|
|
||||||||
Department of Immunology, The Weizmann Institute of Science, Rehovot, Israel
| Abstract |
|---|
|
|
|---|
-derived hinge successfully
performs this task in chimeric scFv-Syk receptors regardless of its
cysteine content. A cytotoxic T cell hybridoma expressing chimeric
receptor genes composed of
scFv-CD8hinge-CD8TM-Syk or
scFv-CD8hinge-CD4TM-Syk is efficiently
stimulated to produce IL-2 upon interaction with APC and specifically
lyses appropriate target cells in a non-MHC-restricted manner. | Introduction |
|---|
|
|
|---|
-chain of the TCR/CD3 or the
Fc
RI
-chain. These chimeric receptors can trigger cytokine
secretion upon encountering Ag and mediate non-MHC-restricted,
Ag-positive target cell lysis. The T body approach is a potent one when
either anti-hapten or anti-tumor Abs are employed (2, 3, 4, 5, 6, 7, 8).
Furthermore, murine T cells expressing the chimeric receptor were
proven to be competent effector cells in the prevention of tumor growth
in vivo (9).
In human patients many tumors escape immune surveillance
either because they do not induce an immune response or because they
evade immune recognition. Often the T cells of cancer patients are
anergized and thus nonreactive to the tumor markers they could
potentially recognize. Recent reports attribute some of these
states of unresponsiveness to alterations in the composition of the
TCR and defects in early stages of cellular activation (10, 11, 12, 13). Such
impaired signaling may limit the use of cTCRs of the scFvR
/
design, which are also dependent on TCR proximal kinases for signal
transduction. To bypass these receptor proximal events we have designed
a new type of cTCR, in which we combined the extracellular scFv with
intracellular protein tyrosine kinases (PTK).
The cytoplasmic PTKs, Zap-70 and Syk, members of the Syk family of
PTKs, have both been shown to participate in the T cell signal cascade
(14, 15). Zap-70 was originally discovered by virtue of its ability to
associate with
-chains (14), but was subsequently shown to also
associate with other CD3 components of activated T cells (16). Syk, a
72-kDa PTK, is abundant in several hemopoietic lineages (17) and is
activated upon association with the cytoplasmic domains of a number of
immune recognition receptors, including the B cell (18) and T cell (15)
Ag, Fc
(19), and Fc
(20, 21, 22, 23) receptors.
In an attempt to enhance the efficiency of the T body signal leading to target cell lysis and to determine the optimal configuration for chimeric scFv-PTK receptors, we have attached a scFv via different transmembrane domains to the PTKs Zap-70 and Syk, thus directly accessing the T cells own signaling machinery. Our results support the idea that these two kinases, although homologous in structure, have different regulatory restraints and signaling capabilities. Syk, when triggered in this manner, is capable of transmitting signals for T cell activation, while Zap-70 is not. Furthermore, in Syk-based chimeric receptors, we demonstrate the importance of connecting transmembrane and extracellular hinge domains for obtaining maximal responses to cell-derived signals.
| Materials and Methods |
|---|
|
|
|---|
Sp6 is an anti-2,4,6-trinitrophenyl (anti-TNP) mAb.
GK20.5 is an anti-Sp6 mAb. TNP modified fowl
-globulin
(TNP-F
G) or A.20 lymphoma cells (TNP-A.20) were made as previously
described (1, 2). Protein G-Sepharose was obtained from Pharmacia.
Oligonucleotide synthesis and DNA sequencing were performed at The
Weizmann Institute of Science (Rehovot, Israel).
Construction of chimeric receptors
Construction of the anti-TNP single chain Fv genes from the Sp6 mAb has been described previously (2). For isolation of the Zap-70 tyrosine kinase gene, reverse transcription-PCR was conducted on Jurkat human leukemia RNA using primers derived from the human sequence with appropriate restriction sites added. Similarly, a DNA fragment was prepared containing the coding sequence for the CD8 transmembrane and hinge regions (residues 116208). RNA from both Jurkat and anti-CD3-stimulated human T cells was used for reverse transcription-PCR of the human syk gene, using primers derived from the porcine sequence with comparison to the predicted human amino acid sequence (24). A DNA fragment encoding the human CD4 transmembrane region (residues 375395) was synthesized in both directions, ligated, and inserted between appropriate restriction sites. Constructs were sequenced in their entirety before insertion into the pRSV expression vector. Oligonucleotides for construction of four initial chimeric genes (Z4, Z8/H, S4, and S8/H) were synthesized as follows: zap-70 (PCR was performed to clone halves, and DNA pieces were later joined at the silent EcoRI site): first piece 5' primer, 5'-CGTCTAGAACCATGCCAGACCCCGCGGCGCACCTGCCCTTCTTCT-3'; first piece 3' primer, 5'-CCATCTGAATTCAGGGTGTCGATTCG-3'; second piece 5' primer, 5'-CGAATCGACACCCTGAATTCAGATGG-3'; second piece 3' primer, 5'-GCGTCGACTTCAGGCACAGGCAGCCTCAGCCTTCTG-3'; Syk (PCR was performed to clone halves, and DNA pieces were later joined at a HindIII site): first piece 5' primer, 5'-CGTCTAGAACCATGGCAGACAGTGCCAACCACTTGCCCTTCTTCT-3'; first piece 3' primer, 5'-TTCTTCCCCTCGGGGATGGAAAGCTTCCC-3'; second piece 5' primer, 5'-AAGGACAAAACTGGGAAGCTTTCCATCCC-3'; second piece 3' primer, 5'-CGCTCGAGTTTAATTAACCACATCGTAGTAGTA-3'; CD8 transmembrane plus hinge (including J region of heavy chain): 5' primer, 5'-CCGGTCACCGTCTCTTCAGCGCTGAGCAACTCCATCATGTACTTCAG-3'; 3' primer, 5'-CGTCTAGAGTGGTTGCAGTAAAGGGTGATAAC-3'; and CD4 transmembrane: sense oligonucleotide, 5'-GTCACCGTCTCTTCAGCGGCCCTGATTGTGCTGGGGGGCGTCGCCGGCCTCCTGCTTTTCATTGGGCTAGGCATCTTCTTCT-3'; antisense oligonucleotide, 5'-CTAGAGAAGAAGATGCCTAGCCCAATGAAAAGCAGGAGGCCGGCGACGCCCCCCAGCACAATCAGGGCCGCCGCTGAAGAGACG-3'.
Generation of subsequent chimeric receptors was performed as follows.
S8 (CD8 transmembrane only)
The CD8 hinge was removed until the EcoRV site, at the junction of the hinge and transmembrane regions. The following oligonucleotides were then ligated to the EcoRV site to provide a BstEII site for subsequent fusion to the scFv: 5'-GTCACCGTCTCTTCAGCG-3' and 3'-GCAGAGAAGTCGC-5'.
S4cys (CD4 transmembrane with added cysteine residue)
The following oligonucleotides were inserted at the NgoMI site of CD4 to introduce a cysteine residue at the transmembrane/scFv junction: 5'GTCACCGTCTCTTCATGCGCATTGATTGTGCTGGGGGGCGTCGG-3' and 3'-CAGAGAAGTACGCGTAACTAACACGACCCCCCGCAGCGGCC-5'.
S4/H (CD4 transmembrane with CD8 hinge)
The CD8 hinge, until the EcoRV site, was ligated to the CD4 transmembrane at an FspI site, which was introduced with the oligonucleotides used to make the S4cys construct.
S8/H* (wild-type CD8 transmembrane with mutated CD8 hinge)
The cysteine residues within the hinge and transmembrane domains of CD8 were changed to serines using the Chameleon double-stranded, site-directed mutagenesis kit (Stratagene, La Jolla, CA) and the following primers: 5'-pGCGCCCAGAGGCTAGCCGGCCAGCGGCG-3', 5'-pGCTGGACTTCGCCAGTGACATCTACATCTGGGCGCCCTTGGCCGGGACTAGTGGGGTCCTTCTC-3', and 5'-pGTTATCACCCTTTATTCGAACCACAGGAACC-3'. Once sequence changes were verified, the mutated hinge piece was ligated to a StyI site in the wild-type transmembrane to obtain the S8/H* receptor.
