson) and fluorescein-conjugated anti-collagen I mAb (clone MAB1340) (Chemicon, Temecula, CA). For controls, directly conjugated isotype controls and cell-only samples were analyzed with each Ab.

Protein secretion studies

Purified human fibrocytes were cultured in six-well fibronectin-coated flat-bottom plates (1 x 105 cells/well) in DMEM supplemented with 2% heat-inactivated FCS (HyClone). Cells were incubated for 16 h alone as control or in the presence of IL-1ß, IFN-{gamma}, platelet-derived growth factor (PDGF-BB),2 TGF-ß1, or TNF-{alpha} (each at 1, 10, or 100 ng/ml; R&D Systems, Minneapolis, MN). Conditioned medium was analyzed with the following ELISA kits: GRO{alpha}, IL-1ß, IL-3, IL-4, IL-6, IL-8, IL-12, monocyte chemotactic protein (MCP)-1, TGF-ß1, PDGF-AB, and macrophage-CSF (R&D Systems); IFN-{gamma} and IL-10 (Genzyme, Cambridge, MA); and IFN-{alpha} (Biosource, Camarillo, CA). Macrophage migration-inhibitory factor (MIF), TNF-{alpha}, macrophage inflammatory protein (MIP)-1{alpha} and MIP-1ß ELISAs were performed as previously described (12, 13, 14). PDGF-AA was analyzed by sandwich ELISA employing a mouse anti-PDGF-AA capture Ab, a polyclonal rabbit anti-PDGF-AB detector, and purified PDGF-AA as standard (R&D Systems). Type I collagen was analyzed by sandwich ELISA employing a mouse monoclonal anti-type I collagen capture Ab (Chemicon), a polyclonal rabbit anti-type I collagen (Accurate, Westbury, NY), and purified human type I collagen as standard (Becton Dickinson) (detection limit = 1 ng/ml). Data are expressed as mean ± SD (n = 3 assays of duplicate wells).

Cell proliferation assay

Purified human fibrocytes were cultured in 96-well flat-bottom plates (5 x 103 cells/well) in DMEM supplemented with 2% heat-inactivated FCS (HyClone). Cells were incubated for 32 h alone as control or in the presence of IL-1ß, IFN-{gamma}, PDGF-BB, TGF-ß1, or TNF-{alpha} (each at 1, 10, or 100 ng/ml). The proliferative activity was measured by direct cell enumeration and by the incorporation of [3H]thymidine (4 µCi/ml) into DNA over the last 12 h of incubation as measured by liquid scintillation counting. Data are expressed as the mean ± SD (n = 3).

Cell migration studies

IL-1ß or TNF-{alpha} (each at 1, 10, and 100 ng/ml) diluted in DMEM supplemented with 2% heat-inactivated FCS were added to the lower chambers of a 24-well chemotaxis insert plate (8-µm pores) (Becton Dickinson Labware). 2 x 104 fibrocytes in the same medium with or without cytokines were then added to the upper wells. After incubation for 4 h at 37°C, the nonmigrating cells were washed from the upper surface of the filters. The membranes were then removed, fixed in 10% buffered neutral formalin, and stained with Diff-Quik (Sigma). Fibrocytes that migrated through the membrane were enumerated by light microscopy in five 200x fields. Data are expressed as the mean ± SD.

Isolation of wound chamber cells

BALB/c mice were anesthetized by i.p. injection of sodium pentobarbital (40 mg/kg), and an 0.5-cm dorsal midline incision was made using aseptic technique. After dissecting a s.c. pocket, a single sterile wound chamber consisting of a perforated 3.5-cm piece of silicone tubing (Dow Corning, Midland, MI) containing a strip of polyvinyl alcohol sponge (Unipoint Inc., High Point, NC) was inserted along each flank. After 5 days, the mice were killed by CO2 asphyxiation, and the wound chambers were removed under strict aseptic conditions. The cells that had infiltrated the wound chambers were dispersed by trituration in ice-cold PBS containing 0.05% EDTA, centrifuged, and purified into three distinct cell populations by immunomagnetic separation following the manufacturer’s protocol: 1) fibrocytes: biotinylated anti-CD34, clone RAM34, PharMingen, San Diego, CA; Dynabeads M-280 Streptavidin, Dynal; 2) T cells: pan-T, anti-CD90, Dynal; 3) macrophages: anti-CD14, rat IgG1, clone rmC5-3, PharMingen; Dynabeads M-450 sheep anti-rat IgG, Dynal. To verify the purity of each cell fraction, a subset of cells was cultured in RPMI, 10% FCS, for 12 h, separated from the magnetic beads, and examined using spot immunofluorescence analysis. The CD34 fraction was found to be 83 ± 2% CD34+ (anti-CD34, clone RAM34, PharMingen), 79 ± 6% CD45+ (anti-CD45, clone 30F11.1, PharMingen), and 94 ± 2% collagen I+ (anti-collagen I, clone T40775R; Biodesign, Kennebunk, ME). The CD90 fraction was found to be 76 ± 3% CD3+ ({alpha}CD3, clone 145–2C11, PharMingen) and the CD14 fraction was found to be 87 ± 5% CD14+ ({alpha}CD14, clone rmC5–3, PharMingen). Overall cell viability was >90%.

