The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Perkel, J. M.
Right arrow Articles by Atchison, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Perkel, J. M.
Right arrow Articles by Atchison, M. L.
The Journal of Immunology, 1998, 160: 241-252.
Copyright © 1998 by The American Association of Immunologists

A Two-Step Mechanism for Recruitment of Pip by PU.11

Jeffrey M. Perkel* and Michael L. Atchison2,*,{dagger}

* Graduate Group of Molecular Biology and {dagger} Laboratories of Biochemistry, Department of Animal Biology, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, PA 19104


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Transcription of the Ig {kappa} light chain gene is controlled in part by the 3' {kappa} enhancer. Two of the proteins that bind to the 3' enhancer, PU.1 and Pip, show tissue-restricted expression and may be responsible for the tissue specificity of 3' enhancer activity. PU.1 alone can bind to DNA; however, Pip cannot bind to its 3' enhancer site in electrophoretic mobility shift assays, unless recruited by PU.1. Previously, we showed that the PU.1 PEST domain (rich in the amino acids proline, glutamate, serine, and threonine; sequences 118–160) is necessary for Pip recruitment to DNA. Here we used detailed mutagenic analyzes of PU.1 to more precisely identify sequences required for Pip recruitment by electrophoretic mobility shift assay. We found that mutation of three segments within the PU.1 PEST domain (118–125, 133–139, and 141–147) modulated the efficiency of Pip recruitment, while mutation of sequences between residues 88–118 and 154–168 had no effect. Interestingly, we found that the PU.1 ETS domain (residues 170 to 255) is both necessary and sufficient for Pip interaction in solution and that other ETS domain proteins can physically interact with Pip as well. Our results suggest that Pip recruitment to DNA by PU.1 occurs via a two-step mechanism. First, a physical interaction that is not sufficient to recruit Pip occurs via the PU.1 ETS domain. Second, a conformational change in the PU.1 PEST domain, apparently mediated by serine phosphorylation, induces a conformational change in Pip enabling it to bind to DNA. We also show that the PU.1 PEST domain does not target PU.1 for rapid turnover.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Temporal and tissue-specific transcriptional regulation of the Ig{kappa} light chain gene is controlled by three DNA elements: the {kappa} promoter, the intron enhancer (E{kappa}), and a second enhancer located 8.5 kb downstream of the C{kappa} exon, the 3' enhancer (E{kappa}3'). The intron enhancer is activated primarily by transcription factor NF-{kappa}B (1). Activity of the 3' enhancer, however, does not require NF-{kappa}B and is therefore controlled by a distinct mechanism (2, 3). A number of proteins are known to bind to the 3' enhancer and control its activity. These proteins include Sp1, c-fos, c-jun, ATF1, CREM, PU.1, NF-EM5 (Pip), E2A, and YY1 (4, 5, 6, 7, 8). Of these enhancer-binding proteins, PU.1 and Pip are tissue restricted.

PU.1, the cellular homologue of the viral oncogene Spi-1, is a 272-amino acid-long, erythroid-, macrophage-, and B cell-specific protein related to the ets family of transcription factors (9, 10). PU.1 can control expression of a number of genes, including Ig{kappa}, Ig{lambda}, Ig J chain, c-fms, IL-1ß, and granulocyte-macrophage CSF receptor {alpha} (11, 12, 13, 14, 15, 16, 17). PU.1 overexpression can immortalize erythroblasts and appears to play an important role in the genesis of erythroleukemia (10, 18, 19, 20, 21). PU.1 is a crucial factor in hemopoetic development because homozygous knockout of the PU.1 gene results in a loss of B cells, T cells, granulocytes, and monocytes (22). In addition, oligonucleotides that contain the PU.1 DNA-binding site can inhibit hemopoetic colony formation in vitro (23). In the macrophage lineage, PU.1 appears to be necessary for terminal development (24).

Several structural features of the PU.1 protein have been identified. The amino terminus of the protein contains the transcriptional activation domain, which includes both acidic and glutamine-rich domains (25). A PEST3 domain (rich in the amino acids proline, glutamate, serine, and threonine) is located between amino acids 120 and 160, and the DNA-binding ETS domain is located between amino acids 161 and 260 (9). Although PU.1 is capable of binding to its cognate DNA site by itself, we previously identified a nuclear factor, NF-EM5, that is incapable of binding to the Ig{kappa} 3' enhancer unless it is recruited by PU.1 (6, 17). The PU.1 and NF-EM5 DNA-binding sites lie adjacent to one another within the 3' enhancer. A similar arrangement of PU.1 and NF-EM5 binding sites occurs within the Ig{lambda}2–4 enhancer (17). PU.1 sequences necessary for recruitment of NF-EM5 to DNA when assayed by electrophoretic mobility shift assay (EMSA) include amino acids 118–160 (the PEST domain; 6 . In addition, recruitment is critically dependent upon phosphorylation of serine 148 in the PU.1 PEST domain (16).

Recently, a protein with properties strongly matching those of NF-EM5 was cloned (26, 27, 28). This protein, named Pip (variously called LSIRF, ICSAT, or IRF4), is related to the IFN-regulatory factors (IRFs) and is a lymphoid-restricted transcription factor. Pip function is critical for proper immune function because disruption of the Pip gene by homologous recombination causes a deficiency in B cell Ag response and in cytotoxic and antitumor T cell activity (29). Interestingly, Pip can bind, in the absence of PU.1, to the IFN-stimulated response element (ISRE (27, 28)). However, full length Pip is unable to bind to its DNA-binding site in the 3' {kappa} and {lambda} enhancers when assayed by EMSA (26). As expected, incubation in the presence of PU.1 results in recruitment of full length Pip to these DNA-binding sites. Pip C-terminal sequences appear to mask the Pip DNA-binding domain, thus inhibiting its ability to bind to {kappa} and {lambda} enhancer sequences (30). Pip interaction with PU.1 may therefore result in a conformational change in Pip such that its DNA-binding domain becomes unmasked (30). However, the precise mechanism by which Pip is recruited to DNA by PU.1 remains unknown.

In this report, we have used mutagenesis to better define the region of PU.1 required for recruitment of Pip to its {kappa}3' enhancer-binding site by EMSA. We identified several regions within the PEST domain that either reduce or abolish Pip recruitment when deleted or mutated to alanine residues. Surprisingly, the PU.1 ETS domain, but not the PEST domain, is required for intermolecular interaction between these two proteins in solution. Taken together, our results suggest a two-step mechanism for the recruitment of Pip to DNA by PU.1. This model proposes that physical interaction occurs between PU.1 and Pip via the PU.1 ETS domain. Subsequently, a conformational change within the PU.1 PEST domain, apparently mediated by serine phosphorylation, induces a conformational change in Pip, thereby exposing the Pip DNA-binding domain.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Anti-Pip Abs

Polyclonal rabbit-anti-Pip antisera (Cocalico Biochemicals, Reamstown, PA) was prepared against polyhistidine-tagged Pip protein purified from Erichia coli BL21 cells using Ni2+-chelate chromatography (Qiagen, Santa Clarita, CA).

Construction of plasmids

The Pip cDNA-containing plasmid pPip/ATG IVT (a gift of Dr. Harinder Singh, University of Chicago, Chicago, IL (26)) was digested with HinDIII-EcoRI. The purified HinDIII-EcoRI fragment was blunted with Klenow polymerase and ligated into XmaI-digested and blunted pGEX-2TK (Pharmacia, Piscataway, NJ) to produce plasmid pGEX-Pip. Plasmid pCMV+-PU.1{Delta}PEST was created by ligation of the EcoRI insert from plasmid pKS+-PU.1{Delta}PEST into EcoRI-digested pCMV+.

The PU.1 mutants {Delta}7–30, {Delta}33–100, {Delta}1–117, {Delta}1–160, {Delta}119–160, and {Delta}245–272 were previously described (6). The PU.1 mutant {Delta}201–272 (KpnI) was constructed by excising a 0.6 kbp KpnI fragment from plasmid 25.1, containing sequences from the pKS+ polylinker and PU.1 cDNA sequences encoding amino acids 1 to 200, and ligation into KpnI-digested pKS+. The mutant {Delta}256–272 was constructed by ligation of a ~0.9 kb EcoRI-BglI fragment from the plasmid 25.1 into SmaI-digested pKS+. The Ets-1 cDNA was provided by Dr. Barbara Graves (University of Utah, Salt Lake City, UT), the Fli-1 cDNA was provided by Dr. Rich Maki (La Jolla Cancer Research Foundation, La Jolla, CA), and the Ets-2 cDNA was provided by Dr. Narayan Avadhani (University of Pennsylvania, Philadelphia, PA).

PU.1 deletion mutations were generated by PCR amplification of regions of the PU.1 cDNA clone 25.1 (9) that flank the desired deletion, followed by digestion with appropriate enzymes and ligation of the two pieces into pKS+ Bluescript (Stratagene, La Jolla, CA). The PCR reactions were conducted using 30 ng of template (25.1), 300 ng of each primer, 50 mM each of dATP, dCTP, dGTP, and dTTP, 1x PCR buffer containing 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.001% (w/v) gelatin (Perkin-Elmer/Cetus, Norwalk, CT), 2.5 U of AmpliTaq polymerase (Perkin-Elmer/Cetus), and 2.5 U of Taq Extender (Stratagene). The amplification cycle consisted of 35 cycles of denaturation for 1 min (95°C), annealing for 30 s (50°C), and polymerization for 2 min (72°C), followed by 1 cycle of polymerization for 4 min (72°C).

The T3 primer (AATTAACCCTCACTAAAGGG, Stratagene) was used in tandem with the reverse primers in Table IGo to amplify the 5' portion of PU.1, while the primer PU.1 3'UT Rev (GCGTCTAGACGGTCTCTGCGGGCGATCAGTGGGG) was used in tandem with the forward primers in Table IGo to amplify the 3' portion of PU.1. The PU.1 mutants, {Delta}154–156, {Delta}161–164, {Delta}165–168, and the alanine substitution mutants were made using the "overlap extension PCR" method (31). All PU.1 mutants generated by PCR were transcribed in vitro using T3 RNA polymerase. The oligonucleotides used to generate PU.1 mutants are shown in Table IGo.


View this table:
[in this window]
[in a new window]
 
Table I. Oligonucleotides used to generate PU.1 mutants by PCR

 
Electrophoretic mobility shift assays

Nuclear extracts were prepared from S194 plasmacytoma cells essentially as described (32), and binding reactions were performed as previously described (6). The sequence of the PU.1:Pip-binding site from the {kappa} 3' enhancer used as a probe in these assays is CTTTGAGGAACTGAAAACAGAACCT (Oligo 5). Quantification of EMSA data was conducted by PhosphorImager analysis (Molecular Dynamics, Sunnyvale, CA). For determination of off-rates, binding reactions were conducted until PU.1:Pip:DNA complex formation reached equilibrium (20 min) followed by addition of a large excess of cold competitor oligonucleotide. Aliquots were removed at various time points and loaded onto a nondenaturing gel. After electrophoresis, the fraction of probe retained in the free DNA, PU.1:DNA, and PU.1:Pip:DNA complexes were quantified using PhosphorImager analysis. The percentage of probe in the PU.1:Pip:DNA complex at a given time point (i.e., the percent of counts in the complex based upon the total number of counts in all three complexes) was normalized based upon a value of 100% for no competitor added.

Protease sensitivity studies

Conformational differences between selected PU.1 mutants were studied by partial proteolytic digestion of PU.1:DNA complexes that had formed in standard EMSA reactions, according to the method of Lodie et al. (33). After the reactions had reached equilibrium, 1 to 2 µl of solution containing either trypsin or proteinase K was added, and the reactions were allowed to proceed for 5 min at room temperature. The reactions were then stopped on ice and subjected to electrophoresis under standard EMSA conditions.

Glutathione S-transferase (GST) chromatography experiments

GST-fusion proteins were prepared essentially as described (34). Equivalent TCA-precipitable counts of [35S]-labeled rabbit reticulocyte lysate translated proteins (Promega, Madison, WI) or metabolically labeled proteins (see below) were incubated with approximately equivalent amounts (as judged by Coomasie blue staining) of GST or GST-fusion proteins bound to glutathione-agarose beads for 1 h at 4°C in NETN (100 mM NaCl, 1 mM EDTA, 20 mM Tris, pH 8.0, 0.5% Nonidet P-40). The beads were washed four to five times in NETN, and bound proteins were eluted in 1x SDS loading dye and resolved on 10% SDS polyacrylamide gels. When oligonucleotides were included in the assay, 500 ng of oligonucleotide was added. The following oligonucleotides were used: AGCAACTGTCATAGCTACCGTCACA (nonspecific (NS)), CTTTGAGGAACTGAAAACAGAACCT (PU.1:Pip).

Metabolic labeling and immunoprecipitation experiments

For metabolic labeling, a variation of the method of Luscher and Eisenman was used (35). Briefly, 3T3 fibroblasts were transfected via the CaPO4 precipitation method (36) with 10 µg of either plasmid CMV-PU.1 or CMV-PU.1{Delta}PEST, or both. Twenty-four hours later, cells were pulsed with 0.2 mCi/ml [35S] protein-labeling mix (Expre[35S][35S]; Dupont-NEN, Boston, MA) for 2 h at 37°C followed by a chase with cold methionine (0.5 mM). At the specified time points, the cells were harvested in Ab buffer (20 mM Tris, pH 7.5, 50 mM NaCl, 0.5% Nonidet P-40, 0.5% SDS, 0.5% deoxycholate, 1 mM DTT, 10 µg/ml leupeptin, 10 µg/ml N-{alpha}-p-tosyl-L-arginine methyl ester, 1 µg/ml pepstatin, 1 mM PMSF), sonicated, and clarified by centrifugation. Approximately 1.5 x 106 TCA-precipitable counts of each lysate was used in precipitations with excess anti-PU.1 Ab (Santa Cruz Biotechnology, Santa Cruz, CA), and the immune complexes were recovered using goat anti-rabbit IgG-coupled agarose beads. The immune complexes were eluted by addition of SDS loading dye, resolved on SDS polyacrylamide gels, and visualized by autoradiography.

For preparation of metabolically labeled lysates used in GST-pull down experiments, 3T3 fibroblasts were transfected with 20 µg of the PU.1 or PU.1{Delta}PEST-expressing plasmids and labeled essentially as described above. Cells were harvested in hypotonic buffer (25 mM Tris-HCl, pH 7.4, 1 mM MgCl2, 5 mM KCl) and incubated on ice for 5 min. An equal volume of hypotonic buffer containing 1% Nonidet P-40 was added, and incubation was continued for an additional 5 min. The nuclei were pelleted and resuspended in RIPA buffer (150 mM NaCl, 1% Nonidet P-40, 0.5% DOC, 0.1% SDS, 50 mM Tris, pH 8.0). The cell suspension was sonicated and clarified by centrifugation.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
NF-EM5 activity in S194 nuclear extracts is due to Pip

Brass et al. (30) recently showed that Pip is responsible for NF-EM5 activity in J558L cells. To determine whether the NF-EM5 activity present in S194 plasmacytoma cell nuclear extracts is also due to Pip, we performed EMSA studies with anti-Pip antisera. The PU.1:Pip DNA-binding sequence from the Ig{kappa} 3' enhancer was incubated with S194 nuclear extract and either preimmune sera or anti-Pip sera. The PU.1:Pip:DNA complex was completely abolished by inclusion of a polyclonal Pip antiserum, while preimmune serum had no effect (Fig. 1Go). Therefore, the Pip protein present in S194 cells is identical, or highly homologous, to recombinant Pip. Because we obtained more efficient DNA binding with proteins isolated from nuclear extracts, the remainder of our studies were performed with Pip derived from S194 cells.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 1. Pip from S194 nuclear extracts is the same as recombinant Pip. EMSA was performed with the PU.1-Pip DNA probe, recombinant PU.1, and Pip from S194 nuclear extracts. Samples either received no treatment, preimmune sera, or polyclonal Pip antisera. The positions of the PU.1:Pip:DNA complex, PU.1:DNA complex, and free DNA probe are indicated by the arrows.

 
Identification of PU.1 PEST domain sequences necessary for Pip recruitment

We previously showed that PU.1 sequences 118–160 (the PEST domain) and phosphorylation of serine 148 are necessary for Pip recruitment to DNA by EMSA (6, 16). In addition, mutation of PU.1 serines 132 and 133 to alanine residues reduced, but did not abolish, Pip recruitment (16). To better characterize the PU.1 PEST domain sequences important for Pip recruitment, we prepared a number of PU.1 PEST domain mutants using a PCR-based technique. Fifteen internal deletions were generated that had deletions anchored on the N-terminal side at arginine residues 87, 117, or 140 and on the C-terminal side at serine residues 107, 113, 126, 133, 142, 148, or 168 (Fig. 2GoA). Each mutant was transcribed and translated in vitro using [35S]methionine and assayed by EMSA for the ability to recruit Pip from S194 nuclear extracts to the PU.1-Pip DNA-binding site of the Ig{kappa} 3' enhancer (sequences 445–469; numbering according to 3 . The results of these assays are shown in Figure 2GoB.



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 2. Identification of PU.1 PEST domain sequences important for Pip recruitment to DNA. A, Map of PU.1 mutants and their relative ability to recruit Pip. Each mutant PU.1 protein is diagrammed with the deleted or alanine substituted PU.1 sequences indicated on the left. The positions of the activation, PEST, and ETS domains are indicated. The shaded box represents the PEST domain. To the right is shown the relative ability of each mutant to recruit Pip to its DNA-binding site. +++, Indicates binding as efficient as wild-type PU.1; ++, the ratio of the PU.1:Pip complex to the PU.1 complex is about 1:1; +, the PU.1 complex is more intense than the PU.1:Pip complex. B, EMSA with the kappa 3' enhancer PU.1-Pip DNA-binding site probe, the various PU.1 mutants prepared by in vitro transcription and translation, and Pip derived from S194 plasmacytoma cell nuclear extracts. The identity of each mutant PU.1 protein is indicated above each lane. The positions of the PU.1:Pip:DNA complex, PU.1:DNA complex, and free DNA probe are indicated by arrows.

 
Deletion of PU.1 amino acids 88–108 or 88–112 had no effect on the ability of PU.1 to recruit Pip to the DNA (Fig. 2GoB, lanes 2–3). Additional deletion to amino acid 125 or 132 resulted in a decrease in Pip recruitment ability (lanes 4–5), and progressive deletion to amino acid 141, 147, or 167 resulted in a total loss of Pip recruitment (lanes 6–8). Similarly, deletion of amino acids 118–125 or 118–132 (lanes 9–10) resulted in a decrease in Pip binding, and progressive deletion to amino acid 141, 147, or 167 completely eliminated Pip recruitment (lanes 11–13). Therefore, PU.1 sequences between 118 and 141 are necessary for Pip recruitment. Deletion of amino acids 141–147 or 141–167 also resulted in complete loss of Pip recruitment (lanes 15–16). Interestingly, deletion of a single amino acid, glutamine 141, produced a PU.1 mutant that appears to recruit Pip with higher efficiency than wild-type PU.1 (lane 14). Similar results with each mutant were seen using recombinant Pip protein (data not shown).

Definition of the N-terminal and C-terminal limits of the recruitment domain

The above results suggested that amino acids 113–125 contain the N-terminal boundary of the Pip recruitment domain (compare {Delta}88–112 to {Delta}88–125; Fig. 2GoB, lanes 3–4). We made two additional deletions to more precisely determine the N-terminal recruitment boundary ({Delta}111–114 and {Delta}111–117; Fig. 2GoA) and assayed them for Pip recruitment via EMSA. Neither deletion resulted in any loss of Pip recruitment relative to wild-type PU.1, indicating that sequences amino terminal to residue 118 are not required for Pip recruitment to DNA (Fig. 3GoA, lanes 1–3). Therefore, the N-terminal boundary of the Pip recruitment domain lies between PU.1 amino acids 118 and 125.



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 3. Identification of the boundaries of the PU.1 PEST sequences necessary for Pip recruitment to DNA. EMSA was performed with the kappa 3' enhancer PU.1-Pip DNA-binding site probe and various PU.1 mutants prepared by in vitro transcription and translation either in the absence or presence of Pip. The identity of each mutant PU.1 protein is indicated above each lane. The positions of the PU.1:Pip:DNA complex, PU.1:DNA complex, and free DNA probe are indicated by arrows, and the presence (+) or absence (-) of Pip derived from S194 nuclear extract is indicated above each lane. A, The amino-terminal boundary of the recruitment domain lies between PU.1 residues 118 and 125, while the carboxyl-terminal boundary lies between residues 148 and 154. B, Alanine substitutions of sequences 118–125, 126–132, 133–139, and 141–147 were assayed by EMSA in the presence of Pip. C, The ratio of the intensity of PU.1:Pip:DNA complex to that of the PU.1:DNA complex for the alanine substitution mutants was quantified using a phosphorImager (Molecular Dynamics). The averaged data from three independent experiments are shown.

 
To define the C-terminal limit of the Pip recruitment domain, we made three small PU.1 deletions between amino acids 154 and 168 ({Delta}154–156, {Delta}161–164, and {Delta}165–168; Fig. 2GoA). None of these mutations caused any significant loss of Pip recruitment in EMSA (Fig. 3GoA, lanes 10–12), suggesting that PU.1 sequences between residues 154 and 168 are not necessary for Pip recruitment to DNA. Since mutation of serine 148 abolishes Pip recruitment (16), the C-terminal boundary of the recruitment domain lies between the PU.1 residues 148 and 154.

Subregions within the PEST domain

Because deletion of amino acids 118–132 reduced Pip recruitment, whereas deletion of sequences 118–141 abolished recruitment, important sequences must also reside between amino acids 132 and 141. To better characterize these sequences, we made three additional deletions between amino acids 129–141: {Delta}129–132, {Delta}133–139, and {Delta}129–141 (Fig. 2GoA). Deletion of amino acids 129–132 had no effect on Pip recruitment compared with wild-type PU.1 (Fig. 3GoA, compare lanes 6 and 7). However, deletion of amino acids 133–139 resulted in a decrease in Pip recruitment, as did deletion of amino acids 129–141 (lanes 8 and 9).

Our results indicate that three PU.1 regions (sequences 118–125, 133–139, and 141–147) can influence Pip recruitment when deleted. However, deletion can potentially affect function by altering protein structure nonspecifically. Therefore, to better characterize these regions, we also prepared alanine point mutations between residues 118–125, 126–132, 133–139, and 141–147 (Fig. 2GoA). Consistent with our deletion data, alanine mutants 118–125A and 133–139A reduced Pip recruitment to DNA, whereas mutant 126–132A had no effect (Fig. 3GoB, lanes 1–4). Alanine mutant 141–147A reduced Pip recruitment (Fig. 3GoB, lane 5), whereas deletion of the same sequences abolished recruitment (Fig. 2GoB, lane 15). This difference may be the result of lost phosphorylation of serine 148 in the deletion mutant (discussed below). Quantification of the recruitment efficiency of each alanine mutant as compared with wild-type PU.1 is shown in Figure 3GoC. Mutation of residues 118–125A was the most severe, reducing Pip recruitment >15-fold, while 133–139A and 141–147A reduced recruitment 2.5-fold and 9-fold, respectively.

Figure 2GoA contains a summary of each PU.1 mutant and Figure 4Go shows the PU.1 PEST sequence and the specific sequences that influence Pip recruitment. Deletion or alanine point mutation of residues 118–125 (subregion A) or 133–139 (subregion B) reduced Pip recruitment, indicating that these sequences can modulate recruitment efficiency. Deletion of both regions ({Delta}118–141) completely eliminated Pip recruitment to the DNA, whereas mutation of the sequences between subregions A and B had no effect on Pip recruitment. Finally, alanine point mutation of residues 141–147 (subregion C) reduced Pip recruitment, whereas deletion of these sequences abolished recruitment.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 4. Summary of the PEST sequences involved in Pip recruitment to DNA. The rectangle represents the PU.1 sequence with the PEST domain indicated by the shaded box. The sequence of the PU.1 PEST domain (residues 118–160) is shown below. Regions that either reduce or eliminate Pip recruitment to DNA when deleted or substituted are indicated. The serine 132, 133, and 148 to alanine mutation data are taken from Pongubala et al. (16).

 
Mutants that reduce Pip recruitment have altered DNA-protein kinetics

Since deletion of sequences between PU.1 residues 118–125 and 133–139 modulated the efficiency of Pip recruitment, we sought to determine whether these mutants affected protein-DNA binding kinetics. To test this hypothesis, {Delta}118–125, {Delta}133–139, and wild-type PU.1 proteins were assayed by off-rate EMSA experiments. These studies showed differences in the off-rates of the PU.1:Pip:DNA complex when comparing wild-type PU.1 with the mutant proteins (Fig. 5GoA). Interestingly, these studies showed a slower off-rate by the {Delta}133–139 mutant as compared with wild-type PU.1. The off-rate for the {Delta}118–125 mutant was intermediate between wild-type PU.1 and the {Delta}133–139 mutant. A similar trend was observed with the PU.1:DNA complex alone (data not shown). The different off-rates of the {Delta}118–125 and {Delta}133–139 mutants compared with wild-type PU.1 suggested that these proteins might have altered conformations. To determine whether this was the case, we performed protease sensitivity studies. Wild-type PU.1, {Delta}118–125, and {Delta}133–139 proteins were bound to DNA, then subjected to increasing doses of either trypsin (Fig. 5GoB) or proteinase K (Fig. 5GoC). Interestingly, both mutant proteins were slightly more resistant to protease digestion than was wild-type PU.1; this can best be seen when comparing the lowest doses of trypsin (Fig. 5GoB, compare lanes 2, 6, and 10) or proteinase K (Fig. 5GoC, compare lanes 2, 6, and 10).



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 5. PU.1 mutants {Delta}118–125 and {Delta}133–139 show altered structures. A, Differences in protein-DNA complex kinetics. Wild-type PU.1 and PU.1 mutants {Delta}118–125 and {Delta}133–139 were assayed for DNA off-rate in the presence of Pip as described in the Materials and Methods section. The percentage of PU.1:Pip:DNA complex remaining through time is plotted. B and C, Differences in protein conformation. Wild-type PU.1, {Delta}118–125, and {Delta}133–139 proteins were bound to DNA, incubated with various amounts of either trypsin (B) or proteinase K (C), then subjected to EMSA. The identity of the protein and the amount of protease are indicated above each lane.

 
The studies detailed above indicate that the sequences deleted in the mutants {Delta}118–125 and {Delta}133–139 can influence the recruitment of Pip to DNA. Mutation of these sequences can influence the kinetics of DNA-protein complexes and can alter the conformation of these proteins. It is interesting that the {Delta}133–139 mutant recruits Pip less efficiently than the wild-type protein, yet has a slower off-rate with Pip compared with wild-type PU.1. This issue will be addressed in the Discussion below.

Interaction of GST-Pip and PU.1 in solution requires the PU.1 ETS domain

The studies described above identified PU.1 sequences within the PEST domain that are required for efficient recruitment of Pip to its DNA-binding site as measured by EMSA. These studies require intact DNA-binding domains because mutation of the PU.1 ETS domain abolishes Pip recruitment (6). To study the interaction between PU.1 and Pip by a second method, we prepared a glutathione S-transferase-Pip fusion protein (GST-Pip) which enabled us to assay the PU.1-Pip interaction in solution. Bacterially produced GST-Pip protein was incubated with [35S]-labeled PU.1 in a GST chromatography experiment in the absence or presence of various oligonucleotide sequences (Fig. 6GoA). Binding of wild-type PU.1 protein was easily detected in the absence of DNA, indicating that PU.1 and Pip can physically interact in solution (Fig. 6GoA, lanes 3–4). Addition of either PU.1-Pip DNA-binding site specific (lanes 5–6) or nonspecific (lanes 7–8) oligonucleotide sequences had no effect on GST-Pip:PU.1 interaction.



View larger version (59K):
[in this window]
[in a new window]
 
FIGURE 6. Interaction of PU.1 with GST-Pip does not require the PU.1 PEST domain. A, PU.1 and PU.1{Delta}141–147 were prepared by in vitro transcription and translation in the presence of [35S]-labeled methionine. Equal numbers of counts of each protein were incubated with either GST, or GST-Pip. After incubation and washing, bound proteins were analyzed by SDS-PAGE. The first two lanes show 10% input of each protein. Above each lane is indicated the presence of either PU.1 or PU.1{Delta}141–147, and GST, or GST-Pip. Lanes received either no oligonucleotide (None), PU.1-Pip binding site sequences (PU.1:Pip), or a nonspecific oligonucleotide (NS). B, Interaction of PU.1 with GST-Pip is highly specific. NIH3T3 cells were transfected with either no plasmid (UnTx), CMV-PU.1 plasmid (PU.1), or CMV-PU.1{Delta}PEST plasmid (PU.1delPEST). Transfected cells were metabolically labeled, and nuclear extracts were prepared and subjected to chromatography with GST or GST-Pip beads. The 10% input of each lysate is shown in lanes 1, 4, or 7. Eluted proteins were subjected to SDS-PAGE. The arrows indicate the relative positions of PU.1 and PU.1{Delta}PEST.

 
Based upon our EMSA results, we expected that a PU.1 mutant containing a deletion between residues 141–147 might not interact with GST-Pip by this assay. However, contrary to our EMSA results, deletion of amino acids 141–147 (mutant {Delta}141–147) did not abolish the interaction of PU.1 with GST-Pip (Fig. 6GoA, lanes 9–14). This unexpected result led us to test the specificity of this physical interaction under more stringent conditions. First, we washed the chromatography assays with NETN containing high salt and blocking protein (0.5 M NaCl, 0.5% milk). This treatment did not effect the relative binding of wild-type and mutant PU.1 proteins (data not shown). Second, we tested the relative specificity of the PU.1:Pip interaction in the context of total nuclear proteins. NIH3T3 cells were transfected with either wild-type PU.1 or PU.1{Delta}PEST. Transfected cells were metabolically labeled with [35S]methionine, and cysteine and cell extracts were prepared. Total labeled nuclear proteins were then assayed for their ability to physically interact with GST-Pip. Remarkably, of all the labeled cellular proteins, only PU.1 and PU.1{Delta}PEST interacted with high efficiency with GST-Pip (Fig. 6GoB, lanes 4–9). No specific protein interactions were observed with cell lysates generated from untransfected cells (lanes 2–3). Therefore, the physical interaction we observed with PU.1{Delta}PEST and GST-Pip is highly specific.

To identify the region of PU.1 that is required for interaction with GST-Pip, we tested a panel of PU.1 deletion mutants in GST chromatography assays. Proteins lacking the activation domain ({Delta}7–30 and {Delta}33–100; Fig. 7GoA, lanes 3–6), the PEST domain ({Delta}119–160; Fig. 7GoA, lanes 7–8), or both ({Delta}1–160; Fig. 7GoA, lanes 11–12; Fig. 7GoB, lanes 8–9) strongly interacted with GST-Pip. In contrast PU.1 mutants {Delta}245–272 (Fig. 7GoA, lanes 9–10) and {Delta}201–272 (Fig. 7GoB, lanes 6–7), which lack portions of the ETS domain, were unable to bind to GST-Pip in these assays. These results are summarized in Figure 7GoC. Our results show that the PU.1 ETS domain is necessary and sufficient for physical interaction with GST-Pip. This domain, however, is not sufficient to recruit Pip to bind to DNA (6). Recruitment of Pip to DNA requires a second step involving the PU.1 PEST domain.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 7. The PU.1 ETS domain can physically interact with Pip. A and B, Various PU.1 mutants indicated above each lane were prepared by in vitro transcription and translation in the presence of [35S]-labeled methionine. Equal counts of each protein were incubated with either GST or GST-Pip. Bound proteins were eluted and subjected to SDS-PAGE. In B, 10% of each input protein is shown in the first three lanes. C, Summary of the GST chromatography experiments. The top rectangle represents wild-type PU.1, and gaps in the rectangles below represent sequences deleted in each mutant. The precise sequences deleted are indicated on the left. The relative ability of each mutant to interact with GST-Pip is shown on the right of each construct.

 
Pip interacts with some, but not all, ETS domain proteins

The observation that Pip can physically interact with the PU.1 ETS domain prompted us to determine whether other ETS domain proteins can interact with Pip. The ETS proteins Ets-1, Ets-2, and Fli-1 were tested. Results from these studies (Fig. 8Go) showed that Ets-1 interaction with GST-Pip was detectable but very weak (lanes 7 and 8). Fli-1 interacted with GST-Pip (lanes 11 and 12) although not as efficiently as PU.1 (lanes 5 and 6). Ets-2 was incapable of interacting with Pip (lanes 9 and 10). Therefore, some, but not all, ETS domain proteins can physically interact with GST-Pip.



View larger version (73K):
[in this window]
[in a new window]
 
FIGURE 8. Interaction of ETS domain proteins with GST-Pip. Each ETS family protein was prepared by in vitro transcription and translation in the presence of [35S]-labeled methionine and then incubated with either GST or GST-Pip. Eluted proteins were subjected to SDS-PAGE. The 10% inputs of each protein are shown in the first four lanes.

 
The PU.1 PEST domain does not confer protein instability

Our results indicate a role of the PU.1 PEST domain in Pip recruitment to DNA. PEST domains have also been hypothesized to confer protein instability (37). We sought, therefore, to determine whether the PEST domain sequences play a role in PU.1 stability. NIH3T3 cells were transfected with plasmids expressing PU.1 or PU.1{Delta}PEST, or both, and 24 h post-transfection, cellular proteins were metabolically labeled with [35S]-labeled amino acids for 2 h, then chased with cold methionine for various time periods and harvested. The PU.1 proteins were immunoprecipitated from cell lysates with anti-PU.1 Ab and resolved by SDS-PAGE. As can be seen in Figure 9Go, the PU.1{Delta}PEST deletion is actually moderately less stable than the wild-type protein, indicating that the PEST domain does not confer an innate instability on PU.1.



View larger version (60K):
[in this window]
[in a new window]
 
FIGURE 9. The PU.1 PEST domain does not confer rapid turnover on PU.1. NIH3T3 cells were transfected with either CMV-PU.1, CMV-PU.1delPEST, or both. Transfected cells were metabolically labeled and chased for various times as described in Materials and Methods. Samples were immunoprecipitated with anti-PU.1 antiserum and subjected to SDS-PAGE. The arrows indicate the relative positions of PU.1 and PU.1delPEST.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Role of the PU.1 PEST and ETS domains in interaction with Pip

To better characterize the PU.1 sequences important for Pip recruitment, we prepared 27 mutations that flank or traverse the PU.1 PEST domain. Consistent with our previous observations (6), we demonstrated that deletion or alanine point mutation of sequences within the PU.1 PEST domain significantly reduced or eliminated recruitment of Pip to DNA. Based upon the data summarized in Figures 2GoA and 4, multiple regions of the PU.1 PEST domain influence Pip recruitment. Mutation of residues 118–125 (subregion A), 133–139 (subregion B), or 141–147 (subregion C) reduced Pip recruitment.

The mechanism by which PU.1 sequences 118–125 (Met-Cys-Phe-Pro-Tyr-Gln-Thr-Leu) influence Pip recruitment is unknown. However, deletion of these sequences alters the conformation of PU.1, and this altered conformation may result in less efficient recruitment of Pip. This mutant protein might also serve as a less efficient substrate for phosphorylation of serine 148 by casein kinase (CK) II. However, addition of excess CKII did not increase Pip recruitment relative to wild-type PU.1 (data not shown). Therefore, it is more likely that mutation of sequences 118–125 influences the PU.1 conformation necessary for optimal recruitment of Pip.

Mutation of sequences 133–139 also reduced Pip recruitment. These sequences (Ser-Asp-Glu-Glu-Glu-Gly-Glu-Val) constitute a consensus sequence for CKII. Therefore, it is very likely that deletion of this sequence abolishes phosphorylation of serine 132, which then leads to reduced Pip recruitment. In support of this conclusion, we previously showed that mutation of serines 132 and 133 to alanine residues resulted in reduced Pip recruitment to DNA (16).

The only difference between our deletion and alanine point mutation data occurred with sequences 141–147 (Gln-Ser-Pro-Pro-Leu-Glu-Val). Mutant {Delta}141–147 abolished Pip recruitment, whereas mutant 141–147A only reduced recruitment. Both mutants retain serine 148, of which phosphorylation is required for PU.1 to recruit Pip to DNA (16). However, deletion of the sequences immediately adjacent to serine 148 in mutant {Delta}141–147 may alter the ability of this residue to be phosphorylated. This hypothesis is supported by the less severe phenotype of the 141–147A mutant, which replaces these sequences with alanine residues. Therefore, the effects on Pip recruitment by mutation of residues 141–147 may be a consequence of reduced phosphorylation of serine 148. The multiple phosphorylated serines in PU.1 make it very difficult to determine the phosphorylation status of serine 148. This would require two-dimensional peptide mapping of metabolically labeled proteins harvested from transfected cells.

Somewhat surprisingly, mutants {Delta}118–125 and {Delta}133–139 showed slower off-rates from DNA as compared with wild-type complexes. Therefore, these mutants have a reduced ability to recruit Pip to DNA, but once assembled, the PU.1:Pip complex comes off the DNA more slowly. Possibly the mutant PU.1 proteins take on a conformation that stabilizes protein-DNA complexes, but they do not as readily undergo conformational changes that facilitate Pip recruitment (see below). Whether deletion of these sequences directly alters a sequence necessary for Pip recruitment or alters the structure of other PU.1 sequences necessary for this function is unclear.

We also studied the interaction of PU.1 and Pip in solution using GST chromatography. Surprisingly, in contrast to our EMSA data, deletion of the PU.1 PEST domain had no effect on PU.1:GST-Pip physical interaction. In fact, deletion of all PU.1 sequences except the ETS domain had no effect on PU.1:Pip interaction. On the other hand, deletions within the PU.1 ETS domain abolished the physical interaction between PU.1 and Pip. Therefore, the PU.1 ETS domain is necessary and sufficient for physical interaction with Pip. Since PU.1 belongs to a family of related ETS domain proteins, we tested the ability of several other ETS domain proteins to physically interact with GST-Pip. Interestingly, Fli-1 was also able to physically interact with GST-Pip, although the interaction between PU.1 and Pip appears to be more efficient (Fig. 8Go). Fli-1 and Pip are both found in B and T lymphocytes (26, 38, 39). It is therefore possible that Pip interacts with Fli-1 in either lymphocyte lineage. The ability of Pip to select from multiple potential dimerization partners may serve to modulate its activity by controlling DNA-binding site specificity, DNA-binding kinetics, or transactivation potential. It will be interesting to determine whether Pip normally interacts with other ETS domain proteins in addition to PU.1.

A two-step model for PU.1 recruitment of Pip to DNA

Two distinct PU.1 domains (the PEST and ETS domains) are required for the recruitment of Pip to its 3' enhancer DNA site. Whereas both the PU.1 PEST and ETS domains are required for Pip recruitment to DNA, only the ETS domain is required for a solution interaction. This is supported by several observations. First, Pip recruitment via EMSA is eliminated by various deletions of the PEST domain, even though these clones contain the PU.1 ETS domain (Fig. 2GoA; see also 6 . Second, the PU.1 ETS domain alone is incapable of recruiting Pip to its Ig{kappa} 3' enhancer DNA-binding site as assayed via EMSA (6). Third, mutations within the ETS domain abolish PU.1 DNA binding, and as a consequence, Pip recruitment (6). Finally, GST-Pip is able to interact with a variety of PU.1 mutants, including PU.1{Delta}PEST, but not with certain ETS domain mutants (Fig. 7Go).

A model consistent with the above observations is a modification of the one put forward by Brass et al. (30), who suggested that PU.1 interaction with Pip results in a Pip conformational change that exposes the Pip DNA-binding domain. Here, we propose a two-step mechanism that results in conformational changes in both PU.1 and Pip (Fig. 10Go). Initially, PU.1 can interact with Pip in solution via the PU.1 ETS domain. This interaction does not require the PU.1 PEST domain or PU.1 phosphorylation and does not result in recruitment of Pip to DNA. Second, phosphorylation of PU.1 at serine 148 causes a covalent structural change in the PU.1 protein. This structural change may directly induce changes in Pip (see below), or may induce a PU.1 conformational change perhaps involving PEST subregions A, B, and C (sequences 118–125, 133–139, and 141–147, respectively). Phosphorylation of PU.1 may occur either before or after interaction with Pip, but phosphorylation at serine 148 is critical because bacterial PU.1 is not capable of Pip recruitment unless first treated with CKII (16). The phosphorylation-induced change in PU.1 would then induce a subsequent conformational change in Pip that either exposes or alters the Pip DNA-binding domain, enabling recruitment of Pip to the {kappa}3' enhancer.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 10. Model for PU.1 recruitment of Pip to DNA. PU.1 and Pip can physically interact via the PU.1 ETS domain. However, this interaction does not result in recruitment of Pip its 3' enhancer binding site. Phosphorylation of PU.1 on serine 148 (either before or after interaction with Pip) induces a PU.1 conformational change that then elicits a Pip conformational change. This either unmasks or alters the Pip DNA-binding domain, enabling Pip recruitment to DNA. PU.1 PEST domain subregions A, B, and C (sequences 118–125, 133–139, and 141–147, respectively) are indicated. The PU.1 activation domain (AD) and DNA-binding domain (ETS) are shown. The DNA-binding domain of Pip is designated DBD, and the autoinhibitory domain (30) is indicated by a shaded region.

 
Evidence for a PU.1 conformational change is provided by the work of Lodie and coworkers (33), who showed that PU.1 in LPS-treated RAW264.7 macrophage cells are more resistant to proteolytic cleavage than PU.1 from unstimulated cells. This conformational change is accompanied by, and may be induced by, increased serine phosphorylation of PU.1. It is not presently known whether phosphorylation of PU.1 serine 148 is regulated during B cell development or in response to extracellular signals, but LPS treatment appears to be able to increase the phosphorylation state of this residue in RAW264.7 macrophages (33). It will be interesting to determine whether a similar mechanism is operative in B cells.

While the physical interaction between PU.1 and Pip is highly specific, other proteins are known to physically interact with PU.1. These include TATA-binding protein (TBP), the retinoblastoma protein (Rb), the glucocorticoid receptor (GR), NF-IL6ß, HMG I/Y, and structure-specific recognition protein (40, 41, 42). TBP, Rb, and GR appear to interact with the amino-terminal region of PU.1, whereas we show that Pip physically interacts with the carboxyl-terminal PU.1 ETS domain (Fig. 7Go). Interestingly, NF-IL6ß also physically interacts with the PU.1 ETS domain (42). However, the interaction between PU.1 and NF-IL6ß does not result in cooperative DNA binding as is observed with PU.1 and Pip. The ability of the PU.1 ETS domain to physically interact with multiple proteins suggests that these interactions could be used as a regulatory mechanism. It will be interesting to determine whether NF-IL6ß can disrupt the interaction between PU.1 and Pip.

PU.1 is a pivotal protein involved in hemopoetic development and in the genesis of erythroleukemia (10, 18, 19, 20, 21, 22, 23, 24). PU.1 can regulate expression of multiple genes and can physically interact with multiple proteins (11, 12, 13, 14, 15, 16, 17, 26, 40, 41, 42). It will be very interesting to determine whether the PU.1 sequences that are necessary for recruitment of Pip to DNA are also necessary for other PU.1 functions such as hemopoetic development, oncogenesis, gene regulation, and interaction with other proteins.


    Acknowledgments
 
We thank B. Graves for the Ets-1 cDNA, N. Avadhani for the Ets-2 cDNA, R. Maki for the Fli-1 cDNA, and H. Singh for the Pip cDNA. We are grateful to S. Maitra, J. Pongubala, S. Nagulapalli, J. Pehrson, T. Kadesch, E. Scott, and N. Avadhani for helpful discussions and for the critical reading of this manuscript.


    Footnotes
 
1 Supported by National Institutes of Health Grant GM42415. Back

2 Address correspondence and reprint requests to Dr. Michael Atchison, 3800 Spruce Street, University of Pennsylvania, School of Veterinary Medicine, Philadelphia, PA 19104. E-mail address: Back

3 Abbreviations used in this paper: PEST, domain rich in the amino acids proline, glutamate, serine, and threonine; NETN, 100 mM NaCl/1 mM EDTA/20 mM Tris, pH 8.0/0.5% Nonidet P-40; EMSA, electrophoretic mobility shift assay; GST, glutathione S-transferase. Back

Received for publication August 4, 1997. Accepted for publication September 19, 1997.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Sen, R., D. Baltimore. 1986. Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell 46:705.[Medline]
  2. Atchison, M. L., R. P. Perry. 1987. The role of the {kappa} enhancer and its binding factor NF-{kappa}B in the developmental regulation of {kappa} gene transcription. Cell 48:121.[Medline]
  3. Meyer, K. B., M. S. Neuberger. 1989. The immunoglobulin {kappa} locus contains a second, stronger B-cell-specific enhancer which is located downstream of the constant region. EMBO J. 8:1959.[Medline]
  4. Costa, M. W., M. L. Atchison. 1996. Identification of an Sp1-like element within the immunoglobulin-{kappa} 3'-enhancer necessary for maximal enhancer activity. Biochemistry 35:8662.[Medline]
  5. Park, K., M. L. Atchison. 1991. Isolation of a candidate repressor/activator, NF-E1 (YY-1, {delta}), that binds to the immunoglobulin {kappa} 3' enhancer and the immunoglobulin heavy chain µ E1 site. Proc. Natl. Acad. Sci. USA 88:9804.[Abstract/Free Full Text]
  6. Pongubala, J. M. R., S. Nagulapalli, M. J. Klemsz, S. R. McKercher, R. A. Maki, M. L. Atchison. 1992. PU.1 recruits a second nuclear factor to a site important for immunoglobulin {kappa} 3' enhancer activity. Mol. Cell. Biol. 12:368.[Abstract/Free Full Text]
  7. Pongubala, J. M. R., M. L. Atchison. 1997. PU.1 can participate in an active enhancer complex without its transcriptional activation domain. Proc. Natl. Acad. Sci. USA 94:127.[Abstract/Free Full Text]
  8. Pongubala, J. M. R., M. L. Atchison. 1995. Activating transcription factor 1 and cyclic AMP response element modulator can modulate the activity of the immunoglobulin {kappa} 3' enhancer. J. Biol. Chem. 270:10304.[Abstract/Free Full Text]
  9. Klemsz, M. J., S. R. McKercher, A. Celada, C. Van Beveren, R. A. Maki. 1990. The macrophage and B cell-specific transcription factor PU.1 is related to the ets oncogene. Cell 61:113.[Medline]
  10. Paul, R., S. Schuetze, S. L. Kozak, C. A. Kozak, D. Kabat. 1991. The Sfpi-1 proviral integration site of Friend erythroleukemia encodes the ets-related transcription factor Pu.1. J. Virol. 65:464.[Abstract/Free Full Text]
  11. Inaba, T., T. Gotoda, S. Ishibashi, K. Harada, J.-I. Ohsuga, K. Ohashi, Y. Yazaki, N. Yamada. 1996. Transcription factor PU.1 mediates induction of c-fms in vascular smooth muscle cells: a mechanism for phenotypic change to phagocytic cells. Mol. Cell. Biol. 16:2264.[Abstract]
  12. Shin, M. K., E. Koshland. 1993. Ets-related protein PU.1 regulates expression of the immunoglobulin J-chain gene through a novel ets-binding element. Genes Dev. 7:2006.[Abstract/Free Full Text]
  13. Kominato, Y., D. L. Galson, W. R. Waterman, A. C. Webb, P. E. Auron. 1995. Monocyte expression of the human prointerleukin 1ß gene (IL1B) is dependent on promoter sequences which bind the hematopoietic transcription factor Spi-1/PU.1. Mol. Cell. Biol. 15:58.
  14. Buras, J. A., W. R. Reenstra, M. J. Fenton. 1995. NFßA, a factor required for maximal interleukin-1ß gene expression is identical to the ets family member PU.1: evidence for structural alteration following LPS activation. Mol. Immunol. 32:541.[Medline]
  15. Hohaus, S., M. S. Petrovick, M. T. Voso, Z. Sun, D.-E. Zhang, D. G. Tenen. 1995. PU.1 (Spi-1) and C/EBP{alpha} regulate expression of the granulocyte-macrophage colony-stimulating factor receptor {alpha} gene. Mol. Cell. Biol. 15:5830.[Abstract]
  16. Pongubala, J. M. R., C. Van Beveren, S. Nagulapalli, M. J. Klemsz, S. R. McKercher, R. A. Maki, M. L. Atchison. 1993. Effect of PU.1 phosphorylation on interaction with NF-EM5 and transcriptional activation. Science 259:1622.[Abstract/Free Full Text]
  17. Eisenbeis, C. F., H. Singh, U. Storb. 1993. PU.1 is a component of a multiprotein complex which binds an essential site in the murine immunoglobulin {lambda}2–4 enhancer. Mol. Cell. Biol. 13:6452.[Abstract/Free Full Text]
  18. Moreau-Gachelin, F., F. Wendling, T. Molina, N. Denis, M. Titeux, G. Grimber, P. Briand, W. Vainchenker, A. Tavitian. 1996. Spi-1/PU.1 transgenic mice develop multistep erythroleukemias. Mol. Cell. Biol. 16:2453.[Abstract]
  19. Moreau-Gachelin, F., D. Ray, M.-G. Mattei, P. Tambourin, A. Tavitian. 1989. The putative oncogene Spi-1: murine chromosomal localization and transcriptional activation in murine acute erythroleukemias. Oncogene 4:1449.[Medline]
  20. Moreau-Gachelin, F., A. Tavitian, P. Tambourin. 1988. Spi-1 is a putative oncogene in virally induced murine erythroleukemias. Nature 331:277.[Medline]
  21. Schuetze, S., P. E. Stenberg, D. Kabat. 1993. The ets-related transcription factor PU.1 immortalizes erythroblasts. Mol. Cell. Biol. 13:5670.[Abstract/Free Full Text]
  22. Scott, E. W., M. C. Simon, J. Anastasi, H. Singh. 1994. Requirement of transcription factor PU.1 in the development of multiple hematopoietic lineages. Science 265:1573.[Abstract/Free Full Text]
  23. Voso, M. T., T. C. Burn, G. Wulf, B. Lim, G. Leone, D. G. Tenen. 1994. Inhibition of hematopoiesis by competitive binding of transcription factor PU.1. Proc. Natl. Acad. Sci. USA 91:7932.[Abstract/Free Full Text]
  24. Olson, M. C., E. W. Scott, A. A. Hack, G. H. Su, D. G. Tenen, H. Singh, M. C. Simon. 1995. PU.1 is not essential for early myeloid gene expression but is required for terminal myeloid differentiation. Immunity 3:703.[Medline]
  25. Klemsz, M. J., R. A. Maki. 1996. Activation of transcription by PU.1 requires both acidic and glutamine domains. Mol. Cell. Biol. 16:390.[Abstract]
  26. Eisenbeis, C. F., H. Singh, U. Storb. 1995. Pip, a novel IRF family member, is a lymphoid-specific, PU.1-dependent transcriptional activator. Genes Dev. 9:1377.[Abstract/Free Full Text]
  27. Yamagata, T., J. Nishida, T. Tanaka, R. Sakai, K. Mitani, M. Yoshida, T. Taniguchi, Y. Yazaki, H. Hirai. 1996. A novel interferon regulatory factor family transcription factor, ICSAT/Pip/LSIRF, that negatively regulates the activity of interferon-regulated genes. Mol. Cell. Biol. 16:1283.[Abstract]
  28. Matsuyama, T., A. Grossman, H.-W. Mittrucker, D. P. Siderovski, F. Kiefer, T. Kawakami, C. D. Richardson, T. Taniguchi, S. K. Yoshinaga, T. W. Mak. 1995. Molecular cloning of LSIRF, a lymphoid-specific member of the interferon regulatory factor family that inds the interferon-stimulated response element (ISRE). Nucleic Acids Res. 23:2127.[Abstract/Free Full Text]
  29. Mittrucker, H.-W., T. Matsuyama, A. Grossman, T. M. Kundig, J. Potter, A. Shahinian, A. Wakeham, B. Patterson, P. S. Ohashi, T. W. Mak. 1997. Requirement for the transcription factor LSIRF/IRF4 for mature B and T lymphocyte function. Science 275:540.[Abstract/Free Full Text]
  30. Brass, A. L., E. Kehrli, C. F. Eisenbeis, U. Storb, H. Singh. 1996. Pip, a lymphoid-restricted IRF, contains a regulatory domain that is important for autoinhibition and ternary complex formation with the Ets factor PU.1. Genes Dev. 10:2335.[Abstract/Free Full Text]
  31. Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, L. R. Pease. 1989. Site directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51.[Medline]
  32. Dignam, J. D., R. M. Lebovitz, R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475.[Abstract/Free Full Text]
  33. Lodie, T. A., R. Savedra, D. T. Jr, C. P. Golenbock, R. A. Van Beveren, R. A. Maki, M. J. Fenton. 1997. Stimulation of macrophages by lipopolysaccharide alters the phosphorylation state, conformation, and function of PU.1 via activation of casein kinase II. J. Immunol. 158:1848.[Abstract]
  34. Kaelin, W. G., D. C. Jr, J. A. Pallas, F. J. DeCaprio, F. J. Kaye, D. M. Livingston. 1991. Identification of cellular proteins that can interact specifically with the T/E1A-binding region of the retinoblastoma gene product. Cell 64:521.[Medline]
  35. Luscher, B., R. N. Eisenman. 1988. c-myc and c-myb protein degradation: effect of metabolic inhibitors and heat shock. Mol. Cell. Biol. 8:2504.[Abstract/Free Full Text]
  36. Graham, F. L., A. J. van der Eb. 1973. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virol. 52:456.
  37. Rogers, S., R. Wells, M. Rechsteiner. 1986. Amino acid sequences common to rapidly degraded proteins: the PEST hypothesis. Science 234:364.[Abstract/Free Full Text]
  38. Klemsz, M. J., R. A. Maki, T. Papayannopoulou, J. Moore, R. Hromas. 1993. Characterization of the ets oncogene family member, fli-1. J. Biol. Chem. 268:5769.[Abstract/Free Full Text]
  39. Rivera, R. R., M. H. Stuiver, R. Steenbergen, C. Murre. 1993. Ets proteins: new factors that regulate immunoglobulin heavy-chain gene expression. Mol. Cell. Biol. 13:7163.[Abstract/Free Full Text]
  40. Gauthier, J. M., B. Bourachot, V. Doucas, M. Yaniv, F. Moreau-Gachelin. 1993. Functional interference between the Spi-1/PU.1 oncoprotein and steroid hormone or vitamin receptors. EMBO J. 12:5089.[Medline]
  41. Hagemeier, C., A. J. Bannister, A. Cook, T. Kouzarides. 1993. The activation domain of transcription factor PU.1 binds the retinoblastoma (RB) protein and the transcription factor TFIID in vitro: RB shows sequence similarity to TFIID and TFIIB. Proc. Natl. Acad. Sci. USA 90:1580.[Abstract/Free Full Text]
  42. Nagulapalli, S., J. M. R. Pongubala, M. L. Atchison. 1995. Multiple proteins physically interact with PU.1: transcriptional synergy with NF-IL6ß (C/EBP{delta}, CRP3). J. Immunol. 155:4330.[Abstract]



This article has been cited by other articles:


Home page
J. Immunol.Home page
A. C. Azim, X. Wang, G. Y. Park, R. T. Sadikot, H. Cao, B. Mathew, M. Atchison, R. B. van Breemen, M. Joo, and J. W. Christman
NF-{kappa}B-Inducing Kinase Regulates Cyclooxygenase 2 Gene Expression in Macrophages by Phosphorylation of PU.1
J. Immunol., December 1, 2007; 179(11): 7868 - 7875.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Dahl, S. R. Iyer, K. S. Owens, D. D. Cuylear, and M. C. Simon
The Transcriptional Repressor GFI-1 Antagonizes PU.1 Activity through Protein-Protein Interaction
J. Biol. Chem., March 2, 2007; 282(9): 6473 - 6483.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Hodawadekar, F. Wei, D. Yu, A. Thomas-Tikhonenko, and M. L. Atchison
Epigenetic Histone Modifications Do Not Control Ig{kappa} Locus Contraction and Intranuclear Localization in Cells with Dual B Cell-Macrophage Potential
J. Immunol., November 1, 2006; 177(9): 6165 - 6171.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Guillouf, I. Gallais, and F. Moreau-Gachelin
Spi-1/PU.1 Oncoprotein Affects Splicing Decisions in a Promoter Binding-dependent Manner
J. Biol. Chem., July 14, 2006; 281(28): 19145 - 19155.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Wang, R. M. Baron, G. Zhu, M. Joo, J. W. Christman, E. S. Silverman, M. A. Perrella, R. J. Riese, and M. Cernadas
PU.1 Regulates Cathepsin S Expression in Professional APCs
J. Immunol., January 1, 2006; 176(1): 275 - 283.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Lehtonen, V. Veckman, T. Nikula, R. Lahesmaa, L. Kinnunen, S. Matikainen, and I. Julkunen
Differential Expression of IFN Regulatory Factor 4 Gene in Human Monocyte-Derived Dendritic Cells and Macrophages
J. Immunol., November 15, 2005; 175(10): 6570 - 6579.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Bai, L. Srinivasan, L. Perkins, and M. L. Atchison
Protein Acetylation Regulates Both PU.1 Transactivation and Ig{kappa} 3' Enhancer Activity
J. Immunol., October 15, 2005; 175(8): 5160 - 5169.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Laricchia-Robbio, T. Tamura, T. Karpova, B. L. Sprague, J. G. McNally, and K. Ozato
Partner-regulated interaction of IFN regulatory factor 8 with chromatin visualized in live macrophages
PNAS, October 4, 2005; 102(40): 14368 - 14373.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
T. V. Pedchenko, G. Y. Park, M. Joo, T. S. Blackwell, and J. W. Christman
Inducible binding of PU.1 and interacting proteins to the Toll-like receptor 4 promoter during endotoxemia
Am J Physiol Lung Cell Mol Physiol, September 1, 2005; 289(3): L429 - L437.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. C. McDevit, L. Perkins, M. L. Atchison, and B. S. Nikolajczyk
The Ig{kappa}3' Enhancer Is Activated by Gradients of Chromatin Accessibility and Protein Association
J. Immunol., March 1, 2005; 174(5): 2834 - 2842.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. van der Stoep, E. Quinten, M. M. Rezende, and P. J. van den Elsen
E47, IRF-4, and PU.1 synergize to induce B-cell-specific activation of the class II transactivator promoter III (CIITA-PIII)
Blood, November 1, 2004; 104(9): 2849 - 2857.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Suzuki, K. Honma, T. Matsuyama, K. Suzuki, K. Toriyama, I. Akitoyo, K. Yamamoto, T. Suematsu, M. Nakamura, K. Yui, et al.
From the Cover: Critical roles of interferon regulatory factor 4 in CD11bhighCD8{alpha}- dendritic cell development
PNAS, June 15, 2004; 101(24): 8981 - 8986.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Hines, B. R. Sorensen, M. A. Shea, and W. Maury
PU.1 Binding to ets Motifs within the Equine Infectious Anemia Virus Long Terminal Repeat (LTR) Enhancer: Regulation of LTR Activity and Virus Replication in Macrophages
J. Virol., April 1, 2004; 78(7): 3407 - 3418.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Alter-Koltunoff, S. Ehrlich, N. Dror, A. Azriel, M. Eilers, H. Hauser, H. Bowen, C. H. Barton, T. Tamura, K. Ozato, et al.
Nramp1-mediated Innate Resistance to Intraphagosomal Pathogens Is Regulated by IRF-8, PU.1, and Miz-1
J. Biol. Chem., November 7, 2003; 278(45): 44025 - 44032.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
S. Hashmueli, M. Gleit-Kielmanowicz, D. Meraro, A. Azriel, D. Melamed, and B.-Z. Levi
A truncated IFN-regulatory factor-8\IFN consensus sequence-binding protein acts as dominant-negative, interferes with endogenous protein-protein interactions and leads to apoptosis of immune cells
Int. Immunol., July 1, 2003; 15(7): 807 - 815.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. O'Reilly, C. M. Quinn, T. El-Shanawany, S. Gordon, and D. R. Greaves
Multiple Ets Factors and Interferon Regulatory Factor-4 Modulate CD68 Expression in a Cell Type-specific Manner
J. Biol. Chem., June 6, 2003; 278(24): 21909 - 21919.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. R. McKercher, C. R. Lombardo, A. Bobkov, X. Jia, and N. Assa-Munt
Identification of a PU.1-IRF4 protein interaction surface predicted by chemical exchange line broadening
PNAS, January 21, 2003; 100(2): 511 - 516.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. Kuwata, C. Gongora, Y. Kanno, K. Sakaguchi, T. Tamura, T. Kanno, V. Basrur, R. Martinez, E. Appella, T. Golub, et al.
Gamma Interferon Triggers Interaction between ICSBP (IRF-8) and TEL, Recruiting the Histone Deacetylase HDAC3 to the Interferon-Responsive Element
Mol. Cell. Biol., November 1, 2002; 22(21): 7439 - 7448.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Meraro, M. Gleit-Kielmanowicz, H. Hauser, and B.-Z. Levi
IFN-Stimulated Gene 15 Is Synergistically Activated Through Interactions Between the Myelocyte/Lymphocyte-Specific Transcription Factors, PU.1, IFN Regulatory Factor-8/IFN Consensus Sequence Binding Protein, and IFN Regulatory Factor-4: Characterization of a New Subtype of IFN-Stimulated Response Element
J. Immunol., June 15, 2002; 168(12): 6224 - 6231.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
W. Hong, A. Y. Kim, S. Ky, C. Rakowski, S.-B. Seo, D. Chakravarti, M. Atchison, and G. A. Blobel
Inhibition of CBP-Mediated Protein Acetylation by the Ets Family Oncoprotein PU.1
Mol. Cell. Biol., June 1, 2002; 22(11): 3729 - 3743.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Kim and R. A. Feldman
Activated Fes Protein Tyrosine Kinase Induces Terminal Macrophage Differentiation of Myeloid Progenitors (U937 Cells) and Activation of the Transcription Factor PU.1
Mol. Cell. Biol., March 15, 2002; 22(6): 1903 - 1918.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Marecki, C. J. Riendeau, M. D. Liang, and M. J. Fenton
PU.1 and Multiple IFN Regulatory Factor Proteins Synergize to Mediate Transcriptional Activation of the Human IL-1{{beta}} Gene
J. Immunol., June 1, 2001; 166(11): 6829 - 6838.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Gupta, A. Anthony, and A. B. Pernis
Stage-Specific Modulation of IFN-Regulatory Factor 4 Function by Kruppel-Type Zinc Finger Proteins
J. Immunol., May 15, 2001; 166(10): 6104 - 6111.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. Lubyova and P. M. Pitha
Characterization of a Novel Human Herpesvirus 8-Encoded Protein, vIRF-3, That Shows Homology to Viral and Cellular Interferon Regulatory Factors
J. Virol., September 1, 2000; 74(17): 8194 - 8201.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
S. Maitra and M. Atchison
BSAP Can Repress Enhancer Activity by Targeting PU.1 Function
Mol. Cell. Biol., March 15, 2000; 20(6): 1911 - 1922.
[Abstract] [Full Text]


Home page
BloodHome page
B. Falini, M. Fizzotti, A. Pucciarini, B. Bigerna, T. Marafioti, M. Gambacorta, R. Pacini, C. Alunni, L. Natali-Tanci, B. Ugolini, et al.
A monoclonal antibody (MUM1p) detects expression of the MUM1/IRF4 protein in a subset of germinal center B cells, plasma cells, and activated T cells
Blood, March 15, 2000; 95(6): 2084 - 2092.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Meraro, S. Hashmueli, B. Koren, A. Azriel, A. Oumard, S. Kirchhoff, H. Hauser, S. Nagulapalli, M. L. Atchison, and B.-Z. Levi
Protein-Protein and DNA-Protein Interactions Affect the Activity of Lymphoid-Specific IFN Regulatory Factors
J. Immunol., December 15, 1999; 163(12): 6468 - 6478.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Marecki, M. L. Atchison, and M. J. Fenton
Differential Expression and Distinct Functions of IFN Regulatory Factor 4 and IFN Consensus Sequence Binding Protein in Macrophages
J. Immunol., September 1, 1999; 163(5): 2713 - 2722.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Cohen, A. Azriel, T. Cohen, D. Meraro, S. Hashmueli, D. Bech-Otschir, R. Kraft, W. Dubiel, and B.-Z. Levi
Interaction between Interferon Consensus Sequence-binding Protein and COP9/Signalosome Subunit CSN2 (Trip15). A POSSIBLE LINK BETWEEN INTERFERON REGULATORY FACTOR SIGNALING AND THE COP9/SIGNALOSOME
J. Biol. Chem., December 8, 2000; 275(50): 39081 - 39089.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Rieske and J. M. R. Pongubala
AKT Induces Transcriptional Activity of PU.1 through Phosphorylation-mediated Modifications within Its Transactivation Domain
J. Biol. Chem., March 9, 2001; 276(11): 8460 - 8468.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Luchin, S. Suchting, T. Merson, T. J. Rosol, D. A. Hume, A. I. Cassady, and M. C. Ostrowski
Genetic and Physical Interactions between Microphthalmia Transcription Factor and PU.1 Are Necessary for Osteoclast Gene Expression and Differentiation
J. Biol. Chem., September 21, 2001; 276(39): 36703 - 36710.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Perkel, J. M.
Right arrow Articles by Atchison, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Perkel, J. M.
Right arrow Articles by Atchison, M. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS