| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
The Picower Institute for Medical Research, Laboratory of Medical Biochemistry, Manhasset, NY 11030; and
Case Western Reserve University, Department of Molecular Biology and Microbiology, Cleveland, OH 44106
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, JE/MCP, MIP-1, MIP-1ß,
MIP-2, PDGF-A, TGF-ß1, and M-CSF. The addition of IL-1ß (1–100
ng/ml), a critical mediator in wound healing, to fibrocytes isolated
from human peripheral blood induced the secretion of chemokines
(MIP-1, MIP-1ß, MCP-1, IL-8, and GRO), hemopoietic growth
factors (IL-6, IL-10, and macrophage-CSF), and the fibrogenic cytokine
TNF-. By contrast, IL-1ß decreased the constitutive secretion of
type I collagen as measured by ELISA. Additional evidence for a role
for fibrocytes in collagen production in vivo was obtained in studies
of livers obtained from Schistosoma japonicum-infected
mice. Mouse fibrocytes localized to areas of granuloma formation and
connective matrix deposition. We conclude that fibrocytes are an
important source of cytokines and type I collagen during both the
inflammatory and the repair phase of the wound healing response.
Furthermore, IL-1ß may act on fibrocytes to effect a phenotypic
transition between a repair/remodeling and a proinflammatory mode. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
stimulate connective tissue cells to proliferate and to secrete
extracellular matrix proteins (4). The normal outcome of this cascading
series of events is elimination of the invasive stimulus followed by
connective tissue scar formation and, over time, by remodeling of the
injured site.
We recently described a population of novel, blood-borne
fibroblast-like cells that rapidly enter sites of tissue injury and
contribute to connective tissue scar formation (5, 6, 7). Termed
fibrocytes, these cells comprise 
0.5% of peripheral blood
leukocytes and display an adherent, spindle-shaped morphology (Ref. 5
and J. Chesney, unpublished observations). Fibrocytes obtained
from blood express the fibroblast products collagen I, collagen III,
and fibronectin, as well as the leukocyte common Ag CD45RO, the
pan-myeloid Ag CD13, and the hemopoietic stem cell Ag CD34. Fibrocytes
do not synthesize epithelial (cytokeratin), endothelial (von Willebrand
factor VIII-related protein), or smooth muscle (-actin) cell markers
and are negative for nonspecific esterases as well as the
monocyte/macrophage-specific markers CD14 and CD16 (5). Fibrocytes also
do not express proteins produced by dendritic cells or their precursors
(CD25, CD10, and CD38) or by the pan-B cell Ag CD19 (5, 8, 9, 10).
In the present study, we report that fibrocytes isolated from wound
chambers or peripheral blood express cytokines and type I collagen.
Mouse fibrocytes participating in tissue repair in vivo were found to
express type I collagen and inflammatory cytokine mRNAs and were
identified to localize to areas of matrix deposition in
Schistosoma japonicum-infected, granulomatous livers. In
vitro, IL-1ß and TNF- stimulated inflammatory cytokine secretion
by human peripheral blood fibrocytes, while IL-1ß inhibited type I
collagen synthesis. IL-1ß, an important mediator of wound healing
responses, may play an important role in effecting a fibrocyte
transition from a "repair" to a "proinflammatory"
phenotype.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
BALB/c and C57BL/6 mice (18–20 gm) of both sexes were purchased from The Jackson Laboratory, Bar Harbor, ME.
Fibrocyte isolation from peripheral blood
Fibrocytes were harvested and cultured as previously described (5, 6). Briefly, total PBMCs first were isolated from human or murine blood by centrifugation over Ficoll-Paque (Pharmacia, Uppsala, Sweden) following the manufacturer’s protocol. After overnight culture on fibronectin-coated plates (6-well plates, 5 x 106 PBMCs/well) (Becton Dickinson Labware, Bedford, MA) in DMEM (Life Technologies, Gaithersburg, MD) supplemented with 20% FCS (HyClone Labs, Logan, UT), the nonadherent cells were removed by a single, gentle aspiration. Following 10 days of continuous culture, the adherent cells were lifted by incubation in cold 0.05% EDTA/PBS and were depleted by immunomagnetic selection of contaminating T cells (Dynabeads M-450 pan-T, anti-CD2, Dynal, Lake Success, NY), monocytes (Dynabeads M-450 anti-CD14, Dynal), and B cells (Dynabeads M-450 Pan-B, anti-CD19, Dynal). Fibrocyte purity was verified to be >95% (70–80% before depletion of contaminating cells) by FACS analysis (described below). Cell viability was determined to be >90% by trypan blue exclusion.
FACS analysis
2 x 105 purified fibrocytes/sample were washed twice in PBS containing 0.1% sodium azide (Sigma Chemical Co., St. Louis, MO) and 1% BSA (Sigma). The cells were resuspended in 25 µl of diluted Ab (in PBS) and incubated for 30 min on ice (11). The cells then were washed twice and resuspended in 200 µl of PBS. At least 10,000 cells were analyzed on a FACScan instrument (Becton Dickinson). Cells were stained using both phycoerythrin-conjugated anti-CD34 mAb (clone 8G12) (Becton Dickinson) and fluorescein-conjugated anti-collagen I mAb (clone MAB1340) (Chemicon, Temecula, CA). For controls, directly conjugated isotype controls and cell-only samples were analyzed with each Ab.
Protein secretion studies
Purified human fibrocytes were cultured in six-well
fibronectin-coated flat-bottom plates (1 x 105
cells/well) in DMEM supplemented with 2% heat-inactivated FCS
(HyClone). Cells were incubated for 16 h alone as control or in
the presence of IL-1ß, IFN-
, platelet-derived growth factor
(PDGF-BB),2 TGF-ß1, or
TNF- (each at 1, 10, or 100 ng/ml; R&D Systems, Minneapolis, MN).
Conditioned medium was analyzed with the following ELISA kits: GRO,
IL-1ß, IL-3, IL-4, IL-6, IL-8, IL-12, monocyte chemotactic protein
(MCP)-1, TGF-ß1, PDGF-AB, and macrophage-CSF (R&D Systems); IFN-
and IL-10 (Genzyme, Cambridge, MA); and IFN- (Biosource, Camarillo,
CA). Macrophage migration-inhibitory factor (MIF), TNF-, macrophage
inflammatory protein (MIP)-1 and MIP-1ß ELISAs were performed as
previously described (12, 13, 14). PDGF-AA was analyzed by sandwich ELISA
employing a mouse anti-PDGF-AA capture Ab, a polyclonal rabbit
anti-PDGF-AB detector, and purified PDGF-AA as standard (R&D
Systems). Type I collagen was analyzed by sandwich ELISA employing a
mouse monoclonal anti-type I collagen capture Ab (Chemicon), a
polyclonal rabbit anti-type I collagen (Accurate, Westbury, NY),
and purified human type I collagen as standard (Becton Dickinson)
(detection limit = 1 ng/ml). Data are expressed as mean ± SD
(n = 3 assays of duplicate wells).
Cell proliferation assay
Purified human fibrocytes were cultured in 96-well flat-bottom
plates (5 x 103 cells/well) in DMEM supplemented
with 2% heat-inactivated FCS (HyClone). Cells were incubated for
32 h alone as control or in the presence of IL-1ß, IFN-,
PDGF-BB, TGF-ß1, or TNF- (each at 1, 10, or 100 ng/ml). The
proliferative activity was measured by direct cell enumeration and by
the incorporation of [3H]thymidine (4 µCi/ml) into DNA
over the last 12 h of incubation as measured by liquid
scintillation counting. Data are expressed as the mean ± SD
(n = 3).
Cell migration studies
IL-1ß or TNF- (each at 1, 10, and 100 ng/ml) diluted in
DMEM supplemented with 2% heat-inactivated FCS were added to the lower
chambers of a 24-well chemotaxis insert plate (8-µm pores) (Becton
Dickinson Labware). 2 x 104 fibrocytes in the
same medium with or without cytokines were then added to the upper
wells. After incubation for 4 h at 37°C, the nonmigrating cells
were washed from the upper surface of the filters. The membranes were
then removed, fixed in 10% buffered neutral formalin, and stained with
Diff-Quik (Sigma). Fibrocytes that migrated through the membrane were
enumerated by light microscopy in five 200x fields. Data are expressed
as the mean ± SD.
Isolation of wound chamber cells
BALB/c mice were anesthetized by i.p. injection of sodium
pentobarbital (40 mg/kg), and an 0.5-cm dorsal midline incision was
made using aseptic technique. After dissecting a s.c. pocket, a single
sterile wound chamber consisting of a perforated 3.5-cm piece of
silicone tubing (Dow Corning, Midland, MI) containing a strip of
polyvinyl alcohol sponge (Unipoint Inc., High Point, NC) was
inserted along each flank. After 5 days, the mice were killed by
CO2 asphyxiation, and the wound chambers were removed under
strict aseptic conditions. The cells that had infiltrated the wound
chambers were dispersed by trituration in ice-cold PBS containing
0.05% EDTA, centrifuged, and purified into three distinct cell
populations by immunomagnetic separation following the manufacturer’s
protocol: 1) fibrocytes: biotinylated anti-CD34, clone RAM34,
PharMingen, San Diego, CA; Dynabeads M-280 Streptavidin, Dynal; 2) T
cells: pan-T, anti-CD90, Dynal; 3) macrophages: anti-CD14, rat
IgG1, clone rmC5-3, PharMingen; Dynabeads M-450 sheep anti-rat IgG,
Dynal. To verify the purity of each cell fraction, a subset of cells
was cultured in RPMI, 10% FCS, for 12 h, separated from the
magnetic beads, and examined using spot immunofluorescence analysis.
The CD34 fraction was found to be 83 ± 2% CD34+
(anti-CD34, clone RAM34, PharMingen), 79 ± 6%
CD45+ (anti-CD45, clone 30F11.1, PharMingen), and
94 ± 2% collagen I+ (anti-collagen I, clone
T40775R; Biodesign, Kennebunk, ME). The CD90 fraction was found to be
76 ± 3% CD3+ (CD3, clone 145–2C11, PharMingen)
and the CD14 fraction was found to be 87 ± 5% CD14+
(CD14, clone rmC5–3, PharMingen). Overall cell viability was
>90%.
mRNA expression by wound chamber cells
Total cellular RNA was isolated by a modified guanidinium
isothiocyanate method (RNAzol, Cinna Biotecx, Friendswood, TX) within
20 min of the start of the wound chamber cell isolation procedure. cDNA
was prepared from 1.0 µg of total RNA using 0.25 ng of
oligo(dT)12–18 and Superscript II following the
manufacturer’s protocol (Life Technologies, Grand Island, NY).
Two-microliter aliquots of cDNA were then amplified by PCR in a
Perkin-Elmer model 9600 thermal cycler (Norwalk, CT) using the primers
listed below and the following cycling program: denaturation for
15 s at 95°C, annealing for 20 s at 55°C, and extension
for 30 s at 72°C for 28 cycles (except ß-actin, 22 cycles)
with a final extension for 5 min at 72°C. Amplimer sets consisting of
presynthesized PCR primer pairs were used for the following mouse
mRNAs: IFN- (294 bp), IFN- (365 bp), IL-3 (496 bp), IL-6 (638
bp), IL-10 (455 bp), M-CSF (397 bp), TGF-ß1 (525 bp), and TNF-
(354 bp) (Clontech, Palo Alto, CA). The following mouse mRNA primer
pairs were custom synthesized: ß-actin, 5'GTGGGCCGCTCTAGGCACCA3',
5'TGGCCT-TAGGGTGCAGGGGG3' (236 bp); CD3, 5'TCTATCCAGCACCCAGAATC3',
5'AGTAGGGGGCACTCTGTAAA3' (269 bp); CD14, 5'GTCCTTAAAGCGGCTTACGG3',
5'GCGCTAAAACTTGGAGGGCT3' (399 bp); CD34,
5'AGACTCAGGGAAAGGCCAAT3', 5'TGAAGGCAGCATGAAGTCAG3' (168 bp); IL-12,
5'GAAGACGGCCAGAGAAAAAC3', 5'GCAGAGTCTCGCCATTATGA3' (357 bp);
JE/MCP, 5'ACCAGCCAACTCTCACTGAA3', 5'TGAAGACCTTAGGGCAGATG3' (360
bp), KC, 5'CTGTCAGTGCCTGCAGACCA3', 5'CCAAGGGAGCTTCAGGGTCA3' (132
bp); PDGF-A, 5'CTCCGTAGGGGCTGAGGATG3',
5'CTCCTCCTCCCGATGGTCTG3', (404 bp); PDGF-B,
5'GCCGCCAGCGCCCATCTTAT3', 5'CGGGCAGGGAGAGGTGCAAA3' (332 bp);
IL-1ß, 5'GCTGGAGAGTGTGGATCCCA3', 5'GCTGTCTGCTCATTCATGAC3' (301
bp); MIP-1, 5'TTGTCACCAGACGCGGTGTG3', 5'GGCAATCAGTTCCAGGTCAG3'
(282 bp); MIP-1ß, 5'CTCTGCGTGTCTGCCCTCTC3',
5'GACCATCTCCATGGGAGAGA3' (490 bp); and MIP-2,
5'TCTTCCTCGGGCACTCCAGA3', 5'GGACAGCAGCCCAGGCTCCT3' (378 bp) (Life
Technologies).
Immunohistochemistry
C57BL/6 mice were infected by the s.c. route with 25 cercariae of a Philippine strain of S. japonicum cercariae at Lowell University, Lowell, MA (National Institute of Allergy and Infectious Diseases Supply Contract AI-02636) (15). After 14 wk of infection, the livers were removed, fixed in 10% buffered neutral formalin, embedded in paraffin, sectioned, and processed for immunohistochemical analyzes. After blocking endogenous peroxidases with H2O2 (3%), the deparaffinized sections were incubated with an anti-CD34 mAb (1:50 dilution) (clone QB-END/10) (Accurate) or an IgG1 isotype control. The sections were then washed, and an immunoperoxidase-linked secondary Ab (Dako, Copenhagen, Denmark) was added, followed by diaminobenzidene as substrate. Control sections were stained with an isotype control or without primary Ab and showed no immunoreactivity. Adjacent sections also were stained with Masson’s Trichrome (Sigma) to visualize connective tissue matrix.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
).
Fibrocytes also expressed detectable levels of mRNAs for the
pro-inflammatory cytokines, IL-1ß and TNF-, and the
anti-inflammatory cytokine, IL-10. Chemokine mRNAs were expressed
by all 3 cell types. By comparing the intensities of the DNA
amplification products, fibrocytes appeared to express the highest
levels of MIP-1 and MIP-2. Fibrocytes also expressed high levels of
mRNA for the fibrogenic growth factors, PDGF-A and TGF-ß1, and the
hemopoietic growth factor M-CSF when compared with monocytes or T
cells. Fibrocytes did not express detectable levels of IFN-, IL-3,
IL-6, or PDGF-B (Fig. 1 and data not shown).
|
). Purified peripheral blood fibrocytes
thus were found to constitutively secrete the chemokines, MIP-1,
MIP-1ß, MCP-1, and the ß chemokines: IL-8 and GRO (Fig. 3). The addition of the proinflammatory
cytokines, IL-1ß or TNF-, to fibrocyte cultures increased the
secretion of these mediators.
|
|
(Fig. 4A). IL-6 also is
produced by fibrocytes upon stimulation with IL-1ß or TNF- (Fig. 4B). IL-10 is an "anti-inflammatory" cytokine
and may play an important role in the wound-healing response by acting
as a potent mitogen for mast cells (17). IL-10 was found to be secreted
by peripheral blood fibrocytes when induced by IL-1ß or TNF- (Fig. 4C). IL-3 synergizes with IL-6, M-CSF, or IL-10 to
induce stem cell differentiation and/or proliferation (19, 20, 21).
However, peripheral blood fibrocytes did not secrete IL-3, either
constitutively or when induced by IL-1ß, TNF-, PDGF-BB, TGF-ß1,
or IFN- (detection limit = 24 pg/ml) (data not shown).
|
, PDGF-AB/AA, and TGF-ß1 each have been found to be
present in the tissue repair microenvironment and have been implicated
in the stimulation of fibrogenic responses in vivo (4). Peripheral
blood fibrocytes constitutively secrete appreciable levels of TGF-ß1
and secrete TNF- upon induction with IL-1ß (Fig. 5). However, fibrocytes do not secrete
IL-1ß (detection limit = 3.9 pg/ml), PDGF-AB (detection
limit = 8.4 pg/ml), PDGF-AA (detection limit = 1.5 ng/ml), or
MIF (detection limit = 0.15 ng/ml) either constitutively or after
stimulation with IL-1ß, TNF-, PDGF-BB, TGF-ß1, or IFN- (data
not shown).
|
inhibits proliferation and
collagen synthesis by connective tissue fibroblasts in vitro and that
IL-1ß, TNF-, PDGF-BB, and TGF-ß1 can stimulate these activities
(4). IFN- did not inhibit fibrocyte proliferation or constitutive
collagen expression and, of the fibrogenic cytokines tested (IL-1ß,
TNF-, PDGF-BB, and TGF-ß1), only IL-1ß was found to affect
collagen expression and proliferation (Figs. 6 and 7 and data not shown). The
proliferative response of fibrocytes to IL-1ß in vitro was confirmed
by direct cell enumeration (control, 5.6 ± 0.33 x
103 cells; IL-1ß-stimulated (100 ng/ml at 12 h),
8.7 ± 0.45 x 103 cells, p <
0.05). IL-1ß also stimulated fibrocyte migration; however, the potent
tissue fibroblast chemoattractants PDGF-BB and TGF-ß1 were not found
to affect fibrocyte movement (Fig. 8 and
data not shown).
|
|
shows a section of liver obtained 14 wk
after infection in which numerous CD34+ cells can be seen
to localize to areas of connective tissue matrix deposition (compare
Fig. 9, A and B to
E and F). No CD34+ fibrocytes
could be detected in normal, uninfected livers (data not shown). These
data suggest that fibrocytes contribute to the fibrotic pathology that
occurs as a consequence of S. japonicum infection.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Studies leading to the identification and purification of the fibrocyte, a blood-borne cell that expresses collagen, together with the hemopoietic/leukocyte cell surface markers CD34 and CD45RO, suggest that this cell type constitutes a previously unrecognized circulating, fibroblast-like cell population (5). The isolation and culture of these cells in high purity (>95% positivity for both CD34 and collagen I) provides evidence for a cell type distinct from that described previously (29, 30) including a population originally identified by Ross and Lillywhite in 1965 (31), who traced the appearance of a blood-borne, connective tissue-like cell type to contamination from local tissue sources. Peripheral blood fibrocytes account for as many as 10% of the inflammatory cells that infiltrate sites of acute injury and have been identified to be present in cutaneous scar tissue (5).
In the current study, mouse fibrocytes participating in tissue repair
were found to express the mRNAs for type I collagen and inflammatory
cytokines and to be present in significant numbers in areas of matrix
deposition in S. japonicum-infected granulomatous livers.
Human peripheral blood fibrocytes constitutively secrete type I
collagen and are a particularly abundant source of the chemokines
MIP-1, MIP-1ß, MCP-1, IL-8, and GRO and the hemopoietic growth
factors IL-6, IL-10, and M-CSF. Both cytokine and collagen expression
were found to occur in a regulated fashion. IL-1ß and TNF-, two
early mediators of the wound-healing response (4), stimulate chemokine
and hemopoietic growth factor secretion by peripheral blood fibrocytes
in vitro, whereas IL-1ß inhibits type I collagen synthesis.
IL-1ß is expressed within 24 h of an injury and is essential for
the generation of inflammatory and reparative responses in vivo (32).
IL-1ß up-regulates the expression of adhesion molecules expression by
endothelial cells (ELAM-1, VCAM-1, ICAM-1) and stimulates endothelial
cell and fibroblast proliferation and matrix production (4, 33).
Studies employing IL-1 receptor antagonists in vivo have established
that IL-1ß is an absolute requirement forconnective tissue scar
formation (34). IL-1ß may function to maintain peripheral blood
fibrocytes in a proinflammatory state early in wound repair, resulting
in the increased production of molecules that recruit and expand the
inflammatory cell population within the wound environment. The
infiltration of CD4+ T cells into areas of tissue damage is
considered a critical requirement for the generation of Ag-specific
immunity (1). The fibrocyte products MIP-1, MIP-1ß, and MCP-1 are
potent T cell chemoattractants and may act to specifically recruit
CD4+ T cells into the tissue repair
microenvironment (35). Recently, fibrocytes have been
identified to be especially potent stimulators of Ag-specific
CD4+ T cell proliferation in vivo (6). Fibrocytes thus may
function not only to recruit but also to activate CD4+ T
cells during tissue repair and may play an important role in the
initiation of Ag-specific immunity.
The ability of fibrocytes to both recruit and activate T cells and to secrete type I collagen suggests that these cells may play a critical role in certain connective tissue disorders. A persistent fibrocyte:T cell activation response, for instance, may lead to pathologically significant fibrosis. T cells are essential for the development of schistosomiasis, and the localization of fibrocytes to areas of matrix deposition suggests that these cells may be an important source of collagen production in schistosome-infected liver. Fibrocytes also may participate in the generation of excessive fibroses in certain autoimmune disorders that involve persistent T cell activation, such as scleroderma and graft vs host disease. Further investigation into the function of this novel cell population may provide important insight into the control of the fibrotic responses associated with inflammation.
|
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Abbreviations used in this paper: PDGF, platelet-derived growth factor; MCP-1, monocyte chemotactic protein 1; M-CSF, macrophage colony-stimulating factor; MIP, macrophage inflammatory protein; MIF, macrophage migration inhibitory factor; GRO, growth stimulatory activity..
Received for publication May 29, 1997. Accepted for publication September 16, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and other growth factors in vivo: analysis by mRNA typing. Science 241:708.
B and cytokine-inducible enhancers. FASEB J. 9:899.[Abstract]
and MIP-1ß chemokines attract distinct populations of lymphocytes. J. Exp. Med. 177:1821.This article has been cited by other articles:
|
|
 |
|
  B. B. Moore Fibrocytes as Potential Biomarkers in Idiopathic Pulmonary Fibrosis Am. J. Respir. Crit. Care Med., April 1, 2009; 179(7): 524 - 525. [Full Text] [PDF]
|
|
|
|
 |
|
 A M A. El-Asrar, S Struyf, J Van Damme, and K Geboes Circulating fibrocytes contribute to the myofibroblast population in proliferative vitreoretinopathy epiretinal membranes Br. J. Ophthalmol., May 1, 2008; 92(5): 699 - 704. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. C. Henderson, A. C. Mackinnon, S. L. Farnworth, T. Kipari, C. Haslett, J. P. Iredale, F.-T. Liu, J. Hughes, and T. Sethi Galectin-3 Expression and Secretion Links Macrophages to the Promotion of Renal Fibrosis Am. J. Pathol., February 1, 2008; 172(2): 288 - 298. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Murphy, R. Summer, and A. Fine Stem Cells in Airway Smooth Muscle: State of the Art Proceedings of the ATS, January 1, 2008; 5(1): 11 - 14. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. M. Vannella, T. R. McMillan, R. P. Charbeneau, C. A. Wilke, P. E. Thomas, G. B. Toews, M. Peters-Golden, and B. B. Moore Cysteinyl Leukotrienes Are Autocrine and Paracrine Regulators of Fibrocyte Function J. Immunol., December 1, 2007; 179(11): 7883 - 7890. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. R. Collard, B. B. Moore, K. R. Flaherty, K. K. Brown, R. J. Kaner, T. E. King Jr., J. A. Lasky, J. E. Loyd, I. Noth, M. A. Olman, et al. Acute Exacerbations of Idiopathic Pulmonary Fibrosis Am. J. Respir. Crit. Care Med., October 1, 2007; 176(7): 636 - 643. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Medina, R. T. Kilani, N. Carr, E. Brown, and A. Ghahary Transdifferentiation of Peripheral Blood Mononuclear Cells into Epithelial-Like Cells Am. J. Pathol., October 1, 2007; 171(4): 1140 - 1152. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Pilling, D. Roife, M. Wang, S. D. Ronkainen, J. R. Crawford, E. L. Travis, and R. H. Gomer Reduction of Bleomycin-Induced Pulmonary Fibrosis by Serum Amyloid P J. Immunol., September 15, 2007; 179(6): 4035 - 4044. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. N. Gomperts and R. M. Strieter Fibrocytes in lung disease J. Leukoc. Biol., September 1, 2007; 82(3): 449 - 456. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. M. Hong, J. A. Belperio, M. P. Keane, M. D. Burdick, and R. M. Strieter Differentiation of Human Circulating Fibrocytes as Mediated by Transforming Growth Factor-beta and Peroxisome Proliferator-activated Receptor {gamma} J. Biol. Chem., August 3, 2007; 282(31): 22910 - 22920. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Ishida, A. Kimura, T. Kondo, T. Hayashi, M. Ueno, N. Takakura, K. Matsushima, and N. Mukaida Essential Roles of the CC Chemokine Ligand 3-CC Chemokine Receptor 5 Axis in Bleomycin-Induced Pulmonary Fibrosis through Regulation of Macrophage and Fibrocyte Infiltration Am. J. Pathol., March 1, 2007; 170(3): 843 - 854. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. He, C. Wan, and G. Li Concise Review: Multipotent Mesenchymal Stromal Cells in Blood Stem Cells, January 1, 2007; 25(1): 69 - 77. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Sakai, T. Wada, H. Yokoyama, M. Lipp, S. Ueha, K. Matsushima, and S. Kaneko Secondary lymphoid tissue chemokine (SLC/CCL21)/CCR7 signaling regulates fibrocytes in renal fibrosis PNAS, September 19, 2006; 103(38): 14098 - 14103. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. B. Moore, L. Murray, A. Das, C. A. Wilke, A. B. Herrygers, and G. B. Toews The Role of CCL12 in the Recruitment of Fibrocytes and Lung Fibrosis Am. J. Respir. Cell Mol. Biol., August 1, 2006; 35(2): 175 - 181. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Pilling, N. M. Tucker, and R. H. Gomer Aggregated IgG inhibits the differentiation of human fibrocytes J. Leukoc. Biol., June 1, 2006; 79(6): 1242 - 1251. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Balmelli, N. Ruggli, K. McCullough, and A. Summerfield Fibrocytes are potent stimulators of anti-virus cytotoxic T cells J. Leukoc. Biol., June 1, 2005; 77(6): 923 - 933. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. B. Moore, J. E. Kolodsick, V. J. Thannickal, K. Cooke, T. A. Moore, C. Hogaboam, C. A. Wilke, and G. B. Toews CCR2-Mediated Recruitment of Fibrocytes to the Alveolar Space after Fibrotic Injury Am. J. Pathol., March 1, 2005; 166(3): 675 - 684. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. B. Stavitsky Regulation of Granulomatous Inflammation in Experimental Models of Schistosomiasis Infect. Immun., January 1, 2004; 72(1): 1 - 12. [Full Text] [PDF]
|
|
|
|
 |
|
 T. Schuler, S. Kornig, and T. Blankenstein Tumor Rejection by Modulation of Tumor Stromal Fibroblasts J. Exp. Med., November 17, 2003; 198(10): 1487 - 1493. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Pilling, C. D. Buckley, M. Salmon, and R. H. Gomer Inhibition of Fibrocyte Differentiation by Serum Amyloid P J. Immunol., November 15, 2003; 171(10): 5537 - 5546. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Kimatrai, C. Oliver, A. C. Abadia-Molina, J. M. Garcia-Pacheco, and E. G. Olivares Contractile Activity of Human Decidual Stromal Cells J. Clin. Endocrinol. Metab., February 1, 2003; 88(2): 844 - 849. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wu, C. Metz, X. Xu, R. Abe, A. W. Gibson, J. C. Edberg, J. Cooke, F. Xie, G. S. Cooper, and R. P. Kimberly A Novel Polymorphic CAAT/Enhancer-Binding Protein {beta} Element in the FasL Gene Promoter Alters Fas Ligand Expression: A Candidate Background Gene in African American Systemic Lupus Erythematosus Patients J. Immunol., January 1, 2003; 170(1): 132 - 138. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H Nakayama, H Enzan, E Miyazaki, and M Toi {alpha} Smooth muscle actin positive stromal cells in gastric carcinoma J. Clin. Pathol., October 1, 2002; 55(10): 741 - 744. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. E. Gerszten Pleiotropic Effects of Chemokines in Vascular Lesion Development Arterioscler. Thromb. Vasc. Biol., April 1, 2002; 22(4): 528 - 529. [Full Text] [PDF]
|
|
|
|
 |
|
 I. HARTLAPP, R. ABE, R. W. SAEED, T. PENG, W. VOELTER, R. BUCALA, and C. N. METZ Fibrocytes induce an angiogenic phenotype in cultured endothelial cells and promote angiogenesis in vivo FASEB J, October 1, 2001; 15(12): 2215 - 2224. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Hirohata, T. Yanagida, T. Nagai, T. Sawada, H. Nakamura, S.'i. Yoshino, T. Tomita, and T. Ochi Induction of fibroblast-like cells from CD34+ progenitor cells of the bone marrow in rheumatoid arthritis J. Leukoc. Biol., September 1, 2001; 70(3): 413 - 421. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Abe, S. C. Donnelly, T. Peng, R. Bucala, and C. N. Metz Peripheral Blood Fibrocytes: Differentiation Pathway and Migration to Wound Sites J. Immunol., June 15, 2001; 166(12): 7556 - 7562. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Ogawa, K. Yamazaki, M. Kuwana, Y. Mashima, Y. Nakamura, S. Ishida, I. Toda, Y. Oguchi, K. Tsubota, S. Okamoto, et al. A Significant Role of Stromal Fibroblasts in Rapidly Progressive Dry Eye in Patients with Chronic GVHD Invest. Ophthalmol. Vis. Sci., January 1, 2001; 42(1): 111 - 119. [Abstract] [Full Text]
|
|
|
|
|
|
G. Majno Chronic Inflammation : Links with Angiogenesis and Wound Healing Am. J. Pathol., October 1, 1998; 153(4): 1035 - 1039. [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) and
human fibrocytes stimulated for 16 h with IL-1ß (
) or TNF-
). Measurements were performed in triplicate cultures; the data
shown are the mean ± SD of two separate experiments.