mRNA expression by wound chamber cells

Total cellular RNA was isolated by a modified guanidinium isothiocyanate method (RNAzol, Cinna Biotecx, Friendswood, TX) within 20 min of the start of the wound chamber cell isolation procedure. cDNA was prepared from 1.0 µg of total RNA using 0.25 ng of oligo(dT)12–18 and Superscript II following the manufacturer’s protocol (Life Technologies, Grand Island, NY). Two-microliter aliquots of cDNA were then amplified by PCR in a Perkin-Elmer model 9600 thermal cycler (Norwalk, CT) using the primers listed below and the following cycling program: denaturation for 15 s at 95°C, annealing for 20 s at 55°C, and extension for 30 s at 72°C for 28 cycles (except ß-actin, 22 cycles) with a final extension for 5 min at 72°C. Amplimer sets consisting of presynthesized PCR primer pairs were used for the following mouse mRNAs: IFN-{alpha} (294 bp), IFN-{gamma} (365 bp), IL-3 (496 bp), IL-6 (638 bp), IL-10 (455 bp), M-CSF (397 bp), TGF-ß1 (525 bp), and TNF-{alpha} (354 bp) (Clontech, Palo Alto, CA). The following mouse mRNA primer pairs were custom synthesized: ß-actin, 5'GTGGGCCGCTCTAGGCACCA3', 5'TGGCCT-TAGGGTGCAGGGGG3' (236 bp); CD3, 5'TCTATCCAGCACCCAGAATC3', 5'AGTAGGGGGCACTCTGTAAA3' (269 bp); CD14, 5'GTCCTTAAAGCGGCTTACGG3', 5'GCGCTAAAACTTGGAGGGCT3' (399 bp); CD34, 5'AGACTCAGGGAAAGGCCAAT3', 5'TGAAGGCAGCATGAAGTCAG3' (168 bp); IL-12, 5'GAAGACGGCCAGAGAAAAAC3', 5'GCAGAGTCTCGCCATTATGA3' (357 bp); JE/MCP, 5'ACCAGCCAACTCTCACTGAA3', 5'TGAAGACCTTAGGGCAGATG3' (360 bp), KC, 5'CTGTCAGTGCCTGCAGACCA3', 5'CCAAGGGAGCTTCAGGGTCA3' (132 bp); PDGF-A, 5'CTCCGTAGGGGCTGAGGATG3', 5'CTCCTCCTCCCGATGGTCTG3', (404 bp); PDGF-B, 5'GCCGCCAGCGCCCATCTTAT3', 5'CGGGCAGGGAGAGGTGCAAA3' (332 bp); IL-1ß, 5'GCTGGAGAGTGTGGATCCCA3', 5'GCTGTCTGCTCATTCATGAC3' (301 bp); MIP-1{alpha}, 5'TTGTCACCAGACGCGGTGTG3', 5'GGCAATCAGTTCCAGGTCAG3' (282 bp); MIP-1ß, 5'CTCTGCGTGTCTGCCCTCTC3', 5'GACCATCTCCATGGGAGAGA3' (490 bp); and MIP-2, 5'TCTTCCTCGGGCACTCCAGA3', 5'GGACAGCAGCCCAGGCTCCT3' (378 bp) (Life Technologies).

Immunohistochemistry

C57BL/6 mice were infected by the s.c. route with 25 cercariae of a Philippine strain of S. japonicum cercariae at Lowell University, Lowell, MA (National Institute of Allergy and Infectious Diseases Supply Contract AI-02636) (15). After 14 wk of infection, the livers were removed, fixed in 10% buffered neutral formalin, embedded in paraffin, sectioned, and processed for immunohistochemical analyzes. After blocking endogenous peroxidases with H2O2 (3%), the deparaffinized sections were incubated with an anti-CD34 mAb (1:50 dilution) (clone QB-END/10) (Accurate) or an IgG1 isotype control. The sections were then washed, and an immunoperoxidase-linked secondary Ab (Dako, Copenhagen, Denmark) was added, followed by diaminobenzidene as substrate. Control sections were stained with an isotype control or without primary Ab and showed no immunoreactivity. Adjacent sections also were stained with Masson’s Trichrome (Sigma) to visualize connective tissue matrix.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To more closely examine fibrocyte function in vivo, we first studied the expression of cytokine and of collagen mRNA in various cell types actively participating in tissue repair. Wound chambers were implanted into mice and, 5 days later, the infiltrating cells were collected and fractionated by positive immunoselection into CD90+ T cells, CD14+ monocytes, and CD34+ fibrocytes. The expression of different mRNAs by these purified cell populations then was analyzed by reverse transcription PCR. Type I collagen mRNA was found to be expressed by CD34+ fibrocytes but not CD14+ monocytes or CD90+ T cells (Fig. 1Go). Fibrocytes also expressed detectable levels of mRNAs for the pro-inflammatory cytokines, IL-1ß and TNF-{alpha}, and the anti-inflammatory cytokine, IL-10. Chemokine mRNAs were expressed by all 3 cell types. By comparing the intensities of the DNA amplification products, fibrocytes appeared to express the highest levels of MIP-1{alpha} and MIP-2. Fibrocytes also expressed high levels of mRNA for the fibrogenic growth factors, PDGF-A and TGF-ß1, and the hemopoietic growth factor M-CSF when compared with monocytes or T cells. Fibrocytes did not express detectable levels of IFN-{gamma}, IL-3, IL-6, or PDGF-B (Fig. 1Go and data not shown).