Expression of chimeric receptors
Transfection into the 27J cytotoxic murine hybridoma was performed by electroporation as previously described (2). Expression of receptors on the surface of transfected cells, selected in G418, was evaluated by immunofluorescence staining using the GK20.5 anti-Sp6 Id and FITC-labeled anti-mouse Fab' Ab. For Western blotting, cells were solubilized in lysis buffer (50 mM HEPES (pH 7.5), 150 mM NaCl, 1% Triton X-100, 2 mM EDTA, 2 mM EGTA, 50 mM NaF, 2 mM Na3VO4, 1 mM PMSF, 0.4% aprotonin (24.4 Trypsin Inhibitor Units/ml), 5 µg/ml leupeptin, and 10 µg/ml soybean trypsin inhibitor) and 50 µg of total lysate protein under partially reducing (lysates plus reducing sample buffer were incubated for 20 min at room temperature) or nonreducing conditions were separated on 10% SDS-polyacrylamide gels. Proteins were then transferred to nitrocellulose membranes and reacted with the GK20.5 Ab. Recognition of the primary Ab was visualized with the ECL (enhanced chemiluminescence) Western blotting detection system (Amersham, Aylesbury, U.K.).
For biotinylation studies, 3 x 107 cells were surface labeled with biotinamidocaproate N-hydroxysuccinimide ester (Sigma Chemical Co., St. Louis, MO) in sodium borate buffer for 15 min at room temperature. After extensive washing, cells were lysed as described above, and chimeric receptors were immunoprecipitated with the GK20.5 Ab bound to protein G-Sepharose. After SDS-PAGE and transfer to nitrocellulose, detection of biotinylated receptors was performed with peroxidase-labeled Extravidin (Sigma) and ECL.
Kinase assays
Kinase assays were performed on anti-Sp6 immunoprecipitates
that were washed three times in a buffer containing 50 mM HEPES (pH 7),
150 mM NaCl, 0.1% Triton, 10% glycerol, 1 mM
Na3VO4, and 5 mM NaF. Sepharose-bound
proteins were then incubated in the same buffer containing 10 mM
magnesium acetate, 10 mM MnCl2, and 20 µCi of
[
32P]ATP (3000 Ci/mmol; DuPont-New England Nuclear,
Boston, MA) for 10 min at room temperature and washed three more times
in wash buffer before resuspension in reducing sample buffer. After
separation by SDS-PAGE, proteins were transferred to polyvinylidene
difluoride (MSI, Westboro, MA), and the membrane was exposed to x-ray
film both before and after treatment with 1 N KOH for 1 h at
55°C.
Functional assays
To measure specific IL-2 production, transfectants were
incubated with TNP-modified A.20 cells or plastic-immobilized TNP-fowl
-globulin (TNP-F
G) in DMEM containing 10% FCS for 18 to 24
h. Supernatants were collected, and IL-2 was assayed as previously
described (25) using an IL-2-dependent CTL line and methyltetrazolium
acid staining. To evaluate the ability of transfectants to specifically
lyse TNP-labeled target cells, transfectants were preincubated with
immobilized TNP-F
G for 4 h and then tested in an 8-h
51Cr release assay (25). Both IL-2 and cytotoxicity
assays were performed in triplicate. The difference between replicate
measurements did not exceed 10% of the indicated value. Determination
of the ability of the different cells to produce IL-2 was repeated at
least six times. The cytotoxicity assay was performed at different E:T
ratios and was repeated at least twice for each cell. The figures
presented here depict representative experiments.
| Results |
|---|
|
|
|---|
As a model system, the scFv of an anti-TNP Ab, Sp6, was
attached to the PTKs Zap-70 or Syk via a transmembrane region. For this
purpose, the hinge and the transmembrane domains of CD8
, which
normally exist as a dimer on the cell surface, or the transmembrane
portion of CD4, which normally exists as a monomer on the cell surface,
were used. It has been shown that the CD8
hinge region is important
in the expression and extension of Ig-like domains (7, 26). The four
signaling molecules (Z4 and S4 for Zap-70 or Syk-derived receptors with
CD4 transmembrane; Z8/H and S8/H for Zap-70 or Syk-derived receptors
with CD8 transmembrane and hinge) were constructed as shown in Figure 1
A and cloned into an
expression vector that contains the Rous sarcoma virus long terminal
repeat promoter and the neomycin resistance gene (27). The DNA was
transfected into a mutant of the murine T cell hybridoma MD45. This
mutant, 27J, lacks the TCR as a result of defective production of its
-chain (28). Stable transfectants grown in media containing G-418
were assayed for cell surface expression of cTCRs by reacting cells
with an anti-Id Ab (GK20.5) to the scFv. Figure 2
shows representative staining patterns
of transfectants after FACS analysis. Chimeric receptors were expressed
at varying degrees, yet, in general, the CD8 transmembrane and
hinge-containing receptors (S8/H, Z8/H) were more efficiently brought
to the cell surface and/or were more accessible to recognition by the
GK20.5 Ab (see Discussion).
|
|
-32P]ATP. Zap-70-based molecules appear to be less
active in this assay (data not shown), consistent with recent results
describing this kinases inferior intrinsic enzymatic activity
compared with that of Syk molecules (29).
|
To assess their ability to initiate IL-2 production, cells
expressing the various Sp6-scFv-PTK receptors were stimulated with
plastic-immobilized TNP-modified carrier protein (TNP-F
G) or
TNP-modified murine B lymphoma cells (TNP-A.20 or TNP-L1210). Here and
throughout this study assays of IL-2 secretion were performed on a
fairly large number of clones per transfection, sometimes even multiple
transfections. Wherever possible, the analyses were performed on cells
expressing similar levels of chimeric receptors on their surface. Yet,
it should be noted that the clonal nature of these cells, in fact,
prohibits a precise quantitative comparison between them. The data
shown are representative experiments of each transfectants particular
behavior.
Despite effective cell surface expression, both Zap-70-based receptors,
Z4 and Z8/H, were unable to trigger the T cell hybridoma to secrete
cytokine when stimulated with either TNP-F
G or TNP-A.20 (Fig. 4
). Soluble TNP-F
G or additional
carrier proteins modified with TNP (such as BSA or keyhole limpet
hemocyanin) were also ineffective in triggering cytokine release in
these cells (data not shown). This inability to generate IL-2 cannot be
attributed to an intrinsic defect in IL-2 gene induction, since
treatment with TPA and calcium ionophore effectively stimulates IL-2
production in the scFv-Zap-70 transfectants (not shown).
|
G (Fig. 4
G molecule (not shown). Neither type
of receptor was stimulated with soluble TNP-F
G or unmodified F
G
(data not shown). Interestingly, when chimeric Syk transfectants were
incubated with TNP-modified B lymphoma cells (TNP-A.20 or TNP-L1210),
only the S8/H clones responded by secreting cytokine (Fig. 4
G stimulation were
unable to respond to TNP in cell-bound form. Increasing the
concentration of TNP used for modification of cells did not trigger a
response in S4 clones, nor did stimulation with other TNP-modified
target cells including the B lymphoma Baf, a murine fibrosarcoma
(WEHI-164), or IGROV, a human ovarian carcinoma (data not shown). S8/H
clones, however, responded in all these cases. Likewise, when Ag was
presented to transfectants following cellular processing of
TNP-modified protein, only the S8/H receptors were activated (not
shown). The CD8 hinge is responsible for the response to cell-bound Ag
To map the source of the differential response to cell-derived Ag
in S4 and S8/H receptors, we constructed two additional chimeric
receptors (Fig. 1
B). First, we attached the CD8
extracellular hinge piece onto the CD4 transmembrane portion (S4/H).
Transfection of this receptor DNA into 27J cells resulted in clones
resembling the S8/H transfectants. They showed increased surface
expression (Fig. 5
A)
and could respond to both immobilized protein- and cell-bound Ag at
levels similar to S8/H clones (Fig. 6
).
As shown previously, the S4 clone responded well to immobilized protein
Ag only.
|
|
Cysteine residues within the CD8 hinge are not necessary for its effect
CD8
normally exists on the cell surface as disulfide-linked
homo- or heterodimers (with CD8ß); cysteine residues within the CD8
hinge are responsible for this dimerization state (30, 31).
Accordingly, the scFv-Syk receptor containing the CD8 transmembrane and
hinge regions is detected in dimeric and multimeric forms when total
lysate protein is separated under nonreducing conditions and then
immunoblotted with anti-Id Ab (Fig. 7
A). Also, since
conditions required for recognition of the Sp6 idiotope by Ab GK20.5 do
not allow for complete reduction, we detected a larger protein band at
200 kDa in partially reduced lysates of S8/H cells, corresponding to
the dimeric form of the chimeric receptor (Fig. 7
A).
In contrast, the CD4-based receptor (S4) was found only in monomeric
form, whether reduced or not, as predicted from its amino acid sequence
(Fig. 7
A).
|
|
-chain or the Fc
R
-chain, which has
been shown to be responsible for dimerization of these two membranal
signaling proteins (32, 33). This receptor variation behaved similarly
to the original CD4-based construct in that it could only respond
to immobilized protein Ag (Fig. 8Cytolytic activity of T cells expressing chimerc Syk receptors
The six chimeric Syk receptors described above were tested for the
ability to initiate a signal leading to cytolysis of Ag-coated target
cells. To this end, representative transfectants of the cytotoxic
hybridoma were prestimulated with immobilized TNP-F
G and then
incubated with 51Cr-labeled, TNP-modified A.20 cells.
Figure 9
shows the percentage of
51Cr released from target cells. The ability of chimeric
receptors to signal for specific target cell lysis was, in general,
comparable to their ability to signal for specific IL-2 production.
That is, cells containing receptors with the CD8 hinge, whether wild
type or mutated (clones S4/H, S8/H, and S8/H*), could effectively
lyse Ag-modified target cells in a non-MHC-restricted fashion.
Transfectants bearing the mutated hinge (S8/H*), which, on the
whole, did not respond as well to cell-derived Ag in the IL-2 assay as
their S8/H (wild-type hinge) counterparts (Fig. 8
), were also somewhat
less cytolytic (Fig. 9
). Interestingly, a representative clone of the
S4 series, which could not secrete IL-2 upon incubation with
Ag-modified cells (see Fig. 4
), was able to recognize TNP-labeled
target cells under these experimental conditions and showed a low level
of specific cytolyis.
|
| Discussion |
|---|
|
|
|---|
-chain, and blunted calcium responses (10, 34).
Similarly, reduced expression of
-chains and
p56lck or altered tyrosine phosphorylation
patterns have been reported in tumor-infiltrating lymphocytes taken
from patients with colorectal or renal cell carcinoma or non-Hodgkins B
cell lymphoma (11, 12, 35). These receptor-proximal defects may
restrict the use of cTCRs of the scFv-
/
design, which are also
dependent on TCR-associated kinases for signal transduction. Yet, with
direct and immediate kinase activation upon Ag recognition, as offered
by the scFv-PTK design, this impaired signaling may be overcome.
Such signaling defects not only reflect the unresponsiveness of these
individuals T cells toward their own tumors, but are also reminiscent
of the unusual
phosphorylation states and defective kinase
recruitment/activation seen in altered peptide ligand-induced T cell
anergy (36, 37). Similar modified biochemical phenotypes are seen when
comparing signaling events elicited by alloantigen alone (leading to
anergy) or by alloantigen and B7-mediated costimulation; the anergic
state is characterized by a lack of CD3
and
hyperphosphorylation
and subsequent Zap-70 recruitment (38). Furthermore, recent findings
have also attributed the induction of T cell anergy to reduced
mitogen-activated protein kinase activities and a block of Ras
activation (39, 40). Signals downstream of Ras seem to be intact, as is
mitogen-activated protein kinase activity upon stimulation by an
alternative route, suggesting a defect at the level of specific
coupling between the TCR-CD3 complex and Ras (40). Since our current
knowledge of T cell activation places the Syk family of tyrosine
kinases as proximal signal transducers of the TCR signal (41) and, via
Cbl, on a pathway that regulates guanine nucleotide exchange on small G
proteins (42, 43, 44), it is tempting to suggest that their direct
activation may enable an anergic cell to overcome its signaling block.
Thus, although two signals are normally required for complete T cell
activation (45), direct activation of a Syk family kinase may bypass
the need for the second costimulatory signal, such as that delivered by
the CD28 receptor (46).
Collectively, this information prompted us to generate new scFv
chimeric receptors, similar in design to those we have described
previously (2), yet replacing the Fc
R
or TCR
intracellular
signaling regions with the early tyrosine kinase Zap-70 or Syk. In
general, this configuration resembles the chimeric molecules described
by Kolanus et al., in which PTKs were tethered to the plasma membrane
via CD7 transmembrane and CD16 extracellular domains (24). We reasoned
that Ag binding to the extracellular scFv portion of these chimeric
molecules should allow for direct triggering of the attached PTKs and
immediate stimulation of the T cells own signaling machinery. Indeed,
Syk-based receptors can efficiently trigger IL-2 production and target
cell lysis in an Ag-dependent manner (
Figs. 58![]()
![]()
![]()
). Although difficult
to compare between cloned transfectants, the scFv-Syk receptors are
certainly as effective, if not more so, than chimeras containing
or
intracellularly (C. Fitzer-Attas, and T. Waks, unpublished
observations). Interestingly, as in the double chain cTCR (1) and the
scFv
/
(2) designs, the scFv-Syk receptors are not activated by
soluble Ag, even in multivalent form (such as the TNP-F
G used in
this study; data now shown). Activation will only take place with
immobilized or cell-bound Ag, suggesting the need for receptor
clustering for signal transduction through the intracellular kinase
moiety as well. The magnitude of the IL-2 response from scFv-Syk
chimeras is quantitatively comparable to that produced from
anti-CD3 stimulation of the TCR/CD3-expressing hybridoma, MD45
(data not shown). A more rigorous test of the superior response of
kinase-based chimeras will require expression of the different
receptors in freshly isolated T lymphocytes or in a transgenic
environment.
In our T body approach we have also demonstrated the differences in
regulatory restraints imposed upon Zap-70 and Syk. The Zap-70-based
chimeric receptors, although efficiently expressed at the cell surface
(Fig. 2
) and able to autophosphorylate in in vitro kinase assays (Fig. 3
), were unable to elicit IL-2 production when exposed to Ag (Fig. 3
).
These results, in fact, concur with those of others who have described
a requirement for Src family tyrosine kinases in the activation of
Zap-70 in both Jurkat cells (24) and heterologous systems (47, 48).
Stimulation of scFv-Zap70 or scFv-Syk receptors with Ag bypasses the
initial activation of Src family kinases, an event that is apparently
essential for signal propagation through Zap-70. It has recently been
suggested that this dependence involves a transient association between
the Src family kinase and Zap-70, as well as their functional
cooperativity in the phosphorylation of substrates such as HS1 or Cbl
(48, 49). The inability of aggregated chimeric Zap-70 molecules to
initiate T cell functions (Fig. 3
) (24) may be due to the lack of Src
family kinase help in the phosphorylation of these or other substrates.
In contrast, we have previously shown that activation of chimeric Syk
molecules causes an increase in Syk-Cbl association and a rise in Cbl
phosphorylation in a manner that is apparently Src kinase independent
(42). Others have also demonstrated that Syk is not strictly dependent
on Src family kinases for its activation in Jurkat T cells (15, 24).
Our data thus support the idea that Syk, by virtue of its superior
kinase activity (29) and constitutive association with the TCR (15),
may be in a position to initiate T cell signals without the prior
activation of Src family kinases.
Receptor aggregation, rather than dimerization, is critical for T cell
activation through endogenous TCR/CD3 receptors (50, 51). The same
requirement exists when chimeric scFv-
or scFv-
have been used
for signaling (2). The highly homologous CD3
-chain and Fc
-chain both exist as disulfide-linked homodimers in their respective
receptor complexes due to transmembrane cysteine residues. Chimeric
receptors based on these molecules are also free to form homodimers or
heterodimers with the cells endogenous chains (2). In the
construction of chimeric receptors with cytosolic PTKs, it was
necessary to attach the extracellular Ab and intracellular signaling
domains via a transmembrane segment. We exploited this need by
incorporating dissimilar transmembrane segments, which can exist as
monomers (CD4) or dimers/multimers (CD8
), and studying their
signaling potential.
Our results indeed emphasize the importance of the transmembranal and
hinge moieties in this chimeric receptor design. Interestingly, while
both CD4 transmembrane (S4)-containing and CD8 transmembrane and hinge
(S8/H)-containing receptors could trigger IL-2 secretion in response to
immobilized protein Ag, only the latter were stimulated when incubated
with Ag-modified target cells (Fig. 4
). Although CD8-based receptors
were, in general, more highly expressed than those with CD4 sequences,
comparison of several transfectants expressing similar amounts of cell
surface receptors indicates that their phenotypic disparity is not due
solely to quantitative differences (data not shown). After generating
additional chimeric scFv-Syk receptors (Fig. 1
B), we
were able to map this differential response to the hinge region of
CD8
(Fig. 6
). Furthermore, after mutating or adding cysteine
residues to two receptors (Fig. 1
C), we concluded
that hinge elements other than disulfide bonds are essential for its
effect (Fig. 8
).
The membrane-proximal hinge region of CD8
is heavily decorated with
O-linked glycosylation, and these sugars are extensively
sialylated (52). These two features are responsible for the extended
and flexible structure of native CD8
in its reach for class I MHC
molecules (53). By incorporating hinge sequences into our chimeric
receptors, we may have conferred upon them a similar extended topology.
This is in agreement with our ability to detect the scFv by flow
cytometry with anti-Id Ab only on cells expressing receptors with
hinge moieties (Figs. 2
and 5
A and data not shown). These
correctly oriented or extended receptors are also those that can
respond to cell-derived Ag, most likely because of this same
far-reaching configuration. Supporting this theory is our finding that
only those receptors with extended hinges show efficient rosetting of
TNP-coated SRBC (data not shown). Similarly, in the construction of
single-chain Fc
RI
or
-chain receptors, it was found that a
membrane-proximal spacer region has a crucial role in their interaction
with cell-bound Ag, most likely via its ability to correctly orient the
receptors on the cell surface (7, 54). However, this same requirement
for a hinge region for recognition of cell-bound Ag is less obvious
when the anti-TNP scFv is connected to
or
signaling
molecules (C. J. Fitzer-Attas and T. Waks, unpublished data).
Apparently, attachment via the native transmembrane portion of
or
in these cTCRs is sufficient for this type of activation.
Contrary to these results, in the response of scFv-Syk chimeras to
another form of Ag, plastic-immobilized protein, the hinge is not a
necessity, since CD4 transmembrane-derived receptors functioned quite
well (Fig. 4
). Yet, interestingly, the CD8 transmembrane portion alone
is not able to transmit any signals upon stimulation (Fig. 6
) despite
effective surface expression (Fig. 5
B). Thus, the
composition of the transmembrane region is also a critical element for
receptor activation, and in the construction of kinase-based chimeric
molecules it is essential to evaluate the effect of individual
transmembrane segments on signaling. Most importantly, the effector
functions stimulated by kinase chimeras upon recognition of
cell-derived Ag are absolutely dependent on the presence of a
connecting hinge region. These studies should assist in development of
the optimal chimeric T cell transducing molecule for redirection and
activation of unresponsive T lymphocytes in the cancer patient.
| Footnotes |
|---|
2 Present address: G. W. Hooper Foundation, University of California, San Francisco, CA 94143. ![]()
3 Address correspondence and reprint requests to Dr. Zelig Eshhar, Department of Immunology, The Weizmann Institute of Science, Rehovot 76100, Israel. ![]()
4 Abbreviations used in this paper: cTCR, chimeric T cell receptor; scFv, single chain of the variable domain; PTK, protein tyrosine kinase; TNP, 2,4,6-trinitrophenyl; TNP-F
G, 2,4,6-trinitrophenyl modified fowl
-globulin. ![]()
Received for publication June 30, 1997. Accepted for publication September 22, 1997.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
E. Biagi, V. Marin, G. M. P. Giordano Attianese, E. Dander, G. D'Amico, and A. Biondi Chimeric T-cell receptors: new challenges for targeted immunotherapy in hematologic malignancies Haematologica, March 1, 2007; 92(3): 381 - 388. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. N. Cooper, Z. Al-Kadhimi, L. M. Serrano, T. Pfeiffer, S. Olivares, A. Castro, W.-C. Chang, S. Gonzalez, D. Smith, S. J. Forman, et al. Enhanced antilymphoma efficacy of CD19-redirected influenza MP1-specific CTLs by cotransfer of T cells modified to present influenza MP1 Blood, February 15, 2005; 105(4): 1622 - 1631. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Y. Mapara and M. Sykes Tolerance and Cancer: Mechanisms of Tumor Evasion and Strategies for Breaking Tolerance J. Clin. Oncol., March 15, 2004; 22(6): 1136 - 1151. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Pinthus, T. Waks, K. Kaufman-Francis, D. G. Schindler, A. Harmelin, H. Kanety, J. Ramon, and Z. Eshhar Immuno-Gene Therapy of Established Prostate Tumors Using Chimeric Receptor-redirected Human Lymphocytes Cancer Res., May 15, 2003; 63(10): 2470 - 2476. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Schaft, R. A. Willemsen, J. de Vries, B. Lankiewicz, B. W. L. Essers, J.-W. Gratama, C. G. Figdor, R. L. H. Bolhuis, R. Debets, and G. J. Adema Peptide Fine Specificity of Anti-Glycoprotein 100 CTL Is Preserved Following Transfer of Engineered TCR{alpha}{beta} Genes Into Primary Human T Lymphocytes J. Immunol., February 15, 2003; 170(4): 2186 - 2194. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang, E. Berenstein, and R. P. Siraganian Phosphorylation of Tyr342 in the Linker Region of Syk Is Critical for Fc{varepsilon}RI Signaling in Mast Cells Mol. Cell. Biol., December 1, 2002; 22(23): 8144 - 8154. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Haynes, J. A. Trapani, M. W. L. Teng, J. T. Jackson, L. Cerruti, S. M. Jane, M. H. Kershaw, M. J. Smyth, and P. K. Darcy Rejection of Syngeneic Colon Carcinoma by CTLs Expressing Single-Chain Antibody Receptors Codelivering CD28 Costimulation J. Immunol., November 15, 2002; 169(10): 5780 - 5786. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. K. Darcy, N. M. Haynes, M. B. Snook, J. A. Trapani, L. Cerruti, S. M. Jane, and M. J. Smyth Redirected Perforin-Dependent Lysis of Colon Carcinoma by Ex Vivo Genetically Engineered CTL J. Immunol., April 1, 2000; 164(7): 3705 - 3712. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Fitzer-Attas, M. Lowry, M. T. Crowley, A. J. Finn, F. Meng, A. L. DeFranco, and C. A. Lowell Fc{gamma} Receptor-mediated Phagocytosis in Macrophages Lacking the Src Family Tyrosine Kinases Hck, Fgr, and Lyn J. Exp. Med., February 21, 2000; 191(4): 669 - 682. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang and R. P. Siraganian CD45 Is Essential for Fc{epsilon}RI Signaling by ZAP70, But Not Syk, in Syk-Negative Mast Cells J. Immunol., September 1, 1999; 163(5): 2508 - 2516. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. She, M. C. Ruzek, P. Velupillai, I. de Aos, B. Wang, D. A. Harn, J. Sancho, C. A. Biron, and C. Terhorst Generation of antigen-specific cytotoxic T lymphocytes and regulation of cytokine production takes place in the absence of CD3{zeta} Int. Immunol., May 1, 1999; 11(5): 845 - 857. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang, M. L. Billingsley, R. L. Kincaid, and R. P. Siraganian Phosphorylation of Syk Activation Loop Tyrosines Is Essential for Syk Function. AN IN VIVO STUDY USING A SPECIFIC ANTI-Syk ACTIVATION LOOP PHOSPHOTYROSINE ANTIBODY J. Biol. Chem., November 3, 2000; 275(45): 35442 - 35447. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |