| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Division of Clinical Immunology and Allergy, Department of Medicine, UCLA School of Medicine, Los Angeles, CA 90095;
Department of Internal Medicine and Interdisciplinary Graduate Program in Immunology, University of Iowa, Iowa City, IA 52242; and
La Jolla Institute of Allergy and Immunology, San Diego, CA 92121
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, and
environmental stress, e.g., exposure to gamma irradiation,
hyperosmolarity, UV light, heat shock, lipid second messengers such as
ceramide, and anticancer drugs such as etoposide (5, 6, 7, 8, 9, 10, 11, 12). While
TNF--mediated apoptosis depends on the recruitment and activation of
caspases that interact directly with the TNF type I receptor (TNFR1)
(10, 11, 13, 14, 15, 16), the mechanism by which other stress stimuli induce
apoptosis is poorly defined. It has been demonstrated, however, that
all of the above stimuli have the capacity to activate the c-Jun
N-terminal kinase (JNK) cascade (6, 7, 8, 9, 13, 14, 15, 16, 17, 18), which, in turn, has
been linked to the regulation of apoptosis (7, 8, 9, 17, 19, 20, 21, 22). The
original observation that apoptosis may be linked to the activation of
the JNK cascade was made in PC12 pheochromacytoma cells during nerve
growth factor withdrawal (20). Moreover, introduction of constitutively
active mitogen-activated protein kinase kinase kinase (MEKK1), the
principal MAP kinase in the JNK cascade (23), resulted in increased
apoptosis in PC12 cells, while dominant interfering mutants of c-Jun, a
downstream target of the JNK cascade, blocked apoptosis induction by
nerve growth factor withdrawal (20). In gamma-irradiated T lymphocytes,
an intimate temporal relationship between activation of the JNK cascade
and induction of apoptosis has been demonstrated (7, 9). In addition, a
dominant negative (DN) version of the Jun kinase kinase,
SAP/extracellular signal-regulated kinase kinase SEK, or a dominant
interfering version of c-Jun interfered with ceramide-induced apoptosis
in other hematopoietic cell types (17). Recently, a novel
mitogen-activated protein kinase (MAPK), ASK1, which activates the JNK
cascade in epithelial cells, has been described and shown to induce
apoptosis. In addition, DN-ASK1 interfered in the induction of
apoptosis by TNF- (22). The role of JNK cascade in apoptosis is controversial, because induction of apoptosis by the TNFR1 or the Fas receptor is not hindered by disruption of the JNK cascade, e.g., by introduction of dominant interfering TRAF2 or JNK mutants (14, 24). Moreover, Johnson et al. have shown that dominant active (DA) MEKK1-mediated apoptosis in fibroblasts is not dependent on JNK or c-Jun activation (21). One view is that the activation of the JNK cascade by TNFR1 and Fas is a bystander event that follows rather than leads to apoptosis (14, 19). This is in agreement with the fact that a nucleus, and consequently activating protein-1 (AP-1)-induced gene expression, is not a critical requirement for apoptosis (14). What needs to be considered, however, is the possibility that the JNK cascade may regulate the expression of receptors, e.g., Fas and Fas ligand (FasL), that induce apoptosis. Taken together, the role of the JNK cascade in stress-induced apoptosis is controversial and needs to be clarified.
We have noticed that transient expression of DA-MEKK1 in Jurkat T cells leads to induction of apoptosis (not shown). More recently, we have begun to use the tetracycline (tet)-regulated vector system to control gene expression in lymphocytes (25, 26, 27, 28). We therefore set out to determine whether inducible expression of DA-MEKK1 will lead to apoptosis in Jurkat cells, and whether this system is useful to clarify the mechanism of apoptosis induction by the JNK cascade. We demonstrate that constitutive activation of the JNK cascade by DA-MEKK1 induces apoptosis in Jurkat cells. This apoptotic event was accompanied by increased expression of Fas and FasL and could be inhibited by Fas-Fc protein. While different types of stress, including UV, gamma irradiation, anisomycin, and anti-Fas Ab, could induce apoptosis and prolonged JNK activation, Fas-Fc protein inhibited some but not all stress-induced apoptotic events. These results show that the JNK cascade, in association with other signaling pathways, plays an important role in stress-induced apoptosis.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The anti-CD3 mAb, OKT3, was from Ortho Pharmaceuticals
(Raritan, NJ) and anti-Fas mAb (CH11) was purchased from MRL
(Camarillo, CA). Anti-CD28 (9.3) was a generous gift from Bristol-Myers
Squibb Pharmaceutical Research Institute (Seattle, WA). Anti-ERK mAb
was purchased from Zymed (San Francisco, CA), and horseradish
peroxidase-conjugated protein A was purchased from Amersham (Arlington
Heights, IL). The GST-c-Jun construct was generously provided by Dr. J.
Woodgett (Ontario Cancer Institute, Ontario, Canada). G418, hygromycin,
anisomycin, PMA, and ionomycin were purchased from Sigma (St. Louis,
MO). The Cbz-Val-Ala-Asp-(Ome)-fluoromethyl ketone (Z-VAD) peptide was
from Enzyme Systems (Dublin, CA). The tet-repressible system, including
the pUHD15.1, pUHD10.3, pTPH, and pUHC13.3 vectors, was a kind gift
from Dr. H. Bujard (Heidelberg, Germany) (25, 26). The pUHD15.1 plasmid
encodes for the tetracycline-controlled transactivator (tTA), which
consists of the tet repressor from Escherichia coli fused to
the activating domain of the viral protein VP16 (25, 26). The pUHD10.3
plasmid contains a tTA-dependent promoter, consisting of seven tet
operator sequences upstream of a minimal PhCMV-1 promoter
and a multiple cloning site (25, 26). The pTPH plasmid was derived from
pUHD10.3 and carries the hygromycin-resistance cassette. The reporter
plasmid, pUHC13.3, contains the tet operator sequences and the
PhCMV promoter upstream of a luciferase gene. The cDNA for
DA-MEKK-1 (MEKK
) and DN-MEKK (MEKK K432 M) were a gift from Dr.
G. Johnson (National Jewish Center for Immunology and Research, Denver,
CO) (21). DA-MEKK1 and DN-MEKK1 were subcloned into the multiple
cloning site of pUHD10.3. The FasL promoter construct, consisting of
the first 486 nucleotides upstream of the start site, has been
previously described (27)
Transfection and generation of stable transfectants
A subclone of Jurkat cells, BMS2, selected for strong
responsiveness to CD28 coligation, was a generous gift from Dr. Robert
Mittler (Bristol-Myers Squibb). An aliquot of 107
Jurkat BMS2 cells was transfected by electroporation with 10 µg of
pUHD15.1 plasmid as previously described (28). Cells were selected in 2
mg/ml of G418 for several weeks, cloned by limiting dilution, and
tested for the expression of the tTA by transient transfection of the
reporter construct, pUHC13.3 (see Fig. 2
A). This
allowed selection of a clone, designated Jurkat-tTA, that stably
expresses tTA. Jurkat-tTA cells were simultaneously transfected with 20
µg of pUHD10.3 encoding DA-MEKK1 in the presence 5 µg of pTPH
plasmid. Cells were selected in 270 µg/ml of hygromycin for 4 wk
before the start of experiments.
|
A total of 107 Jurkat-tTA cells were transiently transfected with 10 µg of pUHC13.3 vector. Duplicate samples were pooled and grown in the presence or absence of 0.1 µg/ml of tet as indicated. For FasL promoter studies, DA-MEKK1 cells were transiently transfected with 50 µg of FasL-Luc construct. The cells were washed, lysed in luciferase buffer (Analytical Luminescence, Ann Arbor, MI), and luciferase activity measured by using 100 µg of protein in a Monolight 2010 luminometer (Analytical Luminescence) (28).
Western blot analysis
Tet was withdrawn for 24 h from aliquots of 107 Jurkat-tTA cells transfected with DA-MEKK1. The cells were stimulated with 100 nM of PMA for 10 min, washed, and lysed as previously described (28). In all, 100 µg of cell lysates were separated by 10% SDS-PAGE and transferred to Immobilon-P membranes (Millipore, Bedford, MA). The membranes were probed with 0.2 µg/ml of anti-ERK, followed by 1:3000 dilution of horseradish peroxidase-coupled protein A (29). The blots were developed by enhanced chemiluminescence according to the manufacturer’s instructions.
JNK assays
A total of 5 x 106 Jurkat cells were stimulated with 200 J/m2 UV, 3300 rad gamma irradiation, 1 µg/ml anisomycin, 100 ng/ml anti-Fas Ab, or a combination of 10 µg/ml anti-CD3 plus 2 µg/ml anti-CD28 for the indicated time period. The cells were lysed in 25 mM HEPES, pH 7.4, 50 µM ß-glycerophosphate, 1 mM EDTA, 1% Triton X-100, 10 µM p-nitrophenylphosphate, 1 mM sodium orthovanadate, 2.5 mM MgCl2, 2 mM PMSF, 10 µg/ml leupeptin, and 2 U/ml aprotinin. The supernatants were incubated with recombinant GST-c-Jun (1–79) bound to glutathione-coupled beads, and the complex washed extensively in lysis buffer. Kinase assays were performed as previously described (28). Fold increase in kinase activity was determined by densitometric analysis of the autoradiographic image as well as by subjecting gel slices to Cerenkov counting.
Measurement of apoptosis
The method of 7-amino actinomycin D (7-AAD) staining was used to distinguish apoptotic from live cells (30, 31). Aliquots of 106 cells were incubated with 1 µg/ml of 7-AAD (Calbiochem, San Diego, CA) for 10 min at room temperature and analyzed by flow cytometry on a Becton Dickinson (Mountain View, CA) instrument using the analysis program Lysis II. This program distinguishes dead cells from cells undergoing apoptosis (31). To perform DNA laddering, genomic DNA was extracted by lysing the cells in lysis buffer containing 0.5 mg/ml of proteinase K and 100 µg/ml of RNase A, followed by phenol-chloroform purification (32, 33). DNA was separated on 2% agarose gel electrophoresis and the gels were viewed by UV transillumination. Trypan blue staining was used to determine cell viability as determined by two independent observers. To determine the effect of the recombinant Fas-Fc protein (33) on induction of apoptosis by UV, gamma irradiation, and anisomycin, cells were incubated with 25 µg/ml of Fas-Fc for 15 min at room temperature before application of the stimulus as described above (33).
Fas and FasL expression
DA-MEKK1 cells were grown under off (tet(+)) or on (tet(-)) conditions for 24 h (28). For comparison, Jurkat-tTA cells were either left untreated or were stimulated with 100 nM PMA + 1 µg/ml ionomycin for 12 h. Immunostaining for Fas and FasL expression was performed by incubating the cells with the anti-Fas (CH11) or anti-FasL (NOK1) mAb, followed by FITC-coupled anti-mouse Ig. The cells were analyzed by flow cytometry, using the Cell Quest program (Becton Dickinson).
RNA extraction and reverse transcriptase (RT)-PCR
Unstimulated and stimulated cells were washed and RNA was extracted using TRIzol according to the manufacture’s recommendations (Life Technologies, Gaithersburg, MD). Reverse transcription was performed at 42°C in the presence of 200 nM oligo(dT), 0.1 M DTT, 0.5 U RNAguard, 10 mM dNTP, 2 U MMTV, and 10 µg RNA (28). Semiquantitative PCR was conducted with Taq polymerase for 30 cycles consisting of 1 min at 94°C, 1 min at 52°C, and 1 min at 72°C. The primers used for ß-actin amplification were: sense 5' AATCTGGCACCACACCTTCTACA and antisense 5' CGACGTAGCACAGCTTCTCCTTA, while the primers for FasL were 5' CAACTCAAGGTCCATGCCTC and antisense 5' AGATTCCTCAAAATTGACCAG. The PCR products were separated by 2% agarose gel electrophoresis and the gels were viewed by UV transillumination.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Chen et al. (7) and Chen, Meyer, and Tan (9) demonstrated an
intimate temporal relationship between activation of the JNK cascade
and induction of apoptosis in gamma-irradiated T cells. In addition to
gamma irradiation, we found that exposure to UV, anisomycin, and
anti-Fas Ab can induce apoptosis in Jurkat cells (Table I). Moreover, the same range of stimuli
induced prolonged (>6 h) activation of the JNK cascade in Jurkat cells
(Fig. 1A). Compared
with unstimulated cells, the overall magnitude of stimulation by UV,
gamma irradiation, and anisomycin amounted to 11-, 6-, and 10-fold,
respectively. Transient activation of the JNK cascade by coligating the
CD3 and CD28 receptors (Fig. 1B) did not lead the
induction of PCD (Table II). Instead,
CD28 coligation exerted an antiapoptotic effect on TCR-induced cell
death (Table II). Please note that CD3 ligation in the absence of CD28
costimulation does not induce JNK activity (28). Taken together, these
data suggest that the Jun kinase cascade and the kinetics of JNK
activation may play an important role in stress-induced apoptosis.
Because the mechanism of action of this cascade in stress-induced
apoptosis is unknown, we used DA-MEKK1 expression to study the role of
the JNK cascade in apoptosis in Jurkat cells.
|
|
|
We established a Jurkat cell line that stably expresses the
tet-regulated transcriptional activator protein, tTA. In the absence of
tet, genes inserted downstream of a modified E. coli tet
operator are induced (Fig. 2
A) (25, 26).
Subsequent transfection of Jurkat-tTA cells with a tet-suppressible
vector (pUHD10–3) containing a DA-MEKK1 (MEKK1) (10) insert yielded
a cell line in which the JNK cascade was constitutively active in the
absence, but not the presence, of tet (Fig. 2B).
Compared with tet(+) cells, unstimulated tet(-) cells showed an
eightfold increase in JNK activity (Fig. 2B,
lanes 1 and 3). The specificity
of this mutant kinase in the activation of the Jun kinase cascade was
demonstrated by the failure of the expressed DA-MEKK1 gene to induce
ERK activation (Fig. 2C).
DA-MEKK1 induces apoptosis in parallel with JNK activation in Jurkat cells
Jurkat-MEKK1 cells, grown in the absence of tet, showed an
increase in the number of trypan blue-positive cells in the population
(Fig. 3A). Although
there is an apparent lag period of about 12 h before the onset of
cell death, this delay reflects the time required for DA-MEKK1
expression and JNK activation (Fig. 3, A and
B). On comparing the kinetics of JNK activation with
the onset of cell death, we noticed that JNK activity began to increase
from 6 h onwards and peaked at 48 h (Fig. 3, A and
B). At that time point, 58% of cells in the
population were dead, and continued to increase to yield 70% dead
cells 72 h after tet withdrawal (Fig. 3, A and
B). The decrease in JNK activity beyond the 48-h time
period is due to the rapid decline in cell viability (Fig. 3B). Dying cells in the tet(-) population were
characterized by surface membrane blebbing, chromatin condensation, and
appearance of apoptotic bodies, which collectively represent the
features of apoptotic cell death (Fig. 4A) (19). To confirm
that these cells indeed entered a program of PCD, we used 7-AAD
staining and DNA laddering to demonstrate the characteristic pattern of
DNA damage that accompanies apoptosis (Fig. 4, B and
C) (13). Compared with tet(+) cells,
DA-MEKK1-expressing Jurkat cells showed a dramatic increase in 7-AAD
uptake as determined by flow cytometry (Fig. 4B). The
estimated rate of apoptosis in Jurkat-MEKK1 cells was 40% after
48 h (Fig. 4B). Anti-Fas mAb was used as a
positive control for apoptosis. Moreover, while expression of DA-MEKK1
induced DNA fragmentation, cells maintained in the presence of tet
failed to show DNA laddering (Fig. 4C). Taken
together, these results show that prolonged DA-MEKK1 expression and JNK
activation induce apoptosis in Jurkat cells.
|
|
Possible roles for DA-MEKK1 in induction of apoptosis include
regulation of the cellular apoptosis threshold (34), as well as
expression of receptors or ligands that induce apoptosis. Concerning a
possible role of the JNK cascade in the expression of modulators of
apoptosis, it has been shown that Ras, which acts upstream of the JNK
cascade in T lymphocytes, regulates Bcl-2 and Bcl-xL
expression in hemapoietic cells (35). These proteins heterodimerize
with Bax, thereby inhibiting the formation of toxic Bax homodimers,
which are required for apoptosis induction (36). Western blots that
detect Bcl-2, Bcl-xL, and Bax (37) failed to show a change
in the levels of these proteins in DA-MEKK1-expressing Jurkat cells
(not shown). We did, however, observe a dramatic increase in Fas and
FasL expression in Jurkat DA-MEKK1 cells. First, constitutive Fas
expression in Jurkat cells, as determined by flow cytometry, was
increased in tet(-) compared with tet(+) DA-MEKK1 cells (Fig. 5A). DA-MEKK1-induced
Fas expression was more abundant than the increase obtained with PMA
and ionomycin treatment in a control population (Fig. 5A). While untransfected or tet-treated DA-MEKK1
Jurkat cells failed to express FasL, DA-MEKK1-expressing cells showed a
dramatic increase in FasL expression (Fig. 5A). As
for Fas, the FasL response in DA-MEKK1-expressing cells was more robust
than the response obtained in PMA- and ionomycin-treated Jurkat-tTA
cells (Fig. 5A). To determine whether the appearance
of FasL on the membrane is accompanied by a change in message
expression, we extracted total cellular RNA that was reverse
transcribed to cDNA, utilizing oligo(dT) primers and MMLV reverse
transcriptase (38). Subsequent amplification with a set of FasL primers
showed that while tet(+) cells lacked FasL message, DA-MEKK1-expressing
cells showed abundant FasL mRNA (Fig. 5B).
DA-MEKK1-induced FasL mRNA expression was more abundant than in PMA-
plus ionomycin-treated cells, which is in accordance with flow
cytometry data (Fig. 5, B and C). Taken
together, these results show that DA-MEKK1 expression induces increased
FasL mRNA and protein levels, which together with increased Fas
expression, may be responsible for the induction of apoptosis in Jurkat
cells.
|
C). These results
indicate that interference with the Fas-FasL interaction prevents the
induction of apoptosis by DA-MEKK (Fig. 5C).
To determine whether the stress stimuli depicted in Figure 1A can induce FasL expression, we used the flow cytometry
approach shown in Figure 5, but could not obtain reliable data due to
the rapid rate of cell death. We therefore employed a cysteine-protease
inhibitor, Z-VAD, which interferes with the activation of CPP32 and
ICE-like caspases (39-41), to determine whether we can prevent cell
death long enough to determine FasL expression. Table III shows that inclusion of Z-VAD in the
culture medium had a dramatic effect on the induction of apoptosis in
Jurkat T cells by noxious stimuli and anti-Fas Ab. Overall, there
was >80% inhibition of cell death in response to stimulation with UV,
gamma irradiation, anisomycin, and anti-Fas mAb (Table III). These
stressed but surviving Z-VAD-exposed cells were analyzed for FasL as
determined by flow cytometry analysis (Fig. 6). This showed definitive evidence of
FasL expression in anisomycin, UV, and gamma-irradiated Jurkat cells
(Fig. 6). These results indicate that induction of cell stress by
stimuli that also induce JNK activation leads to
FasL expression. This suggests that FasL expression may play a role in
induction of apoptosis by environmental stress.
|
|
To confirm that DA-MEKK1 and stress stimuli affect the FasL gene,
we studied their effect on a FasL promoter reporter. We have previously
described that treatment with anti-CD3 and PMA plus ionomycin
induce activity of a luciferase reporter gene driven by 486 bp of
genomic DNA immediately 5' of the FasL translational start site (27).
Transient transfection of this construct into Jurkat DA-MEKK1 cells
showed 3.8- and 5.3-fold activation by anti-CD3 and PMA plus
ionomycin, respectively, in tet(+) cells (Fig. 7A). After removal of
tet, FasL-Luc activity increased to 7.9-fold without any additional
stimulation (Fig. 7A). Treatment with anti-CD3 or
PMA plus ionomycin did not significantly enhance further the response
in tet(-) cells (Fig. 7A), showing that DA-MEKK1
expression alone resulted in maximum activation of the FasL
promoter.
|
B). Luciferase activity was
compared in tet(+) and tet(-) cells. UV, gamma irradiation, and
anisomycin induced 5.3-, 5.5-, and 4.1-fold increases in luciferase
activity, respectively, in tet(+) cells. This response was reduced to
1.7-, 1.6-, and 1.1-fold, respectively, in DN-MEKK1-expressing cells
(Fig. 7B). Taken together, these results show that
MEKK1 plays an important role in the transcriptional activation of the
FasL promoter. Fas-Fc protein interferes in induction of apoptosis by anisomycin but not by UV and gamma irradiation
Induction of FasL expression constitutes a powerful
mechanism by which cells regulate apoptosis (42). Since UV, gamma
irradiation, and anisomycin were found to enhance the expression of
FasL on the surface of Jurkat cells (Fig. 6), we determined whether
interference with Fas binding to FasL will affect apoptosis induction
by these stimuli. Addition of recombinant Fas-Fc proteins to the
culture medium interfered with anisomycin-mediated apoptosis, reducing
the rate of cell death by >60% (Fig. 8). As shown in Figure 5C, Fas-Fc
inhibited DA-MEKK1-induced apoptosis by >80% (Fig. 8). In contrast,
Fas-Fc had little effect on induction of cell death by UV or gamma
irradiation (Fig. 8). These results indicate that while FasL expression
is important for the induction of apoptosis by anisomycin, this ligand
is not critical for induction of cell death by UV and gamma
irradiation. This suggests that UV and gamma irradiation utilize
alternative pathways to induce apoptosis.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, A and
B). We used tet-regulated expression of DA-MEKK1 in
Jurkat cells to study the involvement of the JNK cascade in
stress-induced apoptosis (Figs. 3, 4, and 5). We demonstrate that the
increased rate of apoptosis in DA-MEKK1-expressing Jurkat cells is due
to increased expression of FasL (Fig. 5, A and
B). Fas-Fc protein interfered in the induction of
apoptosis by DA-MEKK1 (Fig. 5C). While stress-induced
apoptosis in response to anisomycin was accompanied by FasL expression,
activation of the FasL promoter, and was Fas-Fc suppressible (
Figs. 6–8), Fas-Fc did not interfere in apoptosis induction by UV treatment
or gamma irradiation (Fig. 8). These data show that while some types of
cellular stress utilize the JNK cascade to induce apoptosis, other
types of stress lead to apoptosis in a JNK-independent fashion.
The tet-controlled gene expression system exhibits highly regulated and
tight control of gene expression (25, 26). This system is ideal for
performing in vivo biochemistry as demonstrated by the use of DA-MEKK1
to activate the JNK cascade and induce apoptosis in Jurkat cells (Fig. 3, A and B). While
isopropyl-1-thio-ß-D-galactopyranoside-inducible DA-MEKK1
expression in fibroblasts leads to apoptosis, this response differs
form Jurkat cells in that JNK activation is not required for PCD in
fibroblasts (21). Jurkat cells showed an intimate temporal relationship
between activation of the JNK cascade and induction of apoptosis (Fig. 3). The importance of the kinetics of JNK activation in the induction
of apoptosis in Jurkat cells is further underscored by the finding that
transient JNK activation by CD3 plus CD28 coligation does not lead to
apoptosis (Table II). These findings are in agreement with Chen et al.
(7) and Chen, Meyer, and Tan (9), who demonstrated that stress-induced
apoptosis in lymphocytes is accompanied by prolonged JNK activation.
While the explanation for prolonged JNK activation in the induction of
PCD is unknown, it is possible that this reflects regulation of AP-1
proteins and AP-1 response elements at a nuclear level. JNKs induce the
transcriptional activation as well as increased expression of c-Jun
(42). This may explain why dominant interfering c-Jun mutants are able
to disrupt ceramide-induced apoptosis or apoptosis induced by growth
factor withdrawal in PC12 cells (17, 20). JNKs also contribute to
transcriptional activation of the ternary complex factor, Elk-1, which
acts at the level of the c-fos promoter to increase
expression of that gene (43, 44). It is interesting, therefore, that
c-fos and c-jun proto-oncogenes have been found
to play a role in PCD during growth factor deprivation in lymphoid cell
lines (45). The effects of these proto-oncogenes on apoptosis could be
opposed by c-fos and c-jun antisense
oligonucleotides (45). Possible targets for AP-1-regulated apoptosis
include genes that encode for proapoptotic proteins. An example is the
Fas gene, which includes an AP-1 response element (TGAGTAA) at
position -552 to -449 (46). This may explain the flow cytometry data
that show increased Fas expression in DA-MEKK1-expressing cells (Fig. 5A). We are currently looking at regulation of the
Fas promoter by MAPK cascades. Another possible target for the JNK
cascade is the FasL gene, since we have shown that both FasL message
and protein can be induced in DA-MEKK1-expressing Jurkat cells (Fig. 5, A and B, and Fig. 6). Indeed, we found that
DA-MEKK1 up-regulates the transcriptional activation of the FasL
promoter in Jurkat cells (Fig. 7A). Although much
remains to be learned about specific response elements in the FasL
promoter, it is interesting that there is a consensus AP-1 element
(TGACTCA) 10 to 16 nucleotides upstream from the start site (47).
Further experimentation will be required to determine whether this
element, or other any sequence in the FasL promoter, is regulated by
DA-MEKK1. Although it has been demonstrated that Fas induces JNK
activation without requiring AP-1 response elements for induction of
apoptosis (24), this situation differs from the experimental approach
we describe. First, the induction of apoptosis by receptors that
express death domains (e.g., Fas, TNFR1) can proceed independently of
JNK activation and are typically rapidly executed events (14). Second,
activation of the JNK cascade by Fas is a delayed event (24) that
probably requires prior activation of caspases (48). Third, at the
commencement of stress exposure, there are no ligands for death domain
receptors expressed on the cell surface. This places JNK activation in
a primary role from where it may induce expression of FasL (Fig. 6) or
TNF- (49) to commit cells to apoptosis. It is possible that in this
setting, there is induction of AP-1 response elements that regulate
these genes. It is also possible that MEKK1 regulates response elements
other than AP-1, for instance, NF-
B binding sites. To this end, it
has been shown that DA-MEKK1 induces activation of the IB kinase,
which leads to release of Rel proteins (50). We are in the process of
studying the role of AP-1 and NF-B response elements in the Fas
promoter.
Our data, which show that DA-MEKK1 induces FasL expression in Jurkat
cells, provide a novel explanation for the role of the JNK cascade in
stress-induced apoptosis (Figs. 5 and 6). This finding is strengthened
by data showing that Fas-Fc protein interferes with certain types of
stress-induced apoptosis, e.g., anisomycin treatment (Fig. 5C). This finding implies that stress stimuli that
use FasL expression utilize the same pathway for apoptosis induction as
the TCR (1, 2). In activated lymphocytes, TCR can induce cell death
through the expression of FasL. Since TCR itself does not activate the
JNK cascade (28), it suggests that diverse signaling pathways lead to
FasL expression. To this end, it has been shown that the TCR-associated
protein tyrosine kinase, p56lck, can induce FasL
message (38). Moreover, we have also shown recently that Ras is
involved in the activation of the FasL promoter as well as the JNK
cascade in Jurkat cells (28, 51). It is important to point out that not
all types of stress that induce JNK activation use the Fas/FasL
mechanism to induce apoptosis. For instance, while TNFR1- or
Fas-mediated apoptosis was accompanied by prolonged JNK activation,
interference in JNK activation by DN-TRAF2 or DN-JNKK, respectively,
did not affect induction of apoptosis (14, 24). A possible explanation
is that these receptors, through the recruitment of postreceptor
proteins with death domains, lead to direct activation of caspase
cascades (10, 11, 52, 53). In this setting, the JNK cascade is not
required for receptor expression. The inability of Fas-Fc protein to
interfere in UV- and gamma irradiation-induced apoptosis suggests the
existence of additional stress-induced apoptosis pathways by which
stress stimuli may induce apoptosis (Fig. 8). For instance, both UV and
gamma irradiation are potent inducers of p38MAPK
(54). At reduced doses of UV and gamma irradiation, apoptosis can be
partly overcome with Fas-Fc protein. For instance, the addition of
Fas-Fc protein to cells exposed to 1500 rad reduced the rate of
apoptosis by 40%. It is interesting to note that when apoptosis is
averted by a cysteine protease inhibitor, Z-VAD, FasL expression does
occur in UV-exposed and gamma-irradiated cells (Fig. 6). We propose
that prolonged JNK activation by stimuli that do not directly engage
caspase cascades utilizes FasL expression as a back-up mechanism to
eliminate activated or damaged T cells from the immune system. Under
these circumstances a cell nucleus will be required for apoptosis. It
is possible that activation of the JNK cascade by UV, gamma
irradiation, TNF-, and anti-Fas is the result rather than the
cause of cell death (14, 19). It is noteworthy that ceramide release,
which leads to JNK cascade activation (6, 17), follows the activation
of caspases (48). This biphasic JNK response, which is depicted in
Figure 1A, during anti-Fas stimulation is in keeping
with this possibility.
It is clear from the foregoing that the role of the JNK cascade in apoptosis is complex and should consider the cell type as well as the type of cellular stress that is involved. Judged by the different effects of dominant interfering c-Jun mutants on apoptosis in PC12 cells, fibroblasts, and myeloid cells (17, 20, 21), it is clear that there are tissue-specific differences in the role of JNK in apoptosis. Within the immune system, the JNK cascade may play different roles in thymocytes and peripheral blood T cells. For instance, it has been demonstrated that sek-/- chimeric mice have normal numbers of mature T cells but fewer immature CD4+/CD8+ thymocytes (55). It has therefore been suggested that Sek-1, a JNK, plays an antiapoptotic role in the thymus (55). Moreover, Sen et al. demonstrated that another MAP kinase cascade, p38MAPK, which is induced by cellular stress, plays a role in T cell survival in the thymus (56), whereas Graves et al. have shown that activation of the JNK and p38MAPK cascades by membrane Ig leads to apoptosis in B lymphocytes (57). As for the JNK cascade, p38MAPK may play different roles in apoptosis induction in different tissues. It is possible that the p38MAPK cascade may play an important role in the induction of apoptosis by gamma irradiation or UV exposure.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Andre Nel, UCLA School of Medicine, Department of Medicine, CIA, 52–175 CHS, 10833 Le Conte Ave, Los Angeles, CA 90095. E-mail address:
3 Abbreviations used in this paper: PCD, programmed cell death; MAPK, mitogen-activated protein kinase; ERK, extracellular signal-regulated kinase; JNK, c-Jun N-terminal kinase; DN, dominant negative; DA, dominant active; TNFR1, TNF receptor type I; MEKK1, mitogen-activated protein kinase kinase kinase; FasL, Fas ligand; AP-1, activating protein-1; Z-VAD, Cbz-Val-Ala-Asp-(Ome)-fluoromethyl ketone; tTA, tetracycline-controlled transactivator; RT, reverse transcriptase; tet, tetracycline; 7-AAD, 7-amino actinomycin D.
Received for publication June 2, 1997. Accepted for publication September 22, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  W.-T. Liao, C.-L. Yu, C.-C. E. Lan, C.-H. Lee, C.-H. Chang, L. W. Chang, H.-L. You, and H.-S. Yu Differential effects of arsenic on cutaneous and systemic immunity: focusing on CD4+ cell apoptosis in patients with arsenic-induced Bowen's disease Carcinogenesis, June 1, 2009; 30(6): 1064 - 1072. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Kadohara, M. Nagumo, S. Asami, Y. Tsukumo, H. Sugimoto, M. Igarashi, K. Nagai, and T. Kataoka Caspase-8 Mediates Mitochondrial Release of Pro-apoptotic Proteins in a Manner Independent of Its Proteolytic Activity in Apoptosis Induced by the Protein Synthesis Inhibitor Acetoxycycloheximide in Human Leukemia Jurkat Cells J. Biol. Chem., February 27, 2009; 284(9): 5478 - 5487. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Mongan, Z. Tan, L. Chen, Z. Peng, M. Dietsch, B. Su, G. Leikauf, and Y. Xia Mitogen-activated Protein Kinase Kinase Kinase 1 Protects against Nickel-induced Acute Lung Injury Toxicol. Sci., August 1, 2008; 104(2): 405 - 411. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-Y. Kim, J.-H. Park, J.-S. Mo, E.-J. Ann, S.-O. Han, S.-H. Baek, K.-J. Kim, S.-Y. Im, J.-W. Park, E.-J. Choi, et al. Downregulation by lipopolysaccharide of Notch signaling, via nitric oxide J. Cell Sci., May 1, 2008; 121(9): 1466 - 1476. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. C. Lee, C.-Y. Chuang, P.-K. Lee, J.-S. Lee, R. W. Harper, A. B. Buckpitt, R. Wu, and K. Oslund TRX-ASK1-JNK signaling regulation of cell density-dependent cytotoxicity in cigarette smoke-exposed human bronchial epithelial cells Am J Physiol Lung Cell Mol Physiol, May 1, 2008; 294(5): L921 - L931. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. H. Zeidan, B. X. Wu, R. W. Jenkins, L. M. Obeid, and Y. A. Hannun A novel role for protein kinase C{delta}-mediated phosphorylation of acid sphingomyelinase in UV light-induced mitochondrial injury FASEB J, January 1, 2008; 22(1): 183 - 193. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Christmann, M. T. Tomicic, D. Aasland, and B. Kaina A role for UV-light-induced c-Fos: stimulation of nucleotide excision repair and protection against sustained JNK activation and apoptosis Carcinogenesis, January 1, 2007; 28(1): 183 - 190. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Horiguchi, S. Arai, T. Nishihara, and J.-i. Nishikawa AIB1 Promotes DNA Replication by JNK Repression and AKT Activation during Cellular Stress J. Biochem., September 1, 2006; 140(3): 409 - 419. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Castellano, B. Vire, M. Pion, V. Quivy, D. Olive, I. Hirsch, C. Van Lint, and Y. Collette Active Transcription of the Human FASL/CD95L/TNFSF6 Promoter Region in T Lymphocytes Involves Chromatin Remodeling: ROLE OF DNA METHYLATION AND PROTEIN ACETYLATION SUGGEST DISTINCT MECHANISMS OF TRANSCRIPTIONAL REPRESSION J. Biol. Chem., May 26, 2006; 281(21): 14719 - 14728. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Y. Sherman and V. L. Gabai Multiple Thermometers in Mammalian Cells: Why Do Cells from Homeothermic Organisms Need to Measure Temperature? Sci. Signal., March 28, 2006; 2006(328): pe16 - pe16. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A Margalit, R. G Cowan, R. M Harman, and S. M Quirk Apoptosis of bovine ovarian surface epithelial cells by Fas antigen/Fas ligand signaling Reproduction, November 1, 2005; 130(5): 751 - 758. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Muthumani, A. Y. Choo, D. S. Hwang, A. Premkumar, N. S. Dayes, C. Harris, D. R. Green, S. A. Wadsworth, J. J. Siekierka, and D. B. Weiner HIV-1 Nef-induced FasL induction and bystander killing requires p38 MAPK activation Blood, September 15, 2005; 106(6): 2059 - 2068. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Zu, L. Hawthorn, and C. Ip Up-regulation of c-Jun-NH2-kinase pathway contributes to the induction of mitochondria-mediated apoptosis by {alpha}-tocopheryl succinate in human prostate cancer cells Mol. Cancer Ther., January 1, 2005; 4(1): 43 - 50. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W.-H. Wang, G. Gregori, R. L. Hullinger, and O. M. Andrisani Sustained Activation of p38 Mitogen-Activated Protein Kinase and c-Jun N-Terminal Kinase Pathways by Hepatitis B Virus X Protein Mediates Apoptosis via Induction of Fas/FasL and Tumor Necrosis Factor (TNF) Receptor 1/TNF-{alpha} Expression Mol. Cell. Biol., December 1, 2004; 24(23): 10352 - 10365. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Shrivastava, C. Pantano, R. Watkin, B. McElhinney, A. Guala, M. L. Poynter, R. L. Persinger, R. Budd, and Y. Janssen-Heininger Reactive Nitrogen Species-Induced Cell Death Requires Fas-Dependent Activation of c-Jun N-Terminal Kinase Mol. Cell. Biol., August 1, 2004; 24(15): 6763 - 6772. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Higuchi, A. Grambihler, A. Canbay, S. F. Bronk, and G. J. Gores Bile Acids Up-regulate Death Receptor 5/TRAIL-receptor 2 Expression via a c-Jun N-terminal Kinase-dependent Pathway Involving Sp1 J. Biol. Chem., January 2, 2004; 279(1): 51 - 60. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Crist, T. S. Griffith, and T. L. Ratliff Structure/Function Analysis of the Murine CD95L Promoter Reveals the Identification of a Novel Transcriptional Repressor and Functional CD28 Response Element J. Biol. Chem., September 19, 2003; 278(38): 35950 - 35958. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Peterson and E. Bogenmann Osmotic Swelling Induces p75 Neurotrophin Receptor (p75NTR) Expression via Nitric Oxide J. Biol. Chem., September 5, 2003; 278(36): 33943 - 33950. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. D. Smith, R. F. Collaco, and J. P. Trempe Enhancement of Recombinant Adeno-Associated Virus Type 2-Mediated Transgene Expression in a Lung Epithelial Cell Line by Inhibition of the Epidermal Growth Factor Receptor J. Virol., June 1, 2003; 77(11): 6394 - 6404. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Mansouri, L. D. Ridgway, A. L. Korapati, Q. Zhang, L. Tian, Y. Wang, Z. H. Siddik, G. B. Mills, and F. X. Claret Sustained Activation of JNK/p38 MAPK Pathways in Response to Cisplatin Leads to Fas Ligand Induction and Cell Death in Ovarian Carcinoma Cells J. Biol. Chem., May 23, 2003; 278(21): 19245 - 19256. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Luo, Y. Sun, H. Lin, Y. Qian, Z. Li, S. S. Leonard, C. Huang, and X. Shi Activation of JNK by Vanadate Induces a Fas-associated Death Domain (FADD)-dependent Death of Cerebellar Granule Progenitors in Vitro J. Biol. Chem., February 7, 2003; 278(7): 4542 - 4551. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-M. Yang, F. Bost, W. Charbono, N. Dean, R. McKay, J. S. Rhim, C. Depatie, and D. Mercola C-Jun NH2-terminal Kinase Mediates Proliferation and Tumor Growth of Human Prostate Carcinoma Clin. Cancer Res., January 1, 2003; 9(1): 391 - 401. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. M. W. Janssen-Heininger, R. L. Persinger, S. H. Korn, C. Pantano, B. McElhinney, N. L. Reynaert, R. C. J. Langen, K. Ckless, P. Shrivastava, and M. E. Poynter Reactive Nitrogen Species and Cell Signaling: Implications for Death or Survival of Lung Epithelium Am. J. Respir. Crit. Care Med., December 15, 2002; 166(12): S9 - 16. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ohtsuka and T. Zhou Bisindolylmaleimide VIII Enhances DR5-mediated Apoptosis through the MKK4/JNK/p38 Kinase and the Mitochondrial Pathways J. Biol. Chem., August 2, 2002; 277(32): 29294 - 29303. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Sanchez-Perez, S. A. Benitah, M. Martinez-Gomariz, J. C. Lacal, and R. Perona Cell Stress and MEKK1-mediated c-Jun Activation Modulate NFkappa B Activity and Cell Viability Mol. Biol. Cell, August 1, 2002; 13(8): 2933 - 2945. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Lei, A. Nimnual, W.-X. Zong, N. J. Kennedy, R. A. Flavell, C. B. Thompson, D. Bar-Sagi, and R. J. Davis The Bax Subfamily of Bcl2-Related Proteins Is Essential for Apoptotic Signal Transduction by c-Jun NH2-Terminal Kinase Mol. Cell. Biol., July 1, 2002; 22(13): 4929 - 4942. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. L. Gabai and M. Y. Sherman Molecular Biology of Thermoregulation: Invited Review: Interplay between molecular chaperones and signaling pathways in survival of heat shock J Appl Physiol, April 1, 2002; 92(4): 1743 - 1748. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Aoki, P. M. Kang, J. Hampe, K. Yoshimura, T. Noma, M. Matsuzaki, and S. Izumo Direct Activation of Mitochondrial Apoptosis Machinery by c-Jun N-terminal Kinase in Adult Cardiac Myocytes J. Biol. Chem., March 15, 2002; 277(12): 10244 - 10250. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. K. Schlesinger, C. Bonvin, M. B. Jarpe, G. R. Fanger, J.-R. Cardinaux, G. L. Johnson, and C. Widmann Apoptosis Stimulated by the 91-kDa Caspase Cleavage MEKK1 Fragment Requires Translocation to Soluble Cellular Compartments J. Biol. Chem., March 15, 2002; 277(12): 10283 - 10291. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. T. Miller and L. J. Berg Defective Fas Ligand Expression and Activation-Induced Cell Death in the Absence of IL-2-Inducible T Cell Kinase J. Immunol., March 1, 2002; 168(5): 2163 - 2172. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Amant, P. Holm, S.-h. Xu, N. Tritman, M. Kearney, and D. W. Losordo Estrogen Receptor-Mediated, Nitric Oxide-Dependent Modulation of the Immunologic Barrier Function of the Endothelium: Regulation of Fas Ligand Expression by Estradiol Circulation, November 20, 2001; 104(21): 2576 - 2581. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Jackle, C. Hasel, I. Melzner, S. Bruderlein, P. M. Jehle, and P. Moller Sustained hyposmotic stress induces cell death: apoptosis by defeat Am J Physiol Cell Physiol, November 1, 2001; 281(5): C1716 - C1726. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Herr and K.-M. Debatin Cellular stress response and apoptosis in cancer therapy Blood, November 1, 2001; 98(9): 2603 - 2614. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Morishima, Y. Gotoh, J. Zieg, T. Barrett, H. Takano, R. Flavell, R. J. Davis, Y. Shirasaki, and M. E. Greenberg {beta}-Amyloid Induces Neuronal Apoptosis Via a Mechanism that Involves the c-Jun N-Terminal Kinase Pathway and the Induction of Fas Ligand J. Neurosci., October 1, 2001; 21(19): 7551 - 7560. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. A. Figueroa-Masot, M. Hetman, M. J. Higgins, N. Kokot, and Z. Xia Taxol Induces Apoptosis in Cortical Neurons by a Mechanism Independent of Bcl-2 Phosphorylation J. Neurosci., July 1, 2001; 21(13): 4657 - 4667. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Kunz, S. Ibrahim, D. Koczan, H.-J. Thiesen, H. J. Köhler, T. Acker, K. H. Plate, S. Ludwig, U. R. Rapp, E.-B. Bröcker, et al. Activation of c-Jun NH2-Terminal Kinase/Stress-activated Protein Kinase (JNK/SAPK) Is Critical for Hypoxia-induced Apoptosis of Human Malignant Melanoma Cell Growth Differ., March 1, 2001; 12(3): 137 - 145. [Abstract] [Full Text]
|
|
|
|
 |
|
 C.-L. Hu, R. G. Cowan, R. M. Harman, D. A. Porter, and S. M. Quirk Apoptosis of Bovine Granulosa Cells After Serum Withdrawal Is Mediated by Fas Antigen (CD95) and Fas Ligand Biol Reprod, February 1, 2001; 64(2): 518 - 526. [Abstract] [Full Text]
|
|
|
|
|
|
S. T. Eichhorst, M. Müller, M. Li-Weber, H. Schulze-Bergkamen, P. Angel, and P. H. Krammer A Novel AP-1 Element in the CD95 Ligand Promoter Is Required for Induction of Apoptosis in Hepatocellular Carcinoma Cells upon Treatment with Anticancer Drugs Mol. Cell. Biol., October 15, 2000; 20(20): 7826 - 7837. [Abstract] [Full Text]
|
|
|
|
|
|
U. Namgung and Z. Xia Arsenite-Induced Apoptosis in Cortical Neurons Is Mediated by c-Jun N-Terminal Protein Kinase 3 and p38 Mitogen-Activated Protein Kinase J. Neurosci., September 1, 2000; 20(17): 6442 - 6451. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Fine, Y. Janssen-Heininger, R. P. Soultanakis, S. G. Swisher, and B. D. Uhal Apoptosis in lung pathophysiology Am J Physiol Lung Cell Mol Physiol, September 1, 2000; 279(3): L423 - L427. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Villunger, D. C. S. Huang, N. Holler, J. Tschopp, and A. Strasser Fas Ligand-Induced c-Jun Kinase Activation in Lymphoid Cells Requires Extensive Receptor Aggregation But Is Independent of DAXX, and Fas-Mediated Cell Death Does Not Involve DAXX, RIP, or RAIDD J. Immunol., August 1, 2000; 165(3): 1337 - 1343. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Melino, F. Bernassola, M. V. Catani, A. Rossi, M. Corazzari, S. Sabatini, F. Vilbois, and D. R. Green Nitric Oxide Inhibits Apoptosis via AP-1-dependent CD95L Transactivation Cancer Res., May 1, 2000; 60(9): 2377 - 2383. [Abstract] [Full Text]
|
|
|
|
|
|
I. Petak, D. M. Tillman, F. G. Harwood, R. Mihalik, and J. A. Houghton Fas-dependent and -independent Mechanisms of Cell Death following DNA Damage in Human Colon Carcinoma Cells Cancer Res., May 1, 2000; 60(10): 2643 - 2650. [Abstract] [Full Text]
|
|
|
|
|
|
F. G. Harwood, S. Kasibhatla, I. Petak, R. Vernes, D. R. Green, and J. A. Houghton Regulation of FasL by NF-kappa B and AP-1 in Fas-dependent Thymineless Death of Human Colon Carcinoma Cells J. Biol. Chem., March 31, 2000; 275(14): 10023 - 10029. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Merritt, H. Enslen, N. Diehl, D. Conze, R. J. Davis, and M. Rincón Activation of p38 Mitogen-Activated Protein Kinase In Vivo Selectively Induces Apoptosis of CD8+ but Not CD4+ T Cells Mol. Cell. Biol., February 1, 2000; 20(3): 936 - 946. [Abstract] [Full Text]
|
|
|
|
|
|
A. Kolbus, I. Herr, M. Schreiber, K.-M. Debatin, E. F. Wagner, and P. Angel c-Jun-Dependent CD95-L Expression Is a Rate-Limiting Step in the Induction of Apoptosis by Alkylating Agents Mol. Cell. Biol., January 15, 2000; 20(2): 575 - 582. [Abstract] [Full Text]
|
|
|
|
|
|
X. R. Li, A. S.-F. Chong, J. Wu, K. A. Roebuck, A. Kumar, J. E. Parrillo, U. R. Rapp, R. P. Kimberly, J. W. Williams, and X. Xu Transcriptional Regulation of Fas Gene Expression by GA-binding Protein and AP-1 in T Cell Antigen Receptor{middle dot}CD3 Complex-stimulated T Cells J. Biol. Chem., December 3, 1999; 274(49): 35203 - 35210. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L. Rawlings, G. M. Crooks, D. Bockstoce, L. W. Barsky, R. Parkman, and K. I. Weinberg Spontaneous Apoptosis in Lymphocytes From Patients With Wiskott-Aldrich Syndrome: Correlation of Accelerated Cell Death and Attenuated Bcl-2 Expression Blood, December 1, 1999; 94(11): 3872 - 3882. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. R. Datta, A. Brunet, and M. E. Greenberg Cellular survival: a play in three Akts Genes & Dev., November 15, 1999; 13(22): 2905 - 2927. [Full Text]
|
|
|
|
|
|
K. Noguchi, C. Kitanaka, H. Yamana, A. Kokubu, T. Mochizuki, and Y. Kuchino Regulation of c-Myc through Phosphorylation at Ser-62 and Ser-71 by c-Jun N-Terminal Kinase J. Biol. Chem., November 12, 1999; 274(46): 32580 - 32587. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Ruiz-Ruiz, G. Robledo, J. Font, M. Izquierdo, and A. Lopez-Rivas Protein Kinase C Inhibits CD95 (Fas/APO-1)-Mediated Apoptosis by at Least Two Different Mechanisms in Jurkat T Cells J. Immunol., November 1, 1999; 163(9): 4737 - 4746. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. I. McLean and S. L. Bachenheimer Activation of cJUN N-Terminal Kinase by Herpes Simplex Virus Type 1 Enhances Viral Replication J. Virol., October 1, 1999; 73(10): 8415 - 8426. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-C. Hsu, M. A. Gavrilin, M.-H. Tsai, J. Han, and M.-Z. Lai p38 Mitogen-activated Protein Kinase Is Involved in Fas Ligand Expression J. Biol. Chem., September 3, 1999; 274(36): 25769 - 25776. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. D. Glick, S. L. Swendeman, D. C. Coffey, R. A. Rifkind, P. A. Marks, V. M. Richon, and M. P. La Quaglia Hybrid Polar Histone Deacetylase Inhibitor Induces Apoptosis and CD95/CD95 Ligand Expression in Human Neuroblastoma Cancer Res., September 1, 1999; 59(17): 4392 - 4399. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. T. Abreu-Martin, A. Chari, A. A. Palladino, N. A. Craft, and C. L. Sawyers Mitogen-Activated Protein Kinase Kinase Kinase 1 Activates Androgen Receptor-Dependent Transcription and Apoptosis in Prostate Cancer Mol. Cell. Biol., July 1, 1999; 19(7): 5143 - 5154. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Martin-Villalba, I. Herr, I. Jeremias, M. Hahne, R. Brandt, J. Vogel, J. Schenkel, T. Herdegen, and K.-M. Debatin CD95 Ligand (Fas-L/APO-1L) and Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Mediate Ischemia-Induced Apoptosis in Neurons J. Neurosci., May 15, 1999; 19(10): 3809 - 3817. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Kempiak, T. S. Hiura, and A. E. Nel The Jun Kinase Cascade Is Responsible for Activating the CD28 Response Element of the IL-2 Promoter: Proof of Cross-Talk with the I{kappa}B Kinase Cascade J. Immunol., March 15, 1999; 162(6): 3176 - 3187. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. T. Abreu-Martin, A. A. Palladino, M. Faris, N. M. Carramanzana, A. E. Nel, and S. R. Targan Fas activates the JNK pathway in human colonic epithelial cells: lack of a direct role in apoptosis Am J Physiol Gastrointest Liver Physiol, March 1, 1999; 276(3): G599 - G605. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Le-Niculescu, E. Bonfoco, Y. Kasuya, F.-X. Claret, D. R. Green, and M. Karin Withdrawal of Survival Factors Results in Activation of the JNK Pathway in Neuronal Cells Leading to Fas Ligand Induction and Cell Death Mol. Cell. Biol., January 1, 1999; 19(1): 751 - 763. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. WIDMANN, S. GIBSON, M. B. JARPE, and G. L. JOHNSON Mitogen-Activated Protein Kinase: Conservation of a Three-Kinase Module From Yeast to Human Physiol Rev, January 1, 1999; 79(1): 143 - 180. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kasai, K. Ohguchi, S. Nakashima, Y. Ito, T. Naganawa, N. Kondo, and Y. Nozawa Increased Activity of Oleate-Dependent Type Phospholipase D During Actinomycin D-Induced Apoptosis in Jurkat T Cells J. Immunol., December 15, 1998; 161(12): 6469 - 6474. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Faris, K. M. Latinis, S. J. Kempiak, G. A. Koretzky, and A. Nel Stress-Induced Fas Ligand Expression in T Cells Is Mediated through a MEK Kinase 1-Regulated Response Element in the Fas Ligand Promoter Mol. Cell. Biol., September 1, 1998; 18(9): 5414 - 5424. [Abstract] [Full Text]
|
|
|
|
|
|
T. Hatai, A. Matsuzawa, S. Inoshita, Y. Mochida, T. Kuroda, K. Sakamaki, K. Kuida, S. Yonehara, H. Ichijo, and K. Takeda Execution of Apoptosis Signal-regulating Kinase 1 (ASK1)-induced Apoptosis by the Mitochondria-dependent Caspase Activation J. Biol. Chem., August 18, 2000; 275(34): 26576 - 26581. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Chen and M.-Z. Lai c-Jun NH2-terminal Kinase Activation Leads to a FADD-dependent but Fas Ligand-independent Cell Death in Jurkat T Cells J. Biol. Chem., March 9, 2001; 276(11): 8350 - 8357. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. Kavurma, F. S. Santiago, E. Bonfoco, and L. M. Khachigian Sp1 Phosphorylation Regulates Apoptosis via Extracellular FasL-Fas Engagement J. Biol. Chem., February 9, 2001; 276(7): 4964 - 4971. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
– or absence –
– of
0.1 µg/ml of tet for the indicated time period. Cell viability was
measured by trypan blue exclusion. Duplicate counts were performed by
two independent observers. Similar results were obtained in three
separate experiments. B, In vitro JNK assay showing the
time-dependent activation of JNK by DA-MEKK1. Duplicate aliquots of the
cell populations shown above were lysed and assayed for JNK activity
using the kinase assay described in Figure 1