View larger version (58K):
[in this window]
[in a new window]
 
FIGURE 1. Wound chamber cell mRNA expression. Wound chambers were implanted s.c. into mice, and 5 days later the infiltrating inflammatory cells were collected and fractionated into CD90+ T cells, CD14+ monocytes, and CD34+ fibrocytes (11 ± 2%, 36 ± 5%, and 16 ± 3% of total cells, respectively). Total cellular RNA was isolated from each cell type and analyzed by reverse transcription PCR as described in Materials and Methods.

 
We next investigated the secretory profile of human fibrocytes isolated from peripheral blood and stimulated in vitro with mediators known to be present during the wound-healing response (1, 4). To verify that cultures of fibrocytes purified from human blood were homogenous, we first examined these cells by flow cytometry for coexpression of type I collagen and CD34, a phenotype unique to fibrocytes (5). After negative immunoselection of T cells, monocytes, and B cells, peripheral blood fibrocytes were found to be >95% pure (Fig. 2Go). Purified peripheral blood fibrocytes thus were found to constitutively secrete the {alpha} chemokines, MIP-1{alpha}, MIP-1ß, MCP-1, and the ß chemokines: IL-8 and GRO{alpha} (Fig. 3Go). The addition of the proinflammatory cytokines, IL-1ß or TNF-{alpha}, to fibrocyte cultures increased the secretion of these mediators.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 2. Type I collagen and CD34 coexpression by human peripheral blood fibrocytes. Purified human fibrocytes were incubated with a FITC-conjugated anti-type I collagen mAb and a phycoerythrin-conjugated anti-CD34 mAb, then analyzed by flow cytometry as described in Materials and Methods. The horizontal and vertical lines mark fluorescence intensity greater than the background that was observed with isotype control mAbs.

 


View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 3. Chemokine secretion by human peripheral blood fibrocytes. MIP-1{alpha} (A), MIP-1ß (B), MCP-1 (C), IL-8 (D), and GRO{alpha} (E) release were analyzed by ELISA of supernatants collected from unstimulated human fibrocytes ({square}) and human fibrocytes stimulated for 16 h with IL-1ß () or TNF-{alpha} ({blacksquare}). Measurements were performed in triplicate cultures; the data shown are the mean ± SD of two separate experiments.

 
The hemopoietic growth factors M-CSF and IL-6 regulate macrophage differentiation and lymphocyte proliferation, respectively, and are known to be released during the early phase of tissue repair (16, 17, 18). Peripheral blood fibrocytes constitutively secrete substantial amounts of M-CSF and are induced to secrete even higher levels by the addition of IL-1ß or TNF-{alpha} (Fig. 4GoA). IL-6 also is produced by fibrocytes upon stimulation with IL-1ß or TNF-{alpha} (Fig. 4GoB). IL-10 is an "anti-inflammatory" cytokine and may play an important role in the wound-healing response by acting as a potent mitogen for mast cells (17). IL-10 was found to be secreted by peripheral blood fibrocytes when induced by IL-1ß or TNF-{alpha} (Fig. 4GoC). IL-3 synergizes with IL-6, M-CSF, or IL-10 to induce stem cell differentiation and/or proliferation (19, 20, 21). However, peripheral blood fibrocytes did not secrete IL-3, either constitutively or when induced by IL-1ß, TNF-{alpha}, PDGF-BB, TGF-ß1, or IFN-{gamma} (detection limit = 24 pg/ml) (data not shown).



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 4. Hemopoietic growth factor secretion by human peripheral blood fibrocytes. M-CSF (A), IL-6 (B), and IL-10 (C) release were analyzed by ELISA of supernatants collected from unstimulated human fibrocytes ({square}) and human fibrocytes stimulated for 16 h with IL-1ß () or TNF-{alpha} ({blacksquare}). Measurements were performed in triplicate cultures; the data shown are the mean ± SD of two separate experiments. p < 0.01 and p < 0.05 for M-CSF and TNF-{alpha} secretion, respectively, for fibrocytes stimulated with 100 ng IL-1ß vs control (no stimulation) (two sample t test, assuming unequal variances).

 
IL-1ß, TNF-{alpha}, PDGF-AB/AA, and TGF-ß1 each have been found to be present in the tissue repair microenvironment and have been implicated in the stimulation of fibrogenic responses in vivo (4). Peripheral blood fibrocytes constitutively secrete appreciable levels of TGF-ß1 and secrete TNF-{alpha} upon induction with IL-1ß (Fig. 5Go). However, fibrocytes do not secrete IL-1ß (detection limit = 3.9 pg/ml), PDGF-AB (detection limit = 8.4 pg/ml), PDGF-AA (detection limit = 1.5 ng/ml), or MIF (detection limit = 0.15 ng/ml) either constitutively or after stimulation with IL-1ß, TNF-{alpha}, PDGF-BB, TGF-ß1, or IFN-{gamma} (data not shown).



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 5. Fibrogenic cytokine secretion by human peripheral blood fibrocytes. TGF-ß1 (A) and TNF-{alpha} (B) release were analyzed by ELISA of supernatants collected from unstimulated human fibrocytes ({square}) and human fibrocytes stimulated for 16 h with IL-1ß () or TNF-{alpha} ({blacksquare}). Measurements were performed in triplicate cultures; the data shown are the mean ± SD of two separate experiments.

