HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Snoek, M. Articles by van Vugt, H. Search for Related Content PubMed PubMed Citation Articles by Snoek, M. Articles by van Vugt, H.

Molecular Analysis of the Major MHC Recombinational Hot Spot Located Within the G7c Gene of the Murine Class III Region That Is Involved in Disease Susceptibility¹

Margriet Snoek^2,*, Cory Teuscher and Huub van Vugt^*

^* Division of Molecular Genetics, The Netherlands Cancer Institute (Antoni van Leeuwenhoek), Amsterdam, The Netherlands; and Department of Veterinary Pathobiology, University of Illinois, Urbana, IL 61801

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Recombination within the MHC does not occur at random, but crossovers are clustered in hot spots. We previously described a recombinational hotspot within the 50-kb Hsp70.3–G7 interval in the class III region of the mouse MHC. The parental haplotypes of recombinants with crossovers in this region represent the majority of the laboratory haplotypes (a, b, d, dx, k, m, p, px, q, s, and u). Using microsatellite markers and sequence-based nucleotide polymorphisms, the breakpoint intervals of 30 recombinants were mapped to a 5-kb-long interval within the G7c gene adjacent to G7a. Recombination within the G7c hot spot does not appear to be restricted to certain haplotypes. Sequence motifs that had been suggested to be associated with site-restricted meiotic recombination were absent in the vicinity of the G7c hot spot, and hence, these sequence motifs are no prerequisite for meiotic recombination. The G7c hot spot resides in a region to which a number of disease susceptibility loci have been mapped, including susceptibility to cleft palate, experimental autoimmune allergic orchitis, and chemically induced alveolar lung tumors. The exact localization of crossovers in recombinants that have been used in functional studies is important for mapping susceptibility genes and limits the number of candidate genes.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
The mouse MHC spans a region of several Mbp, and contains class I, class II, and class III genes. The class I and class II genes fulfill important immunologic functions by encoding polymorphic molecules that present Ag to the TCR of cytotoxic and Th cells, respectively. The class III region, which lies between the class I and class II regions, contains genes coding for complement components, heat-shock proteins, TNF, and other unrelated genes. The MHC appears to be broadly conserved between mammals, while the MHC of other vertebrates also shows many similarities (reviewed in 1 . The MHC complex was discovered by transplantation studies and has been analyzed extensively. Hence, the MHC is the best-studied area of the mouse genome. Serologic typing of the highly polymorphic class I and II cell surface molecules using specific Abs facilitated the generation of congenic strains and the identification of recombinants. The first intra-H2 recombinant was described almost half a century ago, and since that time, hundreds of recombinants between the K and D regions have been generated for functional analysis of the MHC. This large number of intra-H2 recombinants and the increasing knowledge of the molecular structure of the MHC now provide an interesting genetic system to study meiotic recombination. Within the mouse MHC recombination is not random, but frequently occurs at site-specific hot spots. At least eight areas containing a recombinational hot spot have been described between the K and D region genes, a DNA interval of approximately 1500 kb. The hot spots (centromeric to telomeric) are located near Pb (2, 3), in a region between the Pb and Ob genes adjacent to Lmp2 (3), within the Tap1 gene (4), within the second intron of the Eb gene (5, 6), within the fourth intron of the Ea gene (7, 8), in a region between Ea and C4 (9), in a region between Hsp70 and Bat5 (10, 11), and in a region between Tnf and H2D (12).

Interestingly, several intra-H2 recombination sites show some allele specificity, i.e., in certain genetic crosses, the parental haplotypes seem to define which hot spot is used. This allelic dependency might be explained by the degree of homology between the parental chromosomes at the relevant DNA segments, or be dictated by signals outside the hot spot itself. Shiroishi et al. (13) showed involvement of cis-acting elements proximal to and distal of the Lmp2 hot spot, controlling strain-specific and sex-dependent recombination frequency enhancement.

In some cases, hot spot localizations are defined by restriction fragment and/or microsatellite length polymorphisms, and the crossovers are mapped to intervals of considerable length; the Pb hot spot is confined to a 15-kb segment (14), the Ea–C4 hot spot region covers an interval of 300 kb (9), and the hot spot described by Heine et al. (12) lies in the Tnf–H2D region, which is approximately 70 kb in length. Three hot spots, the Eb, Ea, and Lmp2 hot spots, have been characterized in detail, and determination of the nucleotide sequence around these hot spots confined all recombinations within relative short DNA segments of 4, 0.5, and 5 kb, respectively (3, 8, 15).

Our analysis of the mouse class III region has revealed the presence of a hot spot of recombination in the Hsp70–Bat5 interval (10). Studies using additional haplotypes likewise reported the mapping of a hot spot in the class III region. The segments described in these studies span intervals that include the Hsp70–Bat5 segment (11, 16, 17). Subsequent cloning of the region and analysis of an overlapping cosmid contig spanning the G9–G7 interval provided new polymorphic markers that enabled us to reduce the size of the 100-kb-long Hsp70–Bat5 recombination interval to a stretch of 50 kb, between Hsp70.3 and G7, or more precisely between SSLP³ marker D17Nki4 located proximal of Hsc70t, and a DraI polymorphic fragment proximal of G7 (Refs. 18 and 19 and Fig. 1). Lack of further polymorphic markers forced us to sequence the complete 50-kb interval. This stretch of DNA contains the following genes: Hsc70t, G7b, G7e, and G7a (18, 20, 21, 22).

View larger version (18K): [in this window] [in a new window]   FIGURE 1. Map of the crossover intervals in the Hsp70-G7 segment of the MHC class III region. Arrows above the genes indicate the direction of transcription. Arrows with arrowheads at both sites indicate segments without polymorphic microsatellite markers between the parental strains of the recombinants. The previously defined 50-kb crossover interval between microsatellite marker D17Nki4 and the DraI restriction site proximal to G7 was subdivided into smaller intervals by typing of additional microsatellites (see Table I); the length of the interval depends on the haplotypes involved. Lack of polymorphism between the b, d, and u haplotype reduced the size of the interval in b/d, d/b, or b/u recombinants only to 44 kb, while the polymorphisms between k and q, p and q, and s and d reduced the crossover intervals of k/q, s/d, p/q, and q/p recombinants to 2.4 kb. The recombinant haplotypes are given at the left-hand side, and the length of the intervals at the right-hand side of the arrows.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Mouse DNA

Genomic DNA was prepared from the livers of mouse strains available from The Netherlands Cancer Institute (Amsterdam, The Netherlands) or maintained in the colony of Dr. C. Teuscher (Provo, UT), or from livers obtained from Dr. D. C. Shreffler (St. Louis, MO) (B10.A(18R) and B10.BAR5). DNA samples of the strains B10.P(27R), B10.P(33R), B10.P(51R), B10.P(53R), B10.S(21R), B10.S(26R), B10.S(54R), B10.KPQ(38R), B10.BSVS(25R), B10.QP(52R), and B10.SM were supplied by McLaughlin Research Institute (Great Falls, MA) (the mice were maintained on a grant from the American Cancer Society); A.BTR1, A.BTR4, A.BTR5, A.BTR6, A.TBR12, and A.TBR15 were a kind gift of Dr. H. C. Passmore.

Simple sequence length polymorphism

The protocol for SSLP typing has been described previously (30). For every simple sequence repeat we found in the sequence between Hsp70.3 and G7, obtained from subcloned fragments of C57BL/Rij-derived cosmid DNA (18, 22), we designed primers using the computer program primer. The following primer pairs (5'–3') have been used: D17Nki4, -5, and -6 have been described before (19); D17Nki7, GATTTCTGAGTTCGAGGCCA–ATGCAGCCCTCATGTTTCTC; D17Nki8, CACTCGGGCTACACAGAGAA–ACTGCTTTGGAGTCACAGACC; D17Nki9, AGACTGGCTTCAGTAGTTGGAA–ACCCTTTAATTTTGGCCTCTG; D17Nki10, ACTGAGCCATCTCCACAACC–GAACCACTTCTCCAACTCGG; D17Nki11, GCCAGGGCTACACAGAGAAA–GCCAGGGCTACACAGAGAAA; D17Nki12, GCCAGGGCTACACAGAGAAA–ATGAAGGCTCACAACCCATC; D17Nki13, CCCAGAAGGGACAGGAGAAA–TTAAAGTCAAAGAAAGTGGGGC; D17Nki14, CTAGCAACCTGAGTATGGGAAA–GGTTCTCTGAATGGCTTATTGG; D17Nki15, GCCAAATGACAACCCAATG–AGAAAAAGTGGGGCAGAAGG; D17Nki16, CTACCTGGTTTGGGGATTTT–CTGAAGACAGCCACAGTGCA; and D17Nki17, CCAGAACCCTTCCAGACAGA–CCAGGGCTACAGAGAAACCC.

The sequence of the repeats (C57BL/Rij-derived b allele) and the length of the PCR products in a variety of parental haplotypes (b, a, d, dx, f, k, p, pz, q, s, u, and v) are listed in Table I, and their map position is indicated in Figure 1.

Primers for amplification and sequencing were chosen from the sequence surrounding the 2.4-kb interval between markers D17Nki13 and D17Nki14 (available from GenBank under accession number AF008561). Suitable PCR fragments (1–1.5 kb) were generated by amplification of genomic DNA derived from the parental haplotypes. After gel electrophoresis, the products were reamplified from a gel plug, followed by a gene clean isolation step. The fragments were subsequently subjected to cycle sequencing using the dideoxy chain-termination method and sequence-specific primers. The observed nucleotide differences between parental strains were used for typing the recombinant haplotypes.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Mapping of the hot spot using microsatellites

To improve the mapping of the class III recombinational hot spot, we searched for potential polymorphic markers in the Hsp70.3–G7 interval. Most of the intra-C4–H2D recombinants involved in our study are recombinants between the H2^{a or d} and H2^b haplotypes, i.e., recombinants of the H2^h, H2^g, or H2ⁱ haplotype. Many of these recombinants have been generated, and the majority possess their recombination sites within the class III region (31). We previously isolated all CA repeats in the G9–G7 region (19) and noticed an unexpectedly low number of polymorphic CA repeats between the relevant H2^{aor d} and H2^b haplotypes. Therefore, we searched for additional simple sequence repeats present in the Hsp70.3–G7 interval. This resulted in 11 new microsatellites; their map position with respect to the published D17Nki4, 5, 6, and the known genes are shown in Figure 1. The repeats consist of single base repeats sometimes alternated by (a few) other nucleotides (D17Nki4, 7, 9, 13, 14, 15, 17), or dimeric (D17Nki5, 6) and tetrameric (D17Nki16) repeats, or compositions of oligomeric repeats with single base repeats (D17Nki8, 10, 11, 12). In Table I, the fragment length of the different alleles is listed. Most of the repeats did not differ in length between the studied H2^a,d,b haplotypes. Typing of other haplotypes, however, revealed polymorphisms between several unrelated haplotypes (Table I). We tested the DNA samples from C4–H2D recombinants derived from haplotypes polymorphic for these repeats because implication of additional haplotypes could provide clues for the mapping of the hot spot. We typed 37 recombinants with breakpoints in the 50-kb hot spot area for the microsatellite markers. Although not all listed microsatellites are necessary for the ultimate mapping of the crossover sites of the recombinants analyzed by us, we included all possible markers since they might be informative for recombinants of haplotype combinations not assessed by us.

Typing our panel of recombinants showed that the 50-kb area is reduced to smaller or longer intervals, depending on the polymorphisms seen between the involved haplotypes (see Fig. 1). SSLP typing reduced the interval slightly for b/d, d/b recombinants to a 44-kb interval. Due to a minor difference in length of D17Nki9 between the a and b allele, the breakpoints for b/a, a/b recombinants map to a 28-kb interval. Further reduction of the recombination interval was observed for k/d, pz/q, b/k, k/b recombinants to 14.5 kb; b/p, p/b to 12.2 kb; d/dx, s/b, s/q to 6.2 kb; and for four recombinants, B10.AKM (k/q), A.TL (s/d), B10.KPQ(38R) (p/q), and B10.QP(52R) (q/p), crossovers were found in an interval as small as 2.4 kb (see Fig. 1). The various intervals, as defined by the microsatellites, all overlap at this 2.4-kb interval, suggesting that the hot spot has to be searched telomeric of G7a.

Sequence analysis of various intra-class III recombinants

These results prompted us to sequence the 2.4-kb interval, not only from the k, q, p, s, and d haplotypes, but from all of the parental haplotypes of our panel of recombinants. We searched for the presence of nucleotide polymorphisms that distinguish between the parental allelic sequences from which each crossover event was derived. We compared the nucleotide sequences derived from the a, b, d, dx, k, p, pz, q, s, and u alleles across the 2.4-kb interval as far as necessary to position the recombination breakpoints between nucleotide polymorphisms characteristic of the parental alleles. We found several nucleotide differences between the various haplotypes, almost all of which were single base substitutions. Subsequent typing revealed not only that the k/q, s/d, p/q, and q/p recombinants have a crossover breakpoint in the 2.4-kb interval, but also that we were able to map sites of meiotic recombination of 26 additional recombinants within or adjacent to this small interval. Hence, we localized the exact position of the main class III hot spot. In Figure 2, an overview of the segments containing crossover breakpoints is shown. Such a segment is defined as a sequence, identical in both parental haplotypes, bordered by nucleotides specific for one of the parental alleles, and the crossover occurred somewhere between both ends (in Fig. 2, indicated as arrows). As far as these 30 recombinants are concerned, the hot spot spans 5 kb.

View larger version (41K): [in this window] [in a new window]   FIGURE 2. Summary of 30 cases of recombination within the G7c gene. Breakpoints of the various recombinants were mapped by sequence-based nucleotide polymorphism between parental alleles. Informative polymorphic sites are indicated on the composite map at the top of the diagram. The interval between nucleotide 0–2482 corresponds to the 2.4-kb interval depicted in Figure 1. Arrows represent DNA segments of identical sequence in both parental alleles, and indicate the regions between two polymorphic markers between which the recombinants have been found to cross over.

The complete 2.4-kb interval was sequenced and compared for a variety of parental haplotypes. Only two nucleotide differences were observed between the a, d, and b haplotypes, resulting in the mapping of eight breakpoints to the hot spot interval, as indicated in Figure 2. Due to lack of nucleotide differences between the parental haplotypes, we were as yet not able to define the breakpoints for some of the tested Hsp70.3–G7 recombinants. For instance, for six additional a/b, b/a recombinants (B10.A(1R), B10.A(15R), B10.RIII(37R), B10.S(44R), B10.BAR8, B10.BAR12), we know that the breakpoints map proximal of the polymorphic nucleotide 1676. The next known polymorphic marker is microsatellite D17Nki9, which is localized centromeric at 27 kb distance. Hence, the breakpoints of these six recombinants map to that 27-kb interval.

Similarly, we did not find the exact location of the breakpoints for B10.PL(58R) and O20.Q(R15); we diminished the intervals shown in Figure 1 only slightly from the telomeric side: the crossover of the b/u recombinant B10.PL(58R) map within a 43-kb interval between D17Nki4 and nucleotide 1676, the pz/q recombinant O20.Q(R15) within a 13.5-kb interval between D17Nki10 and nucleotide 1369. For a number of recombinants, we extended the sequencing beyond the 2.4-kb interval, resulting in clarifying the crossover intervals for A.TBR12 (k/b), three s/b recombinants (B10.S(26R), B10.P(51R), and B10.P(53R)), and one s/q recombinant B10.SQR (Fig. 2). Although their crossover intervals are quite long, due to the local sequence identity between the parental s and b, s and q haplotypes, respectively (2.3 and 3.2 kb), the intervals are overlapping with the other crossover intervals. Additional sequence data of the remaining 27- and 43-kb intervals from the parental haplotypes (a, b, and u) and subsequent typing of the recombinants will indicate whether the crossovers of these recombinants are falling inside or outside the G7c hot spot.

Location of the crossover intervals

The center of the hot spot interval is located 4 kb telomeric of the poly(A) signal of G7a. Albertella et al. (32) analyzed the class III region in the human MHC and found indications for additional genes in the G7a–G7 interval. Comparison of the mouse genomic sequence with the human coding sequences revealed homologous sequences in the mouse (Albertella, personal communication). We found equivalent sequences to the two described exons of G7c just within the hot spot (see Fig. 2). Hence, meiotic recombination in the class III region preferentially occurs within the G7c gene (D17H6S56E-3); we therefore will refer to this recombinational hot spot as the G7c hot spot. Expression of the two G7c exons can be found in several mouse tissues by reverse-transcriptase analysis (unpublished data). Experiments are in progress to elucidate the complete organization of the G7c gene.

Retroviral sequences are missing from the hot spot region

Further nucleotide analysis of the G7c hot spot and comparison with the Eb and Lmp2 hot spot showed no particular shared sequences. Moreover, the suggested recombinational signals in both the Eb and Lmp2 hot spot (3, 6) MT-family repetitive sequence, long terminal repeat (LTR) and other retroviral related sequences and tetranucleotide repeats, were not found in or in the near vicinity of the G7c hot spot.

Mapping of a susceptibility gene for chemically induced lung tumors

Previously, we mapped a susceptibility gene for chemically induced lung tumors to the Hsp70.3–G7 region using strains B10.A(1R) and B10.A(2R) (29). The new data presented in this study do not alter this mapping dramatically. We now know the exact crossover site of the B10.A(2R) mouse strain (Fig. 2). However, the crossover site of B10.A(1R) is as yet not precisely known. The present data indicate that B10.A(1R) has its breakpoint proximal to nucleotide 1676, while SSLP typing reduced the left-hand border to D17Nki9. Candidate genes for the lung tumor susceptibility and the Orch1 gene are those genes located in this 27-kb-long D17Nki9–G7c interval, e.g., G7e, G7a, and G7c.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
Eight regions of clustered meiotic recombination have been described. Three of them, the Eb, Ea, and Lmp2 hot spots, are precisely mapped and fully sequenced, showing the precise crossover intervals of the recombinants. This work describes the first detailed molecular characterization of a recombinational hot spot lying outside the cluster of class II genes of the mouse MHC. We present the exact localization of the Hsp70.3–G7 hot spot in the class III region. We reduced the size of the hot spot region using microsatellites (see Fig. 1) and pinpointed the location of the recombinational hot spot by sequence-based nucleotide polymorphism analysis (see Fig. 2). The cluster of crossover sites was mapped within the G7c gene, telomeric of G7a. Analogous to the Eb, Ea, and Lmp2 hot spots, the breakpoints are clustered in a small interval. The exact breakpoints are not known, but are localized between polymorphic sites, where the parental haplotypes differ by one nucleotide. We mapped the recombinational crossover site of 30 intra-H2 recombinants to this hot spot spanning a small interval of 5 kb. The position and length of the breakpoint intervals (arrows in Fig. 2) are dependent on the haplotypes involved. Where the breakpoints are to be expected is not precisely known. In yeast, double-strand breaks are believed to be the initiation site of recombinational events. Double-strand breaks cluster as a rule in intergenic DNA segments containing transcription promoters (33). In contrast, two well-described mouse hot spots reside in introns: the Eb hot spot was mapped to the second intron of the Eb gene (34), and the Ea hot spot to the fourth intron of the Ea gene (8). From the other published hot spots it is not known whether they map within a gene. The G7c hot spot spans a region that includes at least two exons. Most of the recombinants overlap in their crossover segments, although this overlap is very small (30 bp). The A.TBR12 (k/b) crossover segment, however, only overlaps with that of B10.AKM (k/q) (see Fig. 2). This 1.9-kb-long segment and the 2.3- and 3.2-kb segments found in the s/b and s/q recombinants, respectively, span additional G7c exons (unpublished data). In theory, the breakpoints of the G7c hot spot could be localized in an intron centromeric of G7c exon a (Fig. 2), in a ±1-kb-long segment. However, this cannot be proven by a mapping approach.

Recombinations between a variety of different haplotypes have occurred in this G7c hot spot. The recombinants we tested involve the a, b, d, dx, k, p, pz, q, s, and u haplotypes. Several other laboratories reported recombinant haplotypes with class III crossovers mapping to a region that includes the Hsp70–Bat5 region described by us (10). These data indicate the potential mapping of breakpoints from crosses involving the f, cas3, and wm7 haplotypes to the G7c hot spot as well (11, 16, 17). We typed all standard laboratory haplotypes except the r haplotype. However, not many recombinants involving the r haplotype have been generated. Two recombinants have a crossover between C4 and H2D (31), potentially in the G7c hot spot, two have their crossover in the Eb gene, and one between Bat5 and H2D (16). Hence, the G7c hot spot does not appear to be haplotype restricted in contrast to some other MHC hot spots. The Ea hot spot is one of the most striking examples of restricted haplotype specificity. Crossovers in the Ea hot spot have been described only for recombinants involving the p haplotype (7, 16). Moreover, the Ea hot spot is only used when the p allele is derived from the intra-H2 recombinant strain B10.F(13R), suggesting that this hot spot is exclusively active in crosses with a particular genetic makeup (12). Similarly, the Lmp2 hot spot shows breakpoint clusters in recombinants from the wm7 and cas3 haplotypes and the Pb hot spot from the cas4 haplotype (14). The Eb, Ea–C4, and G7c hot spots are the apparent recombination sites for laboratory haplotypes, and they do not appear to be restricted to certain haplotypes. The common usage of the G7c hot spot might be the reason for the outcome of our previous calculation that a disproportionally high number of recombinations between H2-K and H2D has occurred between C4 and D (35). Yoshino et al. (17) studied Ab–H2D recombinants, and observed a fifty-fifty distribution of Ea–C4 and C4–H2D recombinants. The large number of wm7 recombinants in their study might show preference for the Ea–C4 interval, as in crosses involving other haplotype breakpoints within the Ea–C4 interval are not that commonly observed.

The characteristics determining which MHC hot spot will be used in the meiotic recombination process are largely unknown. A number of sequence motifs have been implicated as potential sites for recombination, including transcriptional regulatory sequences, simple sequence repeats, MT repeats, and retroviral elements (3, 6, 36). These sequences were found within the crossover intervals of the Eb and Lmp2 hot spots. If these sequences are relevant for the meiotic crossing-over event, we would expect the same motifs in the class III hot spot as well. Similar motifs have been observed in the Hsp70.3–G7 region surrounding the G7e gene (21), which made us speculate that the breakpoints of the class III hot spot were to be found in the close vicinity of G7e. However, the cluster of crossovers was defined about 20 kb telomerically of these motifs, and thus is believed not to be involved in the recombination event. The notion that viral sequences, MT sequences, simple sequence repeats, and transcriptional regulatory sequences play a role in the regulation of meiotic crossing over was merely speculative. The abundant occurrence of these sequences throughout the mouse genome probably caused the coincidental presence of those sequences within the Eb and Lmp2 hot spot. The lack of these sequences within the G7c hot spot shows that the presence of these sequence motives is not obligatory for meiotic recombination.

The mouse MHC contains numerous regions of clustered recombinational events. This observation raises the question whether recombinational hot spots are a unique feature of the mouse MHC or whether meiotic recombination is always restricted to certain areas. We favor the second option. The reason that the phenomenon of clustered breakpoints was observed within the mouse MHC probably is due to the fact that an extremely large number of intra-H2 recombinants have been generated and that the MHC is the best-studied chromosomal segment, rather than due to special characteristics of this part of the genome. Indeed, a potential hot spot has been observed proximal to the MHC between Pim1 and Crya1 (12). Within humans, MHC recombination is also not randomly distributed, as indicated by the strong linkage disequilibrium between various highly polymorphic MHC loci. The so-called ancestral haplotypes or cold spots (37) most probably represent chromosomal stretches in between the segments in which crossovers can occur (hot spots). Recently, a recombinational hot spot was mapped to the second intron of the human TAP2 locus (38). In addition, analogous to the localization of hot spots in the mouse, the HSP70–HOM–TNF and TNF–HLA B intervals in the human MHC were found to be preferentially involved in meiotic recombination (39). Non-MHC recombinational hot spots also have been proposed in humans, e.g., near the Duchenne muscular dystrophy, insulin, collagen, and ß-globin genes (40, 41, 42).

The definition of the breakpoints in the G7c hot spot has important implications for the mapping of a number of susceptibility loci of experimentally induced diseases, including corticosteroid induced cleft palate, vitamin A-enhanced cleft palate, experimental allergic orchitis, and chemically induced lung tumors (23, 25, 27, 28, 43). In this work, we mapped a considerable number of relevant a/b, b/a, d/b, and b/d (B10.A(2R), B10.BAR6, B10.YBR, B10.A(18R), B10.BAR5, B10.HTG, B10.BSVS(25R), and B10.D2(R106)) recombinants to the G7c hot spot, all mapping to an identical breakpoint interval (Fig. 2). However, the precise location of the recombination event in a number of other tested a/b and b/a recombinants could not be identified in the hot spot region because of lack of polymorphism between the parental haplotypes. For this reason, the genotypic difference between, for instance, the B10.A(1R) and B10.A(2R) mouse strain spans, at the most, 27 kb, from polymorphic microsatellite marker D17Nki9 (Fig. 1) up to nucleotide 1676 in the hot spot interval (Fig. 2). Hence, the phenotypic differences in susceptibility to lung cancer, experimental allergic orchitis, and possibly cleft palate, as observed between B10.A(1R) and B10.A(2R), map to this 27-kb interval, which contains the G7e gene, resembling a viral envelope gene (22), the G7a gene encoding valyl-tRNA-synthetase (44), and the G7c gene, a gene with unknown function. Based on what is known on the function of these genes, it is hard to speculate which of these three candidate genes is involved in the susceptibility of the not obviously related diseases, and how one of these candidate genes is regulating the observed phenotypic differences. The ultimate proof that one of these genes is involved in disease susceptibility is supposed to result from a transgenic approach (experiments in preparation); at that point we can try to figure out the working mechanism and to investigate to which extend immunologic processes are involved. For experimental allergic orchitis, we can speculate that presentation of a class III region gene product by class II molecules is part of the mechanism. As a matter of fact, we have some indications for an I region dependency. The recombinants B10.BAR8, B10.BAR12, B10.YBR, B10.A(18R), and B10.D2(R106) carry the b allele at all of the I region genes, and are nonresponders for experimentally induced allergic orchitis, independent of their genotype at the hot spot region. Similar results were noticed for autoimmune encephalomyelitis and the autoimmune response to thyroglobulin, in which susceptibility is controlled by genetic interaction between the I region and a second gene (45, 46).

The crossover site in B10.A(2R) is assigned distal of that of B10.A(1R), which was predicted by the lung tumor susceptibility phenotype and cleft palate data, but not by the orchitis phenotype. The use of H2 congenic strains automatically leads to the anticipation that genes involved are H2 linked. However, congenic strains might still differ at non-MHC loci that might influence the phenotype. Gene interactions also play a role in susceptibility to tumor formation (47, 48), indicating the need for well-defined genetic systems to be able to draw conclusions.

Several groups have attempted to find the sequence elements that make a recombinational hot spot (reviewed by Fischer Lindahl (49)), but the suggested motifs present in the Eb and Lmp2 hot spot were not observed in the Ea and G7c hot spot (3, 6, 8, and this study). The clustering of breakpoints, marking the sites of resolution of Holliday junctions and not the site in which recombination is initiated, suggests common elements in or nearby the hot spot localization. These elements might be three-dimensional structures, for which it will be difficult to resolve the sequence consensus. At this time point, we do not know all possible crossover spots within the MHC; some of the potential hot spots might be hidden due to haplotype specificity, and for this reason, a possible regularity in physical distance between potential hot spots might escape our attention. Another intriguing question is whether recombinations outside hot spots do occur. Increasing the knowledge on the genetic composition of the MHC and mapping of crossovers might be instrumental in understanding the mechanism that regulates the localization of the breakpoints.

	Acknowledgments

 
We thank Janet Howard, Linda Mulder, and Judith Hendriks for skillful technical assistance, and Peter Demant and Anton Berns for stimulating discussions.

	Footnotes

 
¹ This work was supported in part by National Institutes of Health Grant HD21926/NS36524 (to C.T.).

² Address correspondence and reprint requests to Dr. M. Snoek, Division of Molecular Genetics, The Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX Amsterdam, The Netherlands. E-mail address:

³ Abbreviations used in this paper: SSLP, simple sequence length polymorphism; MT, family of middle repetitive sequences.

Received for publication June 26, 1997. Accepted for publication September 22, 1997.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Trowsdale, J.. 1995. "Both man & bird & beast": comparative organization of MHC genes. Immunogenetics 41:1.[Medline]
2. Steinmetz, M., Y. Uematsu, K. Fisher Lindahl. 1986. Gene organization and recombinational hotspot in the murine major histocompatibility complex. Cell 44:895.[Medline]
3. Shiroishi, T., N. Hanzawa, T. Sagai, M. Ishiura, T. Gojobori, M. Steinmetz, K. Moriwaki. 1990. Recombinational hotspot specific to female meiosis in the mouse major histocompatibility complex. Immunogenetics 31:79.[Medline]
4. Zanelli, E., P. Zhou, H. Cao, M. K. Smart, C. S. David. 1995. Genetic polymorphism of the mouse major histocompatibility complex-associated proteasome subunit Lmp7. Immunogenetics 41:251.[Medline]
5. Uematsu, Y., H. Kiefer, R. Schulze, K. Fischer Lindahl, M. Steinmetz. 1986. Molecular characterization of a meiotic recombinational hotspot enhancing homologous equal crossing-over. EMBO J. 5:2123.[Medline]
6. Zimmerer, E. J., H. C. Passmore. 1991. The Eb recombinational hotspot in the mouse. Immunogenetics 33:132.[Medline]
7. Lafuse, W. P., C. S. David. 1986. Recombination hot spots within the I region of the mouse H-2 complex map to the Eß and E genes. Immunogenetics 24:352.[Medline]
8. Khambata, S., J. Mody, A. Modzelewski, D. Heine, H. C. Passmore. 1996. Ea recombinational hot spot in the mouse major histocompatibility complex maps to the fourth intron of the Ea gene. Genome Res. 6:195.[Abstract/Free Full Text]
9. Lafuse, W. P., S. T. Lee, L. Castle, C. S. David. 1989. Restriction fragment analysis of H-2 recombinant mouse strains with crossovers between E and C4 genes. Immunogenetics 30:387.[Medline]
10. Snoek, M., P. C. Groot, T. Spies, R. D. Campbell, P. Demant. 1991. Fine mapping of the crossover-sites in the C4-H-2D region of H-2 recombinant mouse strains. Immunogenetics 34:409.[Medline]
11. Lafuse, W. D., D. Lanning, T. Spies, C. S. David. 1992. PFGE mapping and RFLP analysis of the S/D region of the mouse H-2 complex. Immunogenetics 36:110.[Medline]
12. Heine, D., S. Khambata, K. S. Wydner, H. C. Passmore. 1994. Analysis of recombinational hot spots associated with the p haplotype of the mouse MHC. Genomics 23:168.[Medline]
13. Shiroishi, T., T. Sagai, N. Hanzawa, H. Gotoh, K. Moriwaka. 1991. Genetic control of sex-dependent meiotic recombination in the major histocompatibility complex of the mouse. EMBO J. 10:681.[Medline]
14. Yoshino, M., T. Sagai, K. Fischer Lindahl, Y. Toyoda, T. Shiroishi, K. Moriwaki. 1994. No dosage effect of recombinational hotspots in the mouse major histocompatibility complex. Immunogenetics 39:391.
15. Bryda, E. C., J. A. DePari, D. B. Sant’Angelo, D. B. Murphy, H. C. Passmore. 1992. Multiple sites of crossing over within the Eb recombinational hotspot in the mouse. Mamm. Genome 2:123.[Medline]
16. Turner, S. K., C. L. Miller, P. J. Wettstein, K. J. Hasenkrug, J. H. Stimpfling, G. A. Carlson. 1993. Meiotic recombination within the H-2K-H-2D interval: characterization of a panel of congenic mice, including 12 new strains, using DNA markers. Immunogenetics 38:332.[Medline]
17. Yoshino, M., T. Sagai, K. Fischer Lindahl, Y. Toyoda, Y. Shirayoshi, K. Matsumoto, K. Sugaya, T. Ikemura, K. Moriwaki, T. Shiroishi. 1994. Recombination in the class III region of the mouse major histocompatibility complex. Immunogenetics 40:280.[Medline]
18. Snoek, M., M. Jansen, M. G. Olavesen, R. D. Campbell, C. Teuscher, H. van Vugt. 1993. Three Hsp70 genes are located in the C4-H-2D region: possible candidates for the Orch-1 locus. Genomics 15:350.[Medline]
19. Snoek, M., H. van Vugt, P. C. Groot. 1994. New microsatellite size variants as markers for a cross-over hotspot in the C4-H-2D region. Mamm. Genome 5:174.[Medline]
20. Snoek, M., M. G. Olavesen, H. van Vugt, C. M. Milner, C. Teuscher, R. D. Campbell. 1994. Coding sequences and levels of expression of Hsc70t are identical in mice with different Orch-1 alleles. Immunogenetics 40:159.[Medline]
21. Snoek, M., L. van Dinten, H. van Vugt. 1996. A novel Gene, G7e, resembling a viral envelope gene, is located at the recombinational hot spot in the class III region of the mouse MHC. Genomics 38:5.[Medline]
22. Olavesen, M. G., M. Snoek, R. D. Campbell. 1993. Localization of a new gene adjacent to the HSP70 genes in human and mouse MHCs. Immunogenetics 37:394.[Medline]
23. Teuscher, C., D. L. Gasser, S. R. Woodward, W. F. Hickey. 1990. Experimental allergic orchitis in mice. VI. Recombinations within the H-2S/H-2D interval define the map position of the H-2-associated locus controlling disease susceptibility. Immunogenetics 2:337.
24. Person, P. L., M. Snoek, P. Demant, C. Teuscher. 1992. The immunogenetics of susceptibility and resistance to murine experimental allergic orchitis. Reg. Immunol. 4:284.[Medline]
25. Gasser, D. L., K. N. Yadvish, M. A. Trammell, A. S. Goldman. 1988. Recombinants in the H-2S/H-2D interval of mouse chromosome 17 define the map position of a gene for cleft palate susceptibility. Teratology 38:571.[Medline]
26. Demant, P.. 1985. Corticosteroid-induced cleft palate: cis interaction of MHC genes and hybrid resistance. Immunogenetics 22:183.[Medline]
27. Tyan, M. L., D. B. Tyan. 1993. Vitamin A-enhanced cleft palate susceptibility gene maps between C4 and B144 within the H-2 complex. Proc. Soc. Exp. Biol. Med. 202:482.[Medline]
28. Oomen, L. C. J. M., M. A. van der Valk, P. Demant. 1991. MHC and non-MHC genes in lung tumor susceptibility in the mouse: implications for the study of the different lung tumor types and their cell of origin. Exp. Lung Res. 17:283.[Medline]
29. Fijneman, R. J. A., L. C. J. M. Oomen, M. Snoek, P. Demant. 1995. A susceptibility gene for alveolar lung tumors in the mouse maps between Hsp70.3 and G7 within the H2 complex. Immunogenetics 41:106.[Medline]
30. Moen, C. J. A., M. Snoek, A. A. M. Hart, P. Demant. 1992. Ssc-1, a novel colon cancer susceptibility gene in the mouse: linkage to CD44 (Ly-24, Pgp-1) on chromosome 2. Oncogene 7:563.[Medline]
31. Klein, J.. 1989. Congenic and segregating inbred strains. M. F. Lyon, and A. G. Searle, eds. Genetic Variants and Strains of the Laboratory Mouse 797. Oxford University Press, Oxford.
32. Albertella, M. R., H. Jones, W. Thomson, M. G. Olavesen, R. D. Campbell. 1996. Localization of eight additional genes in the human major histocompatibility complex, including the gene encoding the casein kinase II beta subunit V (CSNK 28). Genomics 36:240.[Medline]
33. Wu, T. C., M. Lichten. 1994. Meiosis-induced double-strand break sites determined by yeast chromatin structure. Science 263:515.[Abstract/Free Full Text]
34. Kobori, J. A., E. Strauss, K. Minard, L. Hood. 1986. Molecular analysis of the hotspot of recombination in the murine major histocompatibility complex. Science 234:173.[Abstract/Free Full Text]
35. Snoek, M., P. C. Groot, R. D. Campbell, T. Spies, P. Demant. 1991. Mapping of a hot spot in the major recombination area of the mouse H-2 complex. J. Klein, and D. Klein, eds. Molecular Evolution of the Major Histocompatibility Complex 383. Springer-Verlag, Heidelberg.
36. Ling, X., R. Shenkar, D. Sakai, N. Arnheim. 1993. The mouse Eb meiotic recombination hotspot contains a tissue-specific transcriptional enhancer. Immunogenetics 37:331.[Medline]
37. Degli-Esposti, M., A. Leaver, F. Christiansen, C. S. Witt, L. J. Abraham, R. L. Dawkins. 1992. Ancestral haplotypes: conserved population MHC haplotypes. Hum. Immunol. 38:242.
38. Cullen, M., H. Erlich, W. Klitz, M. Carrington. 1995. Molecular mapping of a recombination hot spot located in the second intron of the human TAP2 locus. Am. J. Hum. Genet. 56:1350.[Medline]
39. Levo, A., P. Westman, J. Partanen. 1996. An approach to mapping haplotype-specific recombination sites in human MHC class III. Immunogenetics 43:136.[Medline]
40. Lebo, R. V., A. Chakravarti, K. H. Buetow, M. Cheung, H. Cann, B. Cordell, H. Goodman. 1983. Recombination within and between the human insulin and ß-globin gene loci. Proc. Natl. Acad. Sci. USA 80:4808.[Abstract/Free Full Text]
41. Bowcock, A. M., J. M. Hebert, E. Wijsman, I. Gadi, L. L. Cavalli-Sforza, C. D. Boyd. 1988. High recombination between two physically close human basement membrane collagen genes at the distal end of chromosome 13q. Proc. Natl. Acad. Sci. USA 85:2701.[Abstract/Free Full Text]
42. Grimm, T., B. Müller, M. Dreier, E. Kind, T. Bettecken, G. Meng, C. R. Müller. 1989. Hot spot of recombination within DXS164 in Duchenne muscular dystrophy gene. Am. J. Hum. Genet. 45:368.[Medline]
43. Gasser, D. L., N. L. Sternberg, J. C. Pierce, A. Goldner-Sauve, H. Feng, A. K. Haq, T. Spies, C. Hunt, K. H. Buetow, D. D. Chaplin. 1994. P1 and cosmid clones define the organization of 280 kb of the mouse H-2 complex containing the Cps-1 and Hsp70 loci. Immunogenetics 39:48.[Medline]
44. Hsieh, S.-L., R. D. Campbell. 1991. Evidence that gene G7a in the human major histocompatibility complex encodes valyl-tRNA synthetase. Biochem. J. 278:809.
45. Linthicum, D. S., J. A. Frelinger. 1982. Acute autoimmune encephalomyelitis in mice. II. Susceptibility is controlled by the combination of H-2 and histamine sensitization genes. J. Exp. Med. 156:31.[Abstract/Free Full Text]
46. Kong, Y. M., C. S. David, A. A. Giraldo, M. Elrehewy, N. R. Rose. 1979. Regulation of autoimmune response to mouse thyroglobulin: influence of H-2D-end genes. J. Immunol. 123:15.[Abstract/Free Full Text]
47. Van Wezel, T., A. P. M. Stassen, C. J. A. Moen, A. A. M. Hart, M. A. van der Valk, P. Demant. 1996. Gene interaction and single gene effects in colon tumour susceptibility in mice. Nat. Genet. 14:468.[Medline]
48. Fijneman. R. J. A., S. S., R. C. de Vries, R. C. Jansen, P. Demant. 1996. Complex interactions of new quantitative trait loci, Sluc1, Sluc2, Sluc33, and Sluc4, that influence the susceptibility to lung cancer in the mouse. Nat. Genet. 14:465.[Medline]
49. Fischer Lindahl, K.. 1991. His and hers recombinational hotspots. Trends Genet. 7:273.[Medline]

This article has been cited by other articles:

				K. M. Puopolo, D. C. Klinzing, M. P. Lin, D. L. Yesucevitz, and M. J. Cieslewicz A composite transposon associated with erythromycin and clindamycin resistance in group B Streptococcus J. Med. Microbiol., July 1, 2007; 56(7): 947 - 955. [Abstract] [Full Text] [PDF]

				Y. Klieger, O. Yizhar, D. Zenvirth, N. Shtepel-Milman, M. Snoek, and G. Simchen Involvement of Sir2/4 in Silencing of DNA Breakage and Recombination on Mouse YACs during Yeast Meiosis Mol. Biol. Cell, March 1, 2005; 16(3): 1449 - 1455. [Abstract] [Full Text] [PDF]

				C. A. Whittaker and R. O. Hynes Distribution and Evolution of von Willebrand/Integrin A Domains: Widely Dispersed Domains with Roles in Cell Adhesion and Elsewhere Mol. Biol. Cell, October 1, 2002; 13(10): 3369 - 3387. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Snoek, M. Articles by van Vugt, H. Search for Related Content PubMed PubMed Citation Articles by Snoek, M. Articles by van Vugt, H.