 
Previous studies have shown that IFN-{gamma} inhibits proliferation and collagen synthesis by connective tissue fibroblasts in vitro and that IL-1ß, TNF-{alpha}, PDGF-BB, and TGF-ß1 can stimulate these activities (4). IFN-{gamma} did not inhibit fibrocyte proliferation or constitutive collagen expression and, of the fibrogenic cytokines tested (IL-1ß, TNF-{alpha}, PDGF-BB, and TGF-ß1), only IL-1ß was found to affect collagen expression and proliferation (Figs. 6Go and 7 and data not shown). The proliferative response of fibrocytes to IL-1ß in vitro was confirmed by direct cell enumeration (control, 5.6 ± 0.33 x 103 cells; IL-1ß-stimulated (100 ng/ml at 12 h), 8.7 ± 0.45 x 103 cells, p < 0.05). IL-1ß also stimulated fibrocyte migration; however, the potent tissue fibroblast chemoattractants PDGF-BB and TGF-ß1 were not found to affect fibrocyte movement (Fig. 8Go and data not shown).



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 6. Type I collagen secretion by human peripheral blood fibrocytes. Type I collagen release was analyzed by ELISA of supernatants collected from unstimulated human fibrocytes ({square}) and human fibrocytes stimulated for 16 h with IL-1ß () or TNF-{alpha} ({blacksquare}). Measurements were performed in triplicate cultures; the data shown are the mean ± SD of two separate experiments.

 


View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 8. Migration by human peripheral blood fibrocytes. IL-1ß (), TNF-{alpha} ({blacksquare}), or media alone ({square}) were added to the lower chamber of 24-well chemotaxis insert plates and fibrocytes were added to the upper wells. Four hours later, fibrocytes that migrated through the membrane were enumerated in five 200x fields by light microscopy. Data are expressed as the mean ± SD and are representative of one experiment that was performed three times. No significant difference was observed when the stimulant was place in both the upper and lower wells.

 
The parasitic disease schistosomiasis is characterized by a fibrosing, granulomatous reaction directed against parasite eggs that become entrapped in the hepatic and pulmonary circulations (22). To obtain evidence for collagen synthesis by fibrocytes in vivo, we examined liver tissue from S. japonicum-infected mice for the presence of CD34+ fibrocytes. Figure 9Go shows a section of liver obtained 14 wk after infection in which numerous CD34+ cells can be seen to localize to areas of connective tissue matrix deposition (compare Fig. 9Go, A and B to E and F). No CD34+ fibrocytes could be detected in normal, uninfected livers (data not shown). These data suggest that fibrocytes contribute to the fibrotic pathology that occurs as a consequence of S. japonicum infection.



View larger version (133K):
[in this window]
[in a new window]
 
FIGURE 9. CD34+ fibrocytes localize with areas of matrix deposition in S. japonicum-infected mouse liver. Liver specimens were fixed, sectioned, and stained with Masson’s trichrome to visualize connective tissue matrix (cyan blue), (A) 200x, (B) 400x. Adjacent sections were labeled with an isotype control mAb (C) 200x, (D) 400X, or an anti-mouse CD34 mAb (E) 200x, (F) 400x, and binding was detected with an immunoperoxidase-linked secondary Ab. Numerous CD34+ fibrocytes can be seen scattered in the granuloma depicted in E, and certain cells are indicated by the arrows in the higher power view shown in F.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Connective tissue fibroblasts are a quiescent cell population that under normal circumstances remain sparsely distributed throughout the extracellular matrix (23). As a consequence of injury, fibroblasts can enter and proliferate within the injured site (4). The precise origin of the fibroblast-like cells within wounds has been controversial since the original microscopic studies of developing connective tissue performed by Paget in 1863 (24, 25). That wound fibroblasts appeared by migration from adjacent tissue was supported by experiments showing the apparent ingrowth of fibroblasts from local areas and by the observation that India ink-tagged monocytes failed to develop into tissue fibroblasts in vivo (25, 26). Other studies, however, reported evidence for the differentiation of leukocytes into fibroblasts within s.c. diffusion chambers and the apparent in vitro transformation of peripheral blood mononuclear cells into collagen-producing cells (27, 28).

Studies leading to the identification and purification of the fibrocyte, a blood-borne cell that expresses collagen, together with the hemopoietic/leukocyte cell surface markers CD34 and CD45RO, suggest that this cell type constitutes a previously unrecognized circulating, fibroblast-like cell population (5). The isolation and culture of these cells in high purity (>95% positivity for both CD34 and collagen I) provides evidence for a cell type distinct from that described previously (29, 30) including a population originally identified by Ross and Lillywhite in 1965 (31), who traced the appearance of a blood-borne, connective tissue-like cell type to contamination from local tissue sources. Peripheral blood fibrocytes account for as many as 10% of the inflammatory cells that infiltrate sites of acute injury and have been identified to be present in cutaneous scar tissue (5).

In the current study, mouse fibrocytes participating in tissue repair were found to express the mRNAs for type I collagen and inflammatory cytokines and to be present in significant numbers in areas of matrix deposition in S. japonicum-infected granulomatous livers. Human peripheral blood fibrocytes constitutively secrete type I collagen and are a particularly abundant source of the chemokines MIP-1{alpha}, MIP-1ß, MCP-1, IL-8, and GRO{alpha} and the hemopoietic growth factors IL-6, IL-10, and M-CSF. Both cytokine and collagen expression were found to occur in a regulated fashion. IL-1ß and TNF-{alpha}, two early mediators of the wound-healing response (4), stimulate chemokine and hemopoietic growth factor secretion by peripheral blood fibrocytes in vitro, whereas IL-1ß inhibits type I collagen synthesis.

IL-1ß is expressed within 24 h of an injury and is essential for the generation of inflammatory and reparative responses in vivo (32). IL-1ß up-regulates the expression of adhesion molecules expression by endothelial cells (ELAM-1, VCAM-1, ICAM-1) and stimulates endothelial cell and fibroblast proliferation and matrix production (4, 33). Studies employing IL-1 receptor antagonists in vivo have established that IL-1ß is an absolute requirement forconnective tissue scar formation (34). IL-1ß may function to maintain peripheral blood fibrocytes in a proinflammatory state early in wound repair, resulting in the increased production of molecules that recruit and expand the inflammatory cell population within the wound environment. The infiltration of CD4+ T cells into areas of tissue damage is considered a critical requirement for the generation of Ag-specific immunity (1). The fibrocyte products MIP-1{alpha}, MIP-1ß, and MCP-1 are potent T cell chemoattractants and may act to specifically recruit CD4+ T cells into the tissue repair microenvironment (35). Recently, fibrocytes have been identified to be especially potent stimulators of Ag-specific CD4+ T cell proliferation in vivo (6). Fibrocytes thus may function not only to recruit but also to activate CD4+ T cells during tissue repair and may play an important role in the initiation of Ag-specific immunity.

The ability of fibrocytes to both recruit and activate T cells and to secrete type I collagen suggests that these cells may play a critical role in certain connective tissue disorders. A persistent fibrocyte:T cell activation response, for instance, may lead to pathologically significant fibrosis. T cells are essential for the development of schistosomiasis, and the localization of fibrocytes to areas of matrix deposition suggests that these cells may be an important source of collagen production in schistosome-infected liver. Fibrocytes also may participate in the generation of excessive fibroses in certain autoimmune disorders that involve persistent T cell activation, such as scleroderma and graft vs host disease. Further investigation into the function of this novel cell population may provide important insight into the control of the fibrotic responses associated with inflammation.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 7. Proliferation by human peripheral blood fibrocytes. Unstimulated human fibrocytes ({square}) and human fibrocytes stimulated for 20 h with IL-1ß () or TNF-{alpha} ({blacksquare}) were pulsed for 12 h with 4 µCi/ml [3H]thymidine and cell proliferation analyzed by liquid scintillation counting. Data are expressed as mean ± SD and are representative of one experiment that was performed three times.

 

    Acknowledgments
 
We thank Cathy Rapelje for expert assistance with the FACS analyses and the late Dr. Ken Warren for helpful discussions.


    Footnotes
 
1 Address correspondence and reprint requests to Dr. Richard Bucala, Department of Medical Biochemistry, The Picower Institute for Medical Research, 350 Community Drive, Manhasset, NY 11030. E-mail address: Back

2 Abbreviations used in this paper: PDGF, platelet-derived growth factor; MCP-1, monocyte chemotactic protein 1; M-CSF, macrophage colony-stimulating factor; MIP, macrophage inflammatory protein; MIF, macrophage migration inhibitory factor; GRO, growth stimulatory activity.. Back

Received for publication May 29, 1997. Accepted for publication September 16, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Wahl, L. M., S. M. Wahl. 1992. Inflammation. I. K. Cohen, and D. F. Diegelman, and W. J. Lindblad, eds. Wound Healing: Biochemical and Clinical Aspects 40. Saunders, Philadelphia.
  2. Clark, R. A. F.. 1996. Wound Repair: overview and general considerations. R. A. F. Clark, ed. The Molecular and Cellular Biology of Wound Repair 3. Plenum, New York.
  3. Rappolee, D. A., D. Mark, M. J. Banda, Z. Werb. 1988. Wound macrophages express TGF-{alpha} and other growth factors in vivo: analysis by mRNA typing. Science 241:708.[Abstract/Free Full Text]
  4. Kovacs, E. J., L. A. DiPietro. 1994. Fibrogenic cytokines and connective tissue production. FASEB J. 8:854.[Abstract]
  5. Bucala, R., L. A. Spiegel, J. Chesney, M. Hogan, A. Cerami. 1994. Circulating fibrocytes define a new leukocyte subpopulation that mediates tissue repair. Mol. Med. 1:71.[Medline]
  6. Chesney, J., M. Bacher, A. Bender, R. Bucala. 1997. The peripheral blood fibrocyte is a potent antigen presenting cell capable of priming naive T cells in situ. Proc. Natl. Acad. Sci. USA 94:6307.[Abstract/Free Full Text]
  7. Chesney, J., R. Bucala. 1997. Peripheral blood fibrocytes: novel fibroblast-like cells that present antigen and mediate tissue repair. Biochem. Soc. Trans. 25:520.[Medline]
  8. Freudenthal, P. S., R. M. Steinman. 1990. The distinct surface of human blood dendritic cells, as observed after an improved isolation method. Proc. Natl. Acad. Sci. USA 87:7698.[Abstract/Free Full Text]
  9. Galy, A., M. Travis, D. Cen, B. Chen. 1995. Human T, B, natural killer, and dendritic cells arise from a common bone marrow progenitor cell subset. Immunity 3:459.[Medline]
  10. Barclay, A. N., A. B. Beyers, M. L. Birkeland, M. H. Brown, S. J. Davis, C. Somoza, A. F. Williams. 1993. The Leukocyte Antigen Facts Book 142. Academic Press, New York.
  11. Loken, M. R., D. A. Wells. 1994. Immunofluorescence of surface markers. M. G. Ormerod, ed. Flow Cytometry 67. Oxford University Press, Oxford, U.K.
  12. Calandra, T., J. Bernhagen, C. N. Metz, L. A. Spiegel, M. Bacher, T. Donnelly, A. Cerami, R. Bucala. 1995. MIF as a glucocorticoid-induced modulator of cytokine production. Nature 377:68.[Medline]
  13. Hesse, D. G., K. J. Tracey, Y. Fong, K. R. Manogue, M. A. Palladino, A. Cerami, G. T. Shires, S. F. Lowry. 1988. Cytokine appearance in human endotoxemia and primate bacteremia. Surg. Gynecol. Obstet. 166:147.[Medline]
  14. Schmidtmayerova, H., H. L. Nottet, G. Nuovo, T. Raabe, C. R. Flanagan, L. Dubrovsky, H. E. Gendelman, A. Cerami, M. Bukrinsky, B. Sherry. 1996. HIV type I infection alters chemokine-ß peptide expression in human monocytes: implications for recruitment of leukocytes into brain and lymph nodes. Proc. Natl. Acad. Sci. USA 93:700.[Abstract/Free Full Text]
  15. Peters, P. A., K. S. Warren. 1969. A rapid method of infecting mice and other laboratory animals with Schistosoma masoni. J. Parasitol. 55:558.
  16. Kishimoto, T., S. Akira, T. Taga. 1992. Interleukin 6 and its receptor: a paradigm for cytokines. Science 258:593.[Abstract/Free Full Text]
  17. Callard, R., A. Gearing. 1994. IL-10. A. Thompson, ed. The Cytokine Facts Book 174. Academic Press, New York.
  18. Ford, H. R., R. A. Hoffman, E. J. Wing, M. Magee, L. McIntyre, R. L. Simmons. 1989. Characterization of wound cytokines in the sponge matrix model. Arch. Surg. 124:1422.[Abstract/Free Full Text]
  19. Koike, K., T. Nakahata, M. Takagi, T. Kobayashi, A. Ishiguro, K. Tsuji, K. Naganuma, A. Okano, Y. Akiyama, T. Akabane. 1988. Synergism of IL-6 and IL-3 on development of multipotential hemopoietic progenitors in serum-free culture. J. Exp. Med. 168:879.[Abstract/Free Full Text]
  20. McNiece, I. K., B. E. Robinson, P. J. Quesenberry. 1988. Stimulation of murine colony-forming cells with high proliferative potential by the combination of GM-CSF and CSF-1. Blood 72:191.[Abstract/Free Full Text]
  21. Schrader, J. W.. 1988. Interleukin 3. A. Thompson, ed. The Cytokine Handbook 103. Academic Press, New York.
  22. Warren, K. S., E. O. Domingo, R. B. T. Cowan. 1967. Granuloma formation around schistosome eggs as a manifestation of delayed hypersensitivity. Am. J. Pathol. 51:735.[Medline]
  23. Morgan, C. J., W. J. Pledger. 1992. Fibroblast proliferation. I. K. Cohen, and D. F. Diegelman, and W. J. Lindblad, eds. Wound Healing: Biochemical and Clinical Aspects 63. Saunders, Philadelphia.
  24. Paget, J.. 1863. Lectures On Surgical Pathology Delivered at the Royal College of Surgeons of England 848. Longmans, London.
  25. Dunphy, J. E.. 1963. The fibroblast—a ubiquitous ally for the surgeon. N. Engl. J. Med. 268:1367.
  26. Jackson, D. S.. 1961. Specialized functions of connective tissue cells: some methods of study. D. S. Jackson, ed. The Biology of the Connective Tissue Cells 172. Arthritis and Rheumatism Foundation, New York.
  27. Petrakis, N. L., M. Davis, S. P. Lucia. 1961. In vivo differentiation of human leukocytes into histiocytes, fibroblasts and fat cells in subcutaneous diffusion chambers. Blood 17:109.[Abstract/Free Full Text]
  28. Labat, M. L., A. F. Bringuier, C. Arys-Philippart, A. Arys, F. Wellens. 1994. Monocytic origin of fibrosis: in vitro transformation of HLA-DR monocytes into neo-fibroblasts: inhibitory effect of all-trans-retinoic acid on this process. Biomed. Pharmacother. 48:103.[Medline]
  29. Luriya, E. A., A. Y. Fridenshtein, A. G. Grosheva, A. Gleiberman. 1989. Colony-forming precursors in circulating blood fibroblasts. Éksp. Biol. Med. 108:712.
  30. Strirling, G. A., V. V. Kakkar. 1969. Cells in the circulating blood capable of producing connective tissue. Br. J. Exp. Pathol. 50:51.[Medline]
  31. Ross, R., J. W. Lillywhite. 1965. The fate of buffy coat cells grown in subcutaneously implanted diffusion chambers. Lab. Invest. 14:1568.[Medline]
  32. Fahey, T. J., B. Sherry, K. J. Tracey, S. van Deventer, W. G. Jones, J. P. Minei, S. Morgello, G. T. Shires, A. Cerami. 1990. Cytokine production in a model of wound healing: the appearance of MIP-1, MIP-2, cachectin/TNF, and IL-1. Cytokine 2:92.[Medline]
  33. Collins, T., M. A. Read, A. S. Neish, M. Z. Whitley, D. Thanos, T. Maniatis. 1995. Transcriptional regulation of endothelial cell adhesion molecules: NF-{kappa}B and cytokine-inducible enhancers. FASEB J. 9:899.[Abstract]
  34. Piguet, P. F., C. Vessin, G. E. Grau, R. C. Thompson. 1993. IL-1 receptor antagonist prevents or cures pulmonary fibrosis elicited in mice by bleomycin or silica. Cytokine 5:57.[Medline]
  35. Schall, T. J., K. Bacon, R. D. R. Camp, J. W. Kaspari, D. V. Goeddel. 1993. Human MIP-1{alpha} and MIP-1ß chemokines attract distinct populations of lymphocytes. J. Exp. Med. 177:1821.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
R. M. Strieter, E. C. Keeley, M. A. Hughes, M. D. Burdick, and B. Mehrad
The role of circulating mesenchymal progenitor cells (fibrocytes) in the pathogenesis of pulmonary fibrosis
J. Leukoc. Biol., November 1, 2009; 86(5): 1111 - 1118.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
C. L. Galligan, K. A. Siminovitch, E. C. Keystone, V. Bykerk, O. D. Perez, and E. N. Fish
Fibrocyte activation in rheumatoid arthritis
Rheumatology, October 25, 2009; (2009) kep265v1.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Niedermeier, B. Reich, M. R. Gomez, A. Denzel, K. Schmidbauer, N. Gobel, Y. Talke, F. Schweda, and M. Mack
CD4+ T cells control the differentiation of Gr1+ monocytes into fibrocytes
PNAS, October 20, 2009; 106(42): 17892 - 17897.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
B. B. Moore
Fibrocytes as Potential Biomarkers in Idiopathic Pulmonary Fibrosis
Am. J. Respir. Crit. Care Med., April 1, 2009; 179(7): 524 - 525.
[Full Text] [PDF]


Home page
Br J OphthalmolHome page
A M A. El-Asrar, S Struyf, J Van Damme, and K Geboes
Circulating fibrocytes contribute to the myofibroblast population in proliferative vitreoretinopathy epiretinal membranes
Br J Ophthalmol, May 1, 2008; 92(5): 699 - 704.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
N. C. Henderson, A. C. Mackinnon, S. L. Farnworth, T. Kipari, C. Haslett, J. P. Iredale, F.-T. Liu, J. Hughes, and T. Sethi
Galectin-3 Expression and Secretion Links Macrophages to the Promotion of Renal Fibrosis
Am. J. Pathol., February 1, 2008; 172(2): 288 - 298.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
J. Murphy, R. Summer, and A. Fine
Stem Cells in Airway Smooth Muscle: State of the Art
Proceedings of the ATS, January 1, 2008; 5(1): 11 - 14.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. M. Vannella, T. R. McMillan, R. P. Charbeneau, C. A. Wilke, P. E. Thomas, G. B. Toews, M. Peters-Golden, and B. B. Moore
Cysteinyl Leukotrienes Are Autocrine and Paracrine Regulators of Fibrocyte Function
J. Immunol., December 1, 2007; 179(11): 7883 - 7890.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
H. R. Collard, B. B. Moore, K. R. Flaherty, K. K. Brown, R. J. Kaner, T. E. King Jr., J. A. Lasky, J. E. Loyd, I. Noth, M. A. Olman, et al.
Acute Exacerbations of Idiopathic Pulmonary Fibrosis
Am. J. Respir. Crit. Care Med., October 1, 2007; 176(7): 636 - 643.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
A. Medina, R. T. Kilani, N. Carr, E. Brown, and A. Ghahary
Transdifferentiation of Peripheral Blood Mononuclear Cells into Epithelial-Like Cells
Am. J. Pathol., October 1, 2007; 171(4): 1140 - 1152.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Pilling, D. Roife, M. Wang, S. D. Ronkainen, J. R. Crawford, E. L. Travis, and R. H. Gomer
Reduction of Bleomycin-Induced Pulmonary Fibrosis by Serum Amyloid P
J. Immunol., September 15, 2007; 179(6): 4035 - 4044.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
B. N. Gomperts and R. M. Strieter
Fibrocytes in lung disease
J. Leukoc. Biol., September 1, 2007; 82(3): 449 - 456.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. M. Hong, J. A. Belperio, M. P. Keane, M. D. Burdick, and R. M. Strieter
Differentiation of Human Circulating Fibrocytes as Mediated by Transforming Growth Factor-beta and Peroxisome Proliferator-activated Receptor {gamma}
J. Biol. Chem., August 3, 2007; 282(31): 22910 - 22920.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Y. Ishida, A. Kimura, T. Kondo, T. Hayashi, M. Ueno, N. Takakura, K. Matsushima, and N. Mukaida
Essential Roles of the CC Chemokine Ligand 3-CC Chemokine Receptor 5 Axis in Bleomycin-Induced Pulmonary Fibrosis through Regulation of Macrophage and Fibrocyte Infiltration
Am. J. Pathol., March 1, 2007; 170(3): 843 - 854.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Sakai, T. Wada, H. Yokoyama, M. Lipp, S. Ueha, K. Matsushima, and S. Kaneko
Secondary lymphoid tissue chemokine (SLC/CCL21)/CCR7 signaling regulates fibrocytes in renal fibrosis
PNAS, September 19, 2006; 103(38): 14098 - 14103.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
B. B. Moore, L. Murray, A. Das, C. A. Wilke, A. B. Herrygers, and G. B. Toews
The Role of CCL12 in the Recruitment of Fibrocytes and Lung Fibrosis
Am. J. Respir. Cell Mol. Biol., August 1, 2006; 35(2): 175 - 181.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
D. Pilling, N. M. Tucker, and R. H. Gomer
Aggregated IgG inhibits the differentiation of human fibrocytes
J. Leukoc. Biol., June 1, 2006; 79(6): 1242 - 1251.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
C. Balmelli, N. Ruggli, K. McCullough, and A. Summerfield
Fibrocytes are potent stimulators of anti-virus cytotoxic T cells
J. Leukoc. Biol., June 1, 2005; 77(6): 923 - 933.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
B. B. Moore, J. E. Kolodsick, V. J. Thannickal, K. Cooke, T. A. Moore, C. Hogaboam, C. A. Wilke, and G. B. Toews
CCR2-Mediated Recruitment of Fibrocytes to the Alveolar Space after Fibrotic Injury
Am. J. Pathol., March 1, 2005; 166(3): 675 - 684.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
A. B. Stavitsky
Regulation of Granulomatous Inflammation in Experimental Models of Schistosomiasis
Infect. Immun., January 1, 2004; 72(1): 1 - 12.
[Full Text] [PDF]


Home page
JEMHome page
T. Schuler, S. Kornig, and T. Blankenstein
Tumor Rejection by Modulation of Tumor Stromal Fibroblasts
J. Exp. Med., November 17, 2003; 198(10): 1487 - 1493.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Pilling, C. D. Buckley, M. Salmon, and R. H. Gomer
Inhibition of Fibrocyte Differentiation by Serum Amyloid P
J. Immunol., November 15, 2003; 171(10): 5537 - 5546.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Kimatrai, C. Oliver, A. C. Abadia-Molina, J. M. Garcia-Pacheco, and E. G. Olivares
Contractile Activity of Human Decidual Stromal Cells
J. Clin. Endocrinol. Metab., February 1, 2003; 88(2): 844 - 849.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Wu, C. Metz, X. Xu, R. Abe, A. W. Gibson, J. C. Edberg, J. Cooke, F. Xie, G. S. Cooper, and R. P. Kimberly
A Novel Polymorphic CAAT/Enhancer-Binding Protein {beta} Element in the FasL Gene Promoter Alters Fas Ligand Expression: A Candidate Background Gene in African American Systemic Lupus Erythematosus Patients
J. Immunol., January 1, 2003; 170(1): 132 - 138.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
H Nakayama, H Enzan, E Miyazaki, and M Toi
{alpha} Smooth muscle actin positive stromal cells in gastric carcinoma
J. Clin. Pathol., October 1, 2002; 55(10): 741 - 744.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
R. E. Gerszten
Pleiotropic Effects of Chemokines in Vascular Lesion Development
Arterioscler Thromb Vasc Biol, April 1, 2002; 22(4): 528 - 529.
[Full Text] [PDF]


Home page
FASEB J.Home page
I. HARTLAPP, R. ABE, R. W. SAEED, T. PENG, W. VOELTER, R. BUCALA, and C. N. METZ
Fibrocytes induce an angiogenic phenotype in cultured endothelial cells and promote angiogenesis in vivo
FASEB J, October 1, 2001; 15(12): 2215 - 2224.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. Hirohata, T. Yanagida, T. Nagai, T. Sawada, H. Nakamura, S.'i. Yoshino, T. Tomita, and T. Ochi
Induction of fibroblast-like cells from CD34+ progenitor cells of the bone marrow in rheumatoid arthritis
J. Leukoc. Biol., September 1, 2001; 70(3): 413 - 421.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Abe, S. C. Donnelly, T. Peng, R. Bucala, and C. N. Metz
Peripheral Blood Fibrocytes: Differentiation Pathway and Migration to Wound Sites
J. Immunol., June 15, 2001; 166(12): 7556 - 7562.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
Y. Ogawa, K. Yamazaki, M. Kuwana, Y. Mashima, Y. Nakamura, S. Ishida, I. Toda, Y. Oguchi, K. Tsubota, S. Okamoto, et al.
A Significant Role of Stromal Fibroblasts in Rapidly Progressive Dry Eye in Patients with Chronic GVHD
Invest. Ophthalmol. Vis. Sci., January 1, 2001; 42(1): 111 - 119.
[Abstract] [Full Text]


Home page
Am. J. Pathol.Home page
G. Majno
Chronic Inflammation : Links with Angiogenesis and Wound Healing
Am. J. Pathol., October 1, 1998; 153(4): 1035 - 1039.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chesney, J.
Right arrow Articles by Bucala, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chesney, J.
Right arrow Articles by Bucala, R.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